ID: 1183304736

View in Genome Browser
Species Human (GRCh38)
Location 22:37076539-37076561
Sequence GCCCATGCCCTGGAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1840
Summary {0: 1, 1: 0, 2: 9, 3: 149, 4: 1681}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183304736_1183304745 5 Left 1183304736 22:37076539-37076561 CCTCCCATCTCCAGGGCATGGGC 0: 1
1: 0
2: 9
3: 149
4: 1681
Right 1183304745 22:37076567-37076589 GGTTCCTCCTGCAGAGAGTCCGG 0: 1
1: 0
2: 3
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183304736 Original CRISPR GCCCATGCCCTGGAGATGGG AGG (reversed) Intronic
900102127 1:966420-966442 GCCCAGGCCCTGGTGCCGGGCGG + Intergenic
900461933 1:2805789-2805811 GCCCGTCCCCTGGGGCTGGGTGG - Intergenic
900889469 1:5439065-5439087 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
901008742 1:6185829-6185851 TCCCATGCCAAGGAGGTGGGAGG - Exonic
901101934 1:6725769-6725791 GCCCTGGTTCTGGAGATGGGTGG + Intergenic
901124758 1:6921217-6921239 GCCCCTGCCCTAGAGATCTGTGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902085253 1:13855355-13855377 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
903574780 1:24332461-24332483 GCACACGCACTGGAGGTGGGAGG - Intronic
903933265 1:26876830-26876852 ACCCATGGAGTGGAGATGGGTGG - Exonic
904386249 1:30144046-30144068 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
904427242 1:30436869-30436891 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
905357868 1:37397200-37397222 GCACATGCATTGGAGATGAGAGG - Intergenic
906020716 1:42627228-42627250 GCCCCTGCCCTAGAGATTTGTGG + Intronic
906287676 1:44598235-44598257 GCTCATGACCTGGGGAGGGGTGG - Intronic
906319697 1:44808418-44808440 GGGCCTGCCCGGGAGATGGGTGG + Intergenic
906372803 1:45268996-45269018 GCCCCTGCCCTAGAGATTTGTGG + Intronic
906463702 1:46057664-46057686 GCCCCTGCCCTAGAGATTTGTGG + Intronic
906655061 1:47542185-47542207 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
906664417 1:47609077-47609099 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
906760557 1:48373291-48373313 GCCCCTGCCCTAGAGATTTGTGG - Intronic
906938376 1:50234586-50234608 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
907392327 1:54166286-54166308 GCCCCTGCCCTAGAGATTTGTGG - Intronic
907439065 1:54467561-54467583 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
907522228 1:55031609-55031631 GCCCCTGCCCTTGAGATTTGCGG + Intergenic
907555812 1:55343546-55343568 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
907616848 1:55934655-55934677 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
907625214 1:56022843-56022865 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
907854711 1:58291255-58291277 GACCATGGCCTGGAGACAGGGGG + Intronic
907862905 1:58371277-58371299 GCCCCTGCCCTAGAGATCTGTGG + Intronic
907890850 1:58635378-58635400 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
908047421 1:60185394-60185416 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
908729117 1:67208075-67208097 GCCCCTGCCCTAGAGATCTGTGG + Intronic
908866435 1:68553992-68554014 GCCCATGCCCTAGAGATTTATGG + Intergenic
908885126 1:68780357-68780379 TCCCCTGCCCTGGAGATCTGTGG + Intergenic
909023943 1:70462130-70462152 GCCCCTGTCCTGGAGATCTGTGG + Intergenic
909086294 1:71173087-71173109 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
909167491 1:72247495-72247517 GCCCCTGCCCTAGAGATCTGTGG - Intronic
909192510 1:72572520-72572542 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
909257133 1:73438623-73438645 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
909293396 1:73912865-73912887 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
909376699 1:74949817-74949839 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
909405192 1:75281299-75281321 GCCCCTGCCCTAGAGATCTGTGG + Intronic
909436299 1:75646786-75646808 GCCCATGCCCTAGAGATCTGTGG + Intergenic
909457702 1:75869219-75869241 TCCCCTGCCCTGGAGATCTGTGG + Intronic
909574473 1:77158671-77158693 GCCCCTGCCCTAGAGATCTGTGG + Intronic
909599916 1:77450046-77450068 GCCCCTGCCCTAGAGATTTGTGG - Intronic
909710921 1:78648001-78648023 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
909774354 1:79465084-79465106 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
909794805 1:79719819-79719841 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
909807079 1:79884823-79884845 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
910055758 1:83031692-83031714 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
910166958 1:84337914-84337936 GCCCCTGCCCTAGAGATTTGTGG - Intronic
910409479 1:86925104-86925126 GCCCCTGCCCTAGAGATCTGTGG - Intronic
910417247 1:87013865-87013887 GCCCCTGCCCTGGAGACCTGTGG - Intronic
911007692 1:93243704-93243726 GCCCCTGCCCTAGAGATTTGTGG - Intronic
911011720 1:93288046-93288068 GCCCCTGCCCTAGAGATCCGTGG + Intergenic
911309412 1:96275148-96275170 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
911331337 1:96529152-96529174 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
911358418 1:96848655-96848677 GCCCCTGCCCTAGAGATTCGTGG + Intergenic
911407741 1:97463787-97463809 GCCCCTGCCCTAGAGATCTGTGG + Intronic
911430151 1:97774585-97774607 GCCCAGGCACCCGAGATGGGAGG - Intronic
911500654 1:98680665-98680687 GCCCCTGCCCTAGAGATTTGTGG - Intronic
911511285 1:98809897-98809919 GCCCCTGCCCTGGCGATCTGTGG - Intergenic
911541527 1:99163545-99163567 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
911629509 1:100166541-100166563 GCCCCTGCCCTAGAGATCTGTGG + Intronic
911666997 1:100564765-100564787 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
911686347 1:100781272-100781294 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
911790848 1:102013955-102013977 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
911799096 1:102110803-102110825 GCCTCTGCCCTAGAGATGTGTGG - Intergenic
911831165 1:102552874-102552896 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
911855404 1:102869701-102869723 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
912004286 1:104878005-104878027 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
912096353 1:106149502-106149524 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
912135562 1:106656612-106656634 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
912153213 1:106883766-106883788 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
912165589 1:107039342-107039364 GCCCATGCCCTAGAGATTTGTGG + Intergenic
912182625 1:107237235-107237257 GCCCCTGCCCTAGAGATTTGTGG + Intronic
912263664 1:108132922-108132944 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
912267518 1:108173896-108173918 GCCCCTGCCCTAGAGATCTGTGG + Intronic
912625632 1:111203304-111203326 GCCCAAGCCCCAGAGTTGGGGGG - Intronic
912746637 1:112250660-112250682 GCCCAGGCTCAGGAAATGGGTGG - Intergenic
912890351 1:113523570-113523592 GCCCCTGCCCTAGAGATTTGTGG + Intronic
913278142 1:117158880-117158902 GCCCCTGCCCTCGAGATTTGTGG - Intronic
913307702 1:117450261-117450283 GCTCCTGCCCTAGAGATGTGTGG + Intronic
913336858 1:117716707-117716729 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
913383842 1:118238627-118238649 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
913458916 1:119063197-119063219 GCCCCTGCCCTAGAGATTTGTGG + Intronic
913489274 1:119363773-119363795 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
913526765 1:119701225-119701247 GCCCCTGCCCTAGAGATCTGTGG + Intronic
915058505 1:153159277-153159299 GCCTCTGCCCTGGAGATGTGTGG - Intergenic
915087724 1:153399433-153399455 ACCCAAGCCCTGGAGCTGAGAGG - Intergenic
915511717 1:156390335-156390357 GCTAATGCCTTGGAGATGGAGGG - Intergenic
915654928 1:157351493-157351515 GCCCATGCCCTAGAGATTTGTGG - Intergenic
915711020 1:157897803-157897825 GCCCTTGCCCTAGAGATTTGTGG - Intronic
915811672 1:158919931-158919953 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
915885597 1:159717807-159717829 GCCCATGCCCTAGAGATCTGTGG + Intergenic
916296848 1:163228801-163228823 GCCCTTGCCCTAGAGATCTGTGG - Intronic
916302874 1:163294898-163294920 GCCCCTGCCCTAGAGATCTGTGG - Intronic
916993055 1:170265736-170265758 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
917120674 1:171642242-171642264 GTTAATGCCCTGGAGGTGGGTGG + Intronic
917547237 1:175983847-175983869 GCCCCTGCCCTAGAGATCTGTGG + Intronic
917681902 1:177375952-177375974 GCCTCTGCCCTGGAGATTTGTGG - Intergenic
917926672 1:179794946-179794968 GCCCAGGCCTTGGAGTTGGGAGG - Intronic
918007930 1:180559430-180559452 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
918119794 1:181528722-181528744 GCCCCTGCCCTAGAGATTTGTGG + Intronic
918485941 1:185028089-185028111 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
918613937 1:186523246-186523268 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
918718219 1:187818679-187818701 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
918727696 1:187947132-187947154 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
918800092 1:188960493-188960515 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
918831645 1:189405909-189405931 GCCCCTGCCCTAGAGATATGTGG - Intergenic
918871308 1:189978084-189978106 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
918935181 1:190912587-190912609 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
918955792 1:191205335-191205357 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
919200325 1:194348377-194348399 TCCCCTGCCCTGGAGATTTGTGG + Intergenic
919290407 1:195623202-195623224 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
919308852 1:195879056-195879078 GCCCGTGCCCTAGAGATCTGTGG - Intergenic
919388791 1:196955179-196955201 GCCCCTGCCCTGAAGATGTGTGG - Intronic
919394000 1:197022408-197022430 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
919536813 1:198797560-198797582 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
919593509 1:199533222-199533244 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
920310321 1:205044510-205044532 GCCCCAGCCCTGGAGAAAGGTGG + Intronic
920324801 1:205154903-205154925 GCCCCTGCCCTAGAGATCCGTGG + Intronic
920734368 1:208517403-208517425 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
920860396 1:209700834-209700856 GCCCCTGCCCTAGAGATTTGTGG - Intronic
921466277 1:215492117-215492139 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
921496961 1:215853721-215853743 GCCCCTGCCCTAGAGATTTGTGG - Intronic
921724287 1:218507217-218507239 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
921880434 1:220249404-220249426 GCCCCTGCCCTAGAGGTTGGTGG + Intronic
922011016 1:221587670-221587692 GCCCCTGACCTAGAGATGTGTGG + Intergenic
922058469 1:222064283-222064305 GCCCCTGCCCTGGAGAATTGTGG - Intergenic
922175737 1:223195646-223195668 GCCCAGCCCCTGGAGTTGTGAGG - Intergenic
922179656 1:223223821-223223843 GCCCATGCTCCGGAGAGAGGAGG + Intronic
922273874 1:224058594-224058616 AGCCATGGCCTGGAGATTGGTGG - Intergenic
922278035 1:224097437-224097459 GCCCAACCCCTGAAGATGGCAGG + Intergenic
922393947 1:225177198-225177220 GCCCCTGCCCTAGAGATTTGTGG + Intronic
922530375 1:226340786-226340808 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
922535701 1:226379238-226379260 GCGCATGTCCTGGAGAAAGGTGG - Exonic
922667907 1:227488414-227488436 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
923198086 1:231686911-231686933 GCCCCTGCCCTAGAGATTTGTGG - Intronic
923427962 1:233891024-233891046 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
923878446 1:238076055-238076077 GCCCATGCCCTAGAGATCCATGG - Intergenic
923891018 1:238214895-238214917 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
924036646 1:239944595-239944617 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
924806500 1:247365907-247365929 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
924862158 1:247936394-247936416 GCCCATGCCCTGGACATGGCAGG + Intergenic
924936523 1:248776781-248776803 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1062859182 10:796755-796777 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1062878264 10:959064-959086 GCCGAGTCCCTGGAGATGGCAGG + Intergenic
1062958235 10:1554138-1554160 GGGCCTGCCCTGCAGATGGGTGG - Intronic
1063335744 10:5211448-5211470 GTCCCTGCCCTAGAGATGTGTGG - Intronic
1063626303 10:7692905-7692927 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1064793802 10:18988930-18988952 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1065405275 10:25357096-25357118 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1065408058 10:25390502-25390524 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1066048382 10:31614055-31614077 ACCCCTGCCCTGGAGTCGGGAGG + Intergenic
1067064003 10:43093544-43093566 GCCCAGGGCCTGGATATGGCTGG + Intronic
1067202738 10:44187275-44187297 GCCCAGGCCATGGAGATGAAAGG - Intergenic
1067702315 10:48582872-48582894 GACCATGCCCAGGAGAAGGGAGG - Intronic
1067711317 10:48653447-48653469 GCCCATGCCTTGGGGATCTGTGG + Intronic
1067812388 10:49439821-49439843 GCCCCTGCCCTAGAGATGTGTGG - Intergenic
1067814614 10:49464257-49464279 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1067901919 10:50250670-50250692 GTCCATGCTCTGGGGTTGGGAGG - Intergenic
1067911363 10:50350193-50350215 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1068128351 10:52868227-52868249 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1068289856 10:54988599-54988621 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1068431115 10:56934111-56934133 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1068439355 10:57031803-57031825 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1068452714 10:57212521-57212543 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1068495136 10:57777181-57777203 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1068519554 10:58063411-58063433 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1069095114 10:64249773-64249795 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1069173691 10:65263307-65263329 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1069189214 10:65466543-65466565 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1070456300 10:76620564-76620586 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1070552964 10:77505351-77505373 CTCCATGCCCTGGCAATGGGGGG + Intronic
1070830037 10:79412469-79412491 GCCCAGTCCCTGGAGATGGGTGG - Intronic
1070870000 10:79743294-79743316 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1071034786 10:81232508-81232530 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1071327666 10:84533383-84533405 GCCCCTGCCCTAGAGATATGTGG + Intergenic
1071360060 10:84837724-84837746 GCAGATGCCCTGGAATTGGGAGG + Intergenic
1071392653 10:85190929-85190951 ATCCCTGCCCTGGAGATGGCTGG + Intergenic
1071636925 10:87265514-87265536 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1071658323 10:87472440-87472462 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1071738244 10:88326434-88326456 GTCCCTGCCCTAGAGATGTGTGG + Intronic
1071873526 10:89819542-89819564 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1071981099 10:91004908-91004930 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1072289141 10:93946796-93946818 GCCCATGCCGTGGTCAAGGGAGG + Intronic
1072647469 10:97268148-97268170 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1073401244 10:103259412-103259434 GCCCCTGCCCTGGAGATTTGTGG + Intergenic
1073627925 10:105118761-105118783 GCCCTTGCCCTGGAGATCTGTGG + Intronic
1073776308 10:106789492-106789514 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1073817649 10:107224886-107224908 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1073991041 10:109262282-109262304 GCCCCTGCCCTCGAGATCAGTGG - Intergenic
1074242052 10:111649572-111649594 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1074286334 10:112101308-112101330 GCCCCTGCCCTAGAGATTCGTGG - Intergenic
1074622424 10:115139013-115139035 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1074640164 10:115370555-115370577 GCCCTTGCCCTAGAGATTTGTGG + Intronic
1074898051 10:117794002-117794024 CCCAAGGCCATGGAGATGGGAGG + Intergenic
1075082878 10:119395729-119395751 GCCCAAGCTCTAAAGATGGGAGG - Intronic
1075209935 10:120482423-120482445 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1075281740 10:121144553-121144575 CCCCCTGCCCTGGAGATTTGTGG - Intergenic
1075319304 10:121477224-121477246 GCCCATTTCATGGAGATGGGTGG - Intergenic
1075550270 10:123387734-123387756 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1075599245 10:123755209-123755231 GGCCAGCCCCTGGAGGTGGGTGG + Intronic
1075826230 10:125359011-125359033 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1076483397 10:130799869-130799891 GCCCATTTCCTAGAGATGGTGGG + Intergenic
1076689627 10:132215991-132216013 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1076760168 10:132600315-132600337 GCCCGTGCCCTAGAGATGTGTGG - Intronic
1076846495 10:133071871-133071893 GCCCCAGCCCTGGAGAAGGAGGG + Intronic
1076994745 11:292456-292478 GCCCTCGCCCTGGAGGAGGGGGG - Intronic
1077239207 11:1501898-1501920 GCGCCTGCCATGGAGATGGGAGG + Intergenic
1077425261 11:2473100-2473122 TCCCATGGACTTGAGATGGGTGG - Intronic
1077484486 11:2832539-2832561 GCCAAGGCCCTGGGCATGGGCGG - Intronic
1078301538 11:10135609-10135631 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1078364951 11:10699007-10699029 GCCCCTGCACTGGAGATTTGTGG + Intergenic
1078514893 11:12013730-12013752 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1078515971 11:12022893-12022915 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1078518082 11:12041503-12041525 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1078713032 11:13813479-13813501 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1078994840 11:16686455-16686477 GTCCATGCCCTAGAGATCTGTGG - Intronic
1079203771 11:18396249-18396271 GCCCAAGTCCGGAAGATGGGCGG - Exonic
1079272873 11:19005158-19005180 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1079500328 11:21095141-21095163 GCCCCTGCCCTAGAGATGTGTGG - Intronic
1079537054 11:21527138-21527160 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1079546751 11:21642608-21642630 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1079644274 11:22843948-22843970 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1079733227 11:23962140-23962162 GCCCATGTCCTGCATCTGGGAGG - Intergenic
1079834915 11:25322642-25322664 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1079838728 11:25367417-25367439 GCCCCTGCCGTAGAGATGTGTGG - Intergenic
1079880653 11:25922490-25922512 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1079957300 11:26881384-26881406 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1080182679 11:29443482-29443504 GGCCATACCCTGGGGATGTGTGG - Intergenic
1080204973 11:29717756-29717778 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1080215125 11:29831653-29831675 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1080232591 11:30034655-30034677 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1080341813 11:31273413-31273435 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1080359463 11:31495046-31495068 GCCACTGCCCTGGAGATCCGTGG - Intronic
1080449825 11:32369498-32369520 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1080843414 11:36005352-36005374 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1080959932 11:37146340-37146362 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1080982457 11:37424532-37424554 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1081137000 11:39450825-39450847 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1081157702 11:39715668-39715690 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1081270606 11:41077991-41078013 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1081278934 11:41184435-41184457 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1081315645 11:41626013-41626035 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1081386557 11:42479654-42479676 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1081437366 11:43041520-43041542 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1081911884 11:46705103-46705125 GCCCATGCCCTGTGTGTGGGCGG + Exonic
1082652152 11:55806790-55806812 GCCCATGCCTTAGAGATCTGTGG - Intergenic
1082766305 11:57170544-57170566 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1083517981 11:63278500-63278522 GGCCATTCACTGGAGATGGCTGG + Intronic
1084200126 11:67551342-67551364 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1084200777 11:67556649-67556671 TTCCATGCACTGCAGATGGGAGG - Intergenic
1085647508 11:78235626-78235648 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1085754949 11:79194589-79194611 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1085987048 11:81800344-81800366 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1086006692 11:82046782-82046804 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1086503590 11:87479060-87479082 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1086519314 11:87651564-87651586 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1086580440 11:88392401-88392423 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1086721649 11:90128448-90128470 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1086750643 11:90489729-90489751 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1086758966 11:90603287-90603309 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1086764246 11:90675321-90675343 GCCCATGCCCTAGAGATTTGTGG + Intergenic
1086769459 11:90744256-90744278 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1086826820 11:91508435-91508457 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1086840263 11:91676077-91676099 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1087497261 11:98907506-98907528 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1087511672 11:99102556-99102578 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1087763588 11:102126952-102126974 GCCCTTGCCCTAGAGATTTGTGG + Intronic
1087793558 11:102432437-102432459 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1087849311 11:103010076-103010098 TCCCATGCCCTAGAGATCTGTGG - Intergenic
1088013951 11:105037028-105037050 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1088443940 11:109902525-109902547 GCCCCTGCCCTAGAGATTAGTGG - Intergenic
1088496989 11:110441543-110441565 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1088762865 11:112948831-112948853 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1088850759 11:113701444-113701466 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1089088898 11:115849585-115849607 GGCCCTGCTCTGGAGATGGCGGG - Intergenic
1089405078 11:118191170-118191192 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1090431543 11:126650506-126650528 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1090548780 11:127795541-127795563 GCACATGCCAGGTAGATGGGAGG + Intergenic
1090679811 11:129042894-129042916 GCTCATGCCGAGGAGATGGGAGG + Intronic
1090692504 11:129199034-129199056 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1092162871 12:6325631-6325653 GCCTCTGCCCTGAAGCTGGGAGG - Intronic
1092325703 12:7528867-7528889 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1092459265 12:8672043-8672065 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1092485943 12:8902088-8902110 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1092944395 12:13439481-13439503 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1093038220 12:14352870-14352892 GCCCCTGCCCTAGAGATATGTGG - Intergenic
1093076088 12:14760349-14760371 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1093206982 12:16263304-16263326 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1093238639 12:16641551-16641573 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1093590520 12:20896441-20896463 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1093605034 12:21078787-21078809 GCCCCTACCCTGGAGATCTGTGG - Intronic
1093661917 12:21767317-21767339 GTCCCTGGCCTGGAGGTGGGGGG - Intronic
1093753621 12:22829262-22829284 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1094421864 12:30279690-30279712 GCCCCTGCCCTAGAGATTTGCGG + Intergenic
1094716107 12:33016867-33016889 GCCCCCACCCTGGAGATGTGTGG + Intergenic
1094762511 12:33550866-33550888 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1095039633 12:37426936-37426958 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1095131657 12:38549585-38549607 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
1095234923 12:39784856-39784878 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1095252540 12:39996217-39996239 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1095308110 12:40662109-40662131 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1095511066 12:42952387-42952409 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1095623137 12:44282535-44282557 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1096522047 12:52189877-52189899 GCCCCTGCCATGGGGATGGGAGG - Intronic
1097131708 12:56815999-56816021 GCCCATACCGTGGATAGGGGAGG + Intergenic
1097146489 12:56942937-56942959 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1097302829 12:58036398-58036420 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1097609842 12:61806803-61806825 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1097617343 12:61898985-61899007 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1097669014 12:62514027-62514049 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1097758049 12:63428123-63428145 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1098163972 12:67674048-67674070 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1098355409 12:69608274-69608296 GCAAATGCTCTGCAGATGGGAGG + Intergenic
1098509250 12:71292269-71292291 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1098521219 12:71437028-71437050 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1098648860 12:72939915-72939937 GCCCATGACCTGGAGATTTGTGG - Intergenic
1098686281 12:73425029-73425051 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1098771668 12:74560295-74560317 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1098836854 12:75434029-75434051 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1099075581 12:78103243-78103265 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1099076386 12:78114029-78114051 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1099214516 12:79838233-79838255 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1099229385 12:80004289-80004311 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1099386360 12:82018290-82018312 GCCCCTGCCCTGGAGATCTGTGG + Intergenic
1099407379 12:82281192-82281214 GCCCTTGCCCTAGAGATCTGTGG + Intronic
1099503600 12:83445977-83445999 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1099525840 12:83718712-83718734 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1099663556 12:85597119-85597141 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1099707781 12:86179670-86179692 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1099846252 12:88031721-88031743 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1099929173 12:89053523-89053545 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1100032313 12:90208635-90208657 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1100054252 12:90490209-90490231 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1100170677 12:91971353-91971375 GCCCATGCCCTACAGATTTGTGG - Intergenic
1100658044 12:96667938-96667960 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1100769763 12:97908985-97909007 GCCAATGCAGTGGGGATGGGTGG + Intergenic
1100929203 12:99586266-99586288 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1100971857 12:100079441-100079463 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1101033918 12:100686089-100686111 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1101051996 12:100873503-100873525 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1101083686 12:101214212-101214234 GCCCCTGCCCTGGAGATTTGTGG + Intergenic
1101113186 12:101506250-101506272 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1101340373 12:103837615-103837637 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1101516453 12:105439921-105439943 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1101663655 12:106789105-106789127 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1102180576 12:110909608-110909630 CCATATGGCCTGGAGATGGGAGG - Intergenic
1102235363 12:111291211-111291233 ACCCATACCCTGGAGATAGCAGG + Intronic
1102249003 12:111373136-111373158 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1102589967 12:113949639-113949661 GCAAATTCCCTGGAGTTGGGAGG - Intronic
1102758676 12:115366495-115366517 GCTCCTGCCCTGGAGATTTGTGG + Intergenic
1103588306 12:121972422-121972444 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1103614794 12:122145311-122145333 GCCCATGGGCGGGAAATGGGAGG - Exonic
1103931166 12:124451847-124451869 GGCCCTTCCCTGGGGATGGGTGG - Intronic
1103952648 12:124559342-124559364 GGGAATGCCCTGGAGGTGGGGGG - Intronic
1104079926 12:125420922-125420944 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1104780111 12:131414359-131414381 GCCCATGCCCTGCAGATCCAAGG + Intergenic
1104785308 12:131444818-131444840 GCCATGGCCCTGGGGATGGGGGG - Intergenic
1104830083 12:131744402-131744424 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1105502862 13:20988293-20988315 GAGCATGCCCTGGCGCTGGGCGG - Exonic
1105580189 13:21688330-21688352 AGGCATGCCCTGGAGATGGGTGG + Intronic
1105694056 13:22871097-22871119 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1106106527 13:26738108-26738130 GACCCTGCCCTGGAGATTTGTGG + Intergenic
1106416893 13:29553329-29553351 GCCAGTGCCCAGGAGCTGGGTGG + Intronic
1106614636 13:31315416-31315438 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1106678177 13:31983883-31983905 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1106684365 13:32042524-32042546 ACCCACAGCCTGGAGATGGGAGG + Intronic
1106932266 13:34679446-34679468 GACCATGCCTGGGAGAAGGGTGG - Intergenic
1107330629 13:39296100-39296122 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1107641278 13:42446368-42446390 GCCCCTGCCCTAGAGATCTGCGG + Intergenic
1108155976 13:47584849-47584871 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1108219188 13:48216121-48216143 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1108603614 13:52016128-52016150 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1108719719 13:53118410-53118432 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1108790599 13:53965779-53965801 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1108872694 13:55005950-55005972 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1108933889 13:55863947-55863969 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1108971545 13:56382073-56382095 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1109084460 13:57951863-57951885 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1109097808 13:58141260-58141282 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1109171842 13:59107090-59107112 GCCCCTGCCCTCGAGATCTGTGG + Intergenic
1109285933 13:60408608-60408630 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1109334032 13:60970600-60970622 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1109337095 13:61007535-61007557 GCCCCTGCCCTAGAGATCTGCGG + Intergenic
1109347026 13:61126417-61126439 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1109390111 13:61682180-61682202 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1109393730 13:61726141-61726163 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1109476242 13:62883067-62883089 ACCCATGCCCTAGAGATCTGTGG - Intergenic
1109480483 13:62945750-62945772 GCCCCTGCCCTAGAGATTTGCGG - Intergenic
1109522432 13:63531574-63531596 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1109641895 13:65202338-65202360 GCCCCTGCCCTAGAGATATGTGG + Intergenic
1109810626 13:67508841-67508863 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1109863075 13:68225512-68225534 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1110166310 13:72447708-72447730 GCCCCTGCCCTAGAGAAGTGTGG + Intergenic
1110496590 13:76174719-76174741 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1110559838 13:76898933-76898955 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1110740649 13:78991874-78991896 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1110793716 13:79613177-79613199 GCCCCTGCCCTAGAAATGTGTGG - Intergenic
1110852825 13:80263880-80263902 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1110913315 13:80990775-80990797 GCCCCTGCCCTAGAGATATGTGG - Intergenic
1110926942 13:81165168-81165190 GCCCCTTCCCTGGAGATCTGTGG - Intergenic
1111050831 13:82881940-82881962 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1111083423 13:83342450-83342472 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1111103095 13:83612314-83612336 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1111212559 13:85098463-85098485 GCCCCTGCCCTGGAGATCTGTGG + Intergenic
1111218891 13:85179230-85179252 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1111421549 13:88018421-88018443 GTCCCTGCCCTGGAGATCTGTGG + Intergenic
1111505538 13:89184257-89184279 GCCCCTGCCCTTGAGATCTGTGG - Intergenic
1111527690 13:89493010-89493032 GTCCCTGCCCTGGAGATCTGTGG - Intergenic
1111539405 13:89651073-89651095 ACCCCTGCCCTGGAGATTAGTGG - Intergenic
1111594049 13:90388927-90388949 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1111614989 13:90651862-90651884 GCCCCTGCCCTAGAGATCAGTGG + Intergenic
1111687307 13:91517357-91517379 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1111719002 13:91917671-91917693 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1111769920 13:92584391-92584413 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1111819234 13:93193517-93193539 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1112031432 13:95460024-95460046 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1112424872 13:99289151-99289173 GACACTGGCCTGGAGATGGGTGG - Intronic
1112568299 13:100569847-100569869 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1112623554 13:101077563-101077585 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1112744127 13:102508193-102508215 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1112799403 13:103093532-103093554 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1112857324 13:103787285-103787307 GCCCCTGCCCTGGATATCTGTGG - Intergenic
1113203163 13:107888751-107888773 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1113248686 13:108427586-108427608 GCCCATGCACAGGAGAGAGGCGG + Intergenic
1113457032 13:110456724-110456746 GCCCATGCCCTGTGTCTGGGGGG + Intronic
1113502005 13:110783127-110783149 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1113942710 13:114026709-114026731 GCACAGGCCCTGGAGATGTGAGG - Intronic
1114170990 14:20272487-20272509 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1114380436 14:22198141-22198163 GCCCCTGCCCTGGAGATTTGTGG + Intergenic
1114531878 14:23401606-23401628 ACCCTTGCCCTGGAGAGGCGAGG - Intronic
1114669277 14:24400153-24400175 TCCCAGCCCTTGGAGATGGGTGG + Intronic
1114680548 14:24480523-24480545 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1114707102 14:24738212-24738234 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1114839685 14:26248662-26248684 GCCCCTGCCTTAGAGATGTGTGG + Intergenic
1114954772 14:27804524-27804546 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1114984463 14:28209833-28209855 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1114986178 14:28231287-28231309 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1114989831 14:28272899-28272921 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1115007225 14:28499798-28499820 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1115068933 14:29297642-29297664 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1115113596 14:29854406-29854428 GCCCCTGCCCTAGAGATGTGTGG + Intronic
1115115812 14:29879851-29879873 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1115340405 14:32287666-32287688 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1115609276 14:35035912-35035934 GCCTCTGCCCTGGAGATTTGTGG - Intergenic
1116079794 14:40157161-40157183 GCCCCTGCCCTGAAGATTTGGGG - Intergenic
1116091039 14:40307435-40307457 GCCCATGCCCTAGGGATCTGTGG + Intergenic
1116127126 14:40801587-40801609 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1116263402 14:42659655-42659677 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1116264817 14:42674548-42674570 GCTCCTGCCCTAGAGATGTGTGG - Intergenic
1116420006 14:44721874-44721896 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1116590192 14:46761759-46761781 GCCCTTGCCCTAGAGATGTGTGG - Intergenic
1116780785 14:49235831-49235853 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1116784047 14:49268364-49268386 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1116789649 14:49326978-49327000 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1116986325 14:51223590-51223612 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1116998170 14:51346104-51346126 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1117084190 14:52181832-52181854 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1117193009 14:53312226-53312248 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1117746635 14:58876113-58876135 GCCTATGCCCTAAGGATGGGAGG - Intergenic
1117840897 14:59859830-59859852 GCCCTTGCCCTAGAGATTTGTGG + Intronic
1118060902 14:62136421-62136443 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1118083265 14:62386829-62386851 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1118120067 14:62830046-62830068 GCCCCTGCCCTAGAGATGTATGG - Intronic
1118239526 14:64043126-64043148 GCCCCTGCCCTAGAGATTTGCGG + Intronic
1118496160 14:66309775-66309797 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1118532914 14:66727619-66727641 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1118597936 14:67450590-67450612 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1118653916 14:67926333-67926355 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1118669084 14:68102431-68102453 GCCCCTGCCCTAGAGATCTGGGG - Intronic
1118836047 14:69478607-69478629 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1119200478 14:72748292-72748314 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1119565834 14:75628602-75628624 GCACATGTACTGGACATGGGTGG + Intronic
1119935969 14:78592896-78592918 GAGCATCCCCTGCAGATGGGAGG - Intronic
1120091215 14:80334859-80334881 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1120101473 14:80450163-80450185 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1120104036 14:80474156-80474178 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1120152635 14:81054678-81054700 GCCCTTGCCCTGGAGATTTGTGG + Intronic
1120204134 14:81569394-81569416 GCCCTTACCCTTGAGATGGTAGG - Intergenic
1120394040 14:83944861-83944883 GCCCCTGCCCCAGAGATGTGTGG - Intergenic
1120418006 14:84244063-84244085 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1120443213 14:84563727-84563749 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1120582679 14:86272487-86272509 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1120590885 14:86372278-86372300 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1120696285 14:87649221-87649243 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1120704726 14:87734821-87734843 GCCCATGGCAGGGGGATGGGGGG + Intergenic
1120808867 14:88782237-88782259 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1121063520 14:90939144-90939166 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1121114886 14:91336652-91336674 GCCCATGCCTGGGCGAGGGGTGG - Intronic
1121334358 14:93068431-93068453 GCCACTGCCCAGGATATGGGTGG + Intronic
1121417576 14:93789374-93789396 GCCCATGGCCGGGAGAGGGGCGG - Intergenic
1121499188 14:94419957-94419979 GACCCTGCCCTGGACATGTGGGG - Intergenic
1121611437 14:95283672-95283694 TCCCCTGCCCTAGAGATGTGTGG + Intronic
1122324453 14:100874293-100874315 GCCCAGGCCCTGGCCATAGGAGG + Intergenic
1122375681 14:101255498-101255520 GTCCCTGCTCTGGATATGGGTGG + Intergenic
1122968923 14:105144561-105144583 GCACCTGCCCTGGACCTGGGGGG - Intronic
1123103089 14:105818889-105818911 GCGCCTGCCATGCAGATGGGTGG + Intergenic
1123154486 14:106211099-106211121 GCCCCTTCCCTGGAGCTTGGCGG + Intergenic
1123162187 14:106289189-106289211 GCCCATTCCCTGGAGCCTGGCGG + Intergenic
1123216097 14:106810603-106810625 GCCCCTTCCCTGGAGCTTGGCGG + Intergenic
1123795513 15:23766613-23766635 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1124171443 15:27377069-27377091 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1124707521 15:31977935-31977957 GCCCCAGCCCTGGAGGTGGTAGG - Intergenic
1125159585 15:36627745-36627767 GCCCTGGCCCTGGTGATGGTTGG - Intronic
1125274053 15:37971727-37971749 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1125279192 15:38026376-38026398 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1125367682 15:38936312-38936334 GACCAAGGCTTGGAGATGGGTGG - Intergenic
1126266249 15:46756819-46756841 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1126460044 15:48905259-48905281 GCCCAGTCCCTGGAGCTGGAAGG - Intronic
1126539369 15:49804836-49804858 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1126647924 15:50893824-50893846 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1126873321 15:53011935-53011957 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1126933653 15:53682645-53682667 GCCCCTGCCCTAGAGATATGTGG - Intronic
1127145076 15:56015225-56015247 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1127186405 15:56485302-56485324 GCACTTGCCCTGGAGATCTGTGG + Intergenic
1127791005 15:62398701-62398723 GCCCATGCCCTAGAGATCTGTGG + Intronic
1127955128 15:63846701-63846723 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1128113077 15:65088597-65088619 GCCCCTGCCCTGGAGGGAGGGGG - Intergenic
1128552926 15:68609781-68609803 GCCCATGCCCTGGGACTGGAGGG + Intronic
1128688914 15:69708291-69708313 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG + Intergenic
1128813905 15:70591815-70591837 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1128863350 15:71093117-71093139 CGCCAGCCCCTGGAGATGGGTGG - Intergenic
1129469362 15:75742153-75742175 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1129758118 15:78110934-78110956 GCCCATGGCCTGCAGTTGGGTGG + Intronic
1130416822 15:83702125-83702147 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1130778337 15:87008820-87008842 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1131175958 15:90209995-90210017 GCAGCTGGCCTGGAGATGGGAGG + Intronic
1131337321 15:91561846-91561868 GCCCATGACCTCGAAAAGGGAGG + Intergenic
1131426959 15:92353713-92353735 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1131752705 15:95526693-95526715 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1131912737 15:97225152-97225174 GCATATGCCATGGAGATGAGAGG + Intergenic
1132111369 15:99104725-99104747 CCCGAGGCCCTGGAGATTGGTGG - Intronic
1132548659 16:545231-545253 GCCCAGGCCCTGCAGAGGTGAGG + Intronic
1132748661 16:1447373-1447395 GCCCATGCCCTGCACATGCCTGG + Exonic
1133630561 16:7616455-7616477 GCCCATGCTATGGAGGTGTGAGG + Intronic
1136702001 16:32152802-32152824 CCCCATGCCCTGGTGAAGAGCGG - Intergenic
1136765665 16:32774658-32774680 CCCCATGCCCTGGTGAAGAGCGG + Intergenic
1136802434 16:33095720-33095742 CCCCATGCCCTGGTGAAGAGCGG - Intergenic
1136873291 16:33827476-33827498 GCCCCTTCCCTGGAGCTTGGCGG - Intergenic
1137266369 16:46872084-46872106 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1137638475 16:50008183-50008205 GCCCCTGCCCTAGAGATCTGCGG + Intergenic
1137818659 16:51422834-51422856 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1137981512 16:53074171-53074193 GCCCTTGCCCTAGAGATTTGTGG + Intronic
1138166424 16:54805934-54805956 GCCCTTGCCCTAGAGATGTGTGG - Intergenic
1138506458 16:57480586-57480608 GCCCATGCTCAGGACATGGAGGG - Intronic
1138585794 16:57969879-57969901 GCCCATGGCTGGGAGAGGGGTGG - Intronic
1138805804 16:60086922-60086944 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1139033332 16:62911977-62911999 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1139041251 16:63001650-63001672 GCCCCTGCCCTTGAGATCTGTGG + Intergenic
1141125509 16:81398042-81398064 GTCCAGGGCCTGGAGCTGGGGGG - Intergenic
1141313155 16:82934713-82934735 GCCCTTGCCCTAGAGATCTGTGG - Intronic
1141524960 16:84605132-84605154 GCCCAGGCCCAGGCCATGGGGGG - Intronic
1142138775 16:88463348-88463370 GCCCAGACCCTCGTGATGGGAGG + Intronic
1142280813 16:89146649-89146671 GGCCCTGCCCTGGACATGGAGGG - Intronic
1203068053 16_KI270728v1_random:1036906-1036928 CCCCATGCCCTGGTGAAGAGCGG + Intergenic
1203098882 16_KI270728v1_random:1288579-1288601 GCCCCTTCCCTGGAGATTGGCGG + Intergenic
1142708481 17:1710520-1710542 GACCATGCCCTGGAGCTCGGGGG + Intergenic
1142840410 17:2624060-2624082 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1142985380 17:3691926-3691948 GCCCCTGCCCAGGAGCTGGTGGG - Intronic
1143187690 17:5020478-5020500 TCCTATTCCCTAGAGATGGGAGG - Exonic
1143424321 17:6821854-6821876 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1144281684 17:13733196-13733218 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1144324868 17:14169183-14169205 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1144761126 17:17708075-17708097 ACCCATTCCTTGGAGATGGTGGG - Intronic
1144891297 17:18495854-18495876 CCCCATGCCTCTGAGATGGGAGG + Intergenic
1145140927 17:20448463-20448485 CCCCATGCCTCCGAGATGGGAGG - Intergenic
1145378244 17:22371512-22371534 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1146098279 17:29953981-29954003 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1146452820 17:32988176-32988198 GACCATGCCCTGGAGATCTGTGG - Intronic
1147257632 17:39191632-39191654 TCCCAGGCCCAGGAGCTGGGAGG - Intronic
1148640630 17:49184600-49184622 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1149135487 17:53359061-53359083 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1149234212 17:54571305-54571327 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1149366638 17:55952010-55952032 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1149386418 17:56147022-56147044 GCCCTTGCCCTAGAGATCTGTGG - Intronic
1149452135 17:56758228-56758250 GCCCCTACCCTGGAGATTTGTGG + Intergenic
1149520838 17:57317211-57317233 CCCCATGCCCTGGCCATGGCAGG - Intronic
1149998152 17:61415781-61415803 GCCCAGGACCTGGGGGTGGGGGG - Intergenic
1150941544 17:69698889-69698911 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1151501077 17:74489275-74489297 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1151501207 17:74490332-74490354 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1152064187 17:78101215-78101237 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1152277230 17:79364930-79364952 GCCCAAGCACTGCAGCTGGGTGG - Intronic
1152469274 17:80481938-80481960 GCCCACTCACTGGACATGGGTGG - Intergenic
1152535654 17:80949112-80949134 CCCGATGCCCTGGAGCTGGAGGG + Intronic
1152614551 17:81331734-81331756 GCCCAGGGCCTGCAGCTGGGAGG - Intergenic
1153199251 18:2632676-2632698 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1153214899 18:2810316-2810338 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1153388987 18:4533393-4533415 GCCCCTGCCCTGGAGAACTGTGG - Intergenic
1153455085 18:5271785-5271807 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1153539160 18:6135572-6135594 GCCCTTGCCCTAGAGATTTGTGG - Intronic
1153915139 18:9738385-9738407 GTCCCTTCCCTGGAGATTGGTGG - Intronic
1154049686 18:10942483-10942505 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1154404301 18:14074575-14074597 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1154506653 18:15046653-15046675 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1155167875 18:23245944-23245966 TCCCATGGCCTGGAGTTAGGTGG + Intronic
1155413620 18:25572255-25572277 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1155632215 18:27906750-27906772 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1155818719 18:30348235-30348257 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1155851635 18:30782077-30782099 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1156322247 18:36037855-36037877 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1156344354 18:36242236-36242258 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1156858930 18:41814288-41814310 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1156904544 18:42337506-42337528 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1156991832 18:43418593-43418615 GCCATTGCCATGGAGAGGGGTGG - Intergenic
1157377735 18:47181867-47181889 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1157592378 18:48843455-48843477 TCCCATGGCCTAGAGATGGGTGG - Intronic
1157601260 18:48894453-48894475 GCCCCTGCCCTGGGGCTGGGAGG + Intergenic
1157843143 18:50977936-50977958 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1158061567 18:53349203-53349225 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1158071372 18:53475049-53475071 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1158221981 18:55159803-55159825 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1158299315 18:56033865-56033887 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1158535173 18:58301969-58301991 GCCCCTGCCCCGGTGATAGGGGG + Intronic
1158833184 18:61302927-61302949 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1159151971 18:64533370-64533392 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1159650474 18:70971708-70971730 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1159895910 18:73996043-73996065 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1159996710 18:74971501-74971523 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1160041879 18:75352988-75353010 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1160258328 18:77266163-77266185 GCCCTTGCCCTAGAGATCTGTGG - Intronic
1160295297 18:77631808-77631830 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1160408507 18:78659329-78659351 GCCCTTTCCCTGGAGCGGGGAGG + Intergenic
1161028806 19:2048659-2048681 ACCCAAGGCCAGGAGATGGGTGG + Intronic
1161035748 19:2083459-2083481 GACCATGGCCTGGAGGTGGCCGG - Intronic
1161153749 19:2721900-2721922 GCCCAGGCCCCTGGGATGGGTGG - Intronic
1161864240 19:6822065-6822087 GGCCCTGCCCTGGAGCTTGGAGG + Intronic
1162136515 19:8558734-8558756 GCTCCTGGCCTGGGGATGGGGGG - Intronic
1162296372 19:9816473-9816495 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1162475735 19:10898423-10898445 GCACATGGCCTGGAGAGGTGGGG - Intronic
1162593345 19:11607568-11607590 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1162596412 19:11633065-11633087 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1162924548 19:13923646-13923668 TCCCTGGCCCTGGGGATGGGTGG - Intronic
1163019151 19:14473431-14473453 GCCCACGACGTGGAGATGGTGGG - Exonic
1163224618 19:15949345-15949367 GCCCATGACCAGGAGAAGGAAGG - Exonic
1164565461 19:29323068-29323090 GACCCTGCCCTGGAGCTGGGAGG + Intergenic
1164666433 19:30041848-30041870 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1165248314 19:34510791-34510813 GCCCCTGCCCTAGAGATTTGTGG - Exonic
1165866549 19:38942931-38942953 GCCCAGACACTGGAGATAGGTGG + Intronic
1165888471 19:39096338-39096360 GCCCCTGCCCTGGAGATTATTGG - Intronic
1165974849 19:39666643-39666665 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1166393855 19:42424787-42424809 ACCCCTGCCATGGAGAAGGGGGG - Intronic
1166526320 19:43512483-43512505 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1166803816 19:45473308-45473330 ACCCAAGCTCTGGGGATGGGTGG + Exonic
1166957674 19:46475838-46475860 GCTCATGCACTGGGGTTGGGTGG - Intergenic
1167403397 19:49288062-49288084 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1168612778 19:57814493-57814515 GGCAATGGCCTGGAGATGGACGG - Intronic
1168625578 19:57915425-57915447 GGCAATGGCCTGGAGATGGACGG - Intronic
925035864 2:685349-685371 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG + Intergenic
925560125 2:5182696-5182718 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
925724381 2:6859100-6859122 GCCCTTGCCCTAGAGATTTGTGG + Intronic
925782045 2:7390034-7390056 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
925817108 2:7764230-7764252 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
926484039 2:13432929-13432951 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
926597620 2:14808971-14808993 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
926611987 2:14956107-14956129 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
926734685 2:16063936-16063958 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
926840087 2:17070635-17070657 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
926949465 2:18226275-18226297 GCCCCTGCCCTAGAGATCTGTGG + Intronic
927030647 2:19117476-19117498 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
927100237 2:19782566-19782588 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
927389739 2:22582028-22582050 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
927438287 2:23089208-23089230 GCCCCTGCCCTAGAGATTTGAGG - Intergenic
927605535 2:24483396-24483418 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
927611984 2:24549989-24550011 GCCCCTGCCCTGGAGGTTTGTGG - Intronic
927641006 2:24845468-24845490 GCCCCTGCCCTAGAGATTTGTGG + Intronic
927809472 2:26173433-26173455 GCCCACGCCGGGGAGCTGGGAGG - Intronic
927860713 2:26558421-26558443 GCCCATGCTCTGGAGGTGGCCGG - Intronic
928072146 2:28227669-28227691 TCCCATGCCACGGGGATGGGAGG + Intronic
928170395 2:28999498-28999520 GCCCTTGACCTGGAAGTGGGTGG - Intronic
928474785 2:31615470-31615492 CCCCCTGCCCTGGAGATCTGTGG + Intergenic
928582905 2:32726424-32726446 GCCCCTGCCCTAGAGATGTGTGG - Intronic
928674692 2:33639070-33639092 GCCCATGTTCTGGAGAAAGGGGG - Intergenic
928804435 2:35133107-35133129 GCCCCTGCCCTAGAGATTTGGGG - Intergenic
928808822 2:35197819-35197841 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
928927446 2:36594017-36594039 GCCCCTGCCCTAGAGATTTGTGG - Intronic
929260651 2:39863502-39863524 TCCCATGCCCTAGAGATTTGTGG + Intergenic
929528897 2:42732816-42732838 GCCCCTGCCCTAGAGATTTGTGG - Intronic
929612697 2:43283614-43283636 GCCCCTGCCCTAGAGATCTGTGG + Intronic
929771096 2:44892691-44892713 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
930254816 2:49077771-49077793 GCCCCTGCCCTAGAGATTTGTGG - Intronic
930419595 2:51134523-51134545 GCCCCTGCCCTAGAGATATGTGG + Intergenic
930427929 2:51234709-51234731 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
930444232 2:51450582-51450604 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
930512022 2:52358047-52358069 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
930536195 2:52648827-52648849 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
930544060 2:52745126-52745148 GCCCCTGCCCTAGAGATCTGAGG + Intergenic
930585682 2:53264209-53264231 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
930687456 2:54324954-54324976 GCCCCTGCCCTGGAGATCTGTGG + Intergenic
930812794 2:55560395-55560417 GCCCCTGCCCTAGAGATCTGTGG + Intronic
930960203 2:57251968-57251990 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
931033583 2:58211742-58211764 GCCCCTGCCCTAGAGATATGTGG - Intronic
931119304 2:59198827-59198849 GCCCCTGCCCTTGAGATGTGTGG + Intergenic
931144973 2:59507635-59507657 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
931703311 2:64926134-64926156 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
931734542 2:65181985-65182007 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
932509139 2:72267742-72267764 GCCAATGCCCTAGAGATCTGTGG + Intronic
932847497 2:75150973-75150995 GCCCCTGCCCTAGAGATTTGTGG + Intronic
932849453 2:75170762-75170784 GCCCTTGCCCTAGAGATTTGTGG + Intronic
932904473 2:75734319-75734341 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
932912366 2:75818898-75818920 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
932956402 2:76356609-76356631 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
933047513 2:77557709-77557731 GCCCCTGCCCTAGAGATTTGTGG + Intronic
933181219 2:79229899-79229921 GCCCCTGCCCTAGAGATTTGTGG + Intronic
933424029 2:82087170-82087192 GCCCCTGCCCTAGAGATATGTGG - Intergenic
933508194 2:83204865-83204887 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
933548207 2:83741173-83741195 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
933584730 2:84168389-84168411 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
933832180 2:86219903-86219925 GGCTATGCCCTGGAGATTGGGGG - Intronic
934482544 2:94664757-94664779 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
934559200 2:95303590-95303612 GCCCAGGCCCAGGAGAGCGGGGG - Intronic
934610672 2:95732934-95732956 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
934700757 2:96438218-96438240 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
934960352 2:98667570-98667592 GCCCCTGCCCTAGAGATTTGTGG + Intronic
935130535 2:100257900-100257922 GCCCATGCCTTGTAGAGGGAGGG - Intergenic
935139815 2:100343138-100343160 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
935324871 2:101926931-101926953 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
935419822 2:102855237-102855259 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
935436894 2:103045152-103045174 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
935547826 2:104419386-104419408 GCTCATGCCCCTGAGATGGGGGG - Intergenic
935752487 2:106248822-106248844 TCCCATGCCAAGGAGAAGGGAGG + Intergenic
935797894 2:106663460-106663482 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
935912901 2:107916365-107916387 TCCCATGCCAAGGAGAAGGGAGG + Intergenic
936169297 2:110154678-110154700 GCCCCTGCCCTAGAGATTTGTGG + Intronic
936257462 2:110929330-110929352 GCCCCGGCCCTAGAGATGTGTGG + Intronic
936788116 2:116119622-116119644 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
936811368 2:116407122-116407144 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
936872237 2:117146774-117146796 GCCCCTGCCCTTGAGATCTGTGG - Intergenic
936909494 2:117575576-117575598 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
936915649 2:117636965-117636987 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
936940795 2:117882407-117882429 GCCCATGCCCTAGAGATCTGTGG + Intergenic
937008848 2:118543601-118543623 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
937142515 2:119614049-119614071 GCCCCTGCCCTAGAGATCTGTGG - Intronic
937491467 2:122372303-122372325 GCCCTTGCCCTGGAGATCTGTGG - Intergenic
937620529 2:123980131-123980153 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
937866184 2:126753230-126753252 GCCCATGCACTGAGCATGGGTGG - Intergenic
937889405 2:126925878-126925900 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
937911914 2:127079991-127080013 GCCCCCGCCTTGGAAATGGGAGG + Intronic
937935163 2:127238223-127238245 GCCCCTGGCCTGGAGATCTGTGG + Intergenic
938293735 2:130163913-130163935 GCTCATGCTCTGGAGAAGGTGGG + Intronic
938557494 2:132438823-132438845 GCCCAAGCCCTGGAGAGAAGGGG + Intronic
938868938 2:135453584-135453606 GCCCCTGCCCTAGAGATTTGTGG - Intronic
939092786 2:137798880-137798902 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
939108493 2:137977927-137977949 GCTGGAGCCCTGGAGATGGGGGG - Intronic
939287777 2:140154827-140154849 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
939361183 2:141175002-141175024 GGCCCTGCCCTGGAGATTTGTGG + Intronic
939506330 2:143052128-143052150 GCCCCTGCCCTAGAGATTTGTGG + Exonic
939508228 2:143075258-143075280 GCCTCTGCCCTGGAGATTTGTGG + Intergenic
939578018 2:143919099-143919121 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
939667038 2:144965057-144965079 GCCCCTGCCCTAGAGATATGTGG + Intergenic
939667635 2:144970110-144970132 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
939740637 2:145901835-145901857 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
939752506 2:146064611-146064633 GCCCCTGCCTTAGAGATTGGTGG - Intergenic
939761806 2:146191771-146191793 TCCCATCTCTTGGAGATGGGAGG - Intergenic
940430988 2:153589206-153589228 GCCCCTGCCCTCGAGATTTGTGG - Intergenic
940446502 2:153784331-153784353 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
940728355 2:157361477-157361499 CCCCCTGCCCTGGAGATCTGGGG + Intergenic
940785761 2:157979850-157979872 GCCCCTGCCCTAGAGATTTGTGG + Intronic
940888920 2:159015733-159015755 GCCCCTGCCCTAGAGATCTGTGG - Intronic
941165571 2:162079506-162079528 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
941225972 2:162848736-162848758 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
941319990 2:164041998-164042020 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
941477499 2:165967559-165967581 GCCCCTGCCCTAGAGATTTGCGG + Intergenic
942026467 2:171915202-171915224 GCCCATCCCTTGGACCTGGGAGG + Intronic
942114458 2:172713732-172713754 GCCCAGGTCCTGCAGCTGGGTGG + Intergenic
942118264 2:172749899-172749921 GCCCATGCCCTAGAGATTTGTGG - Intronic
942733438 2:179083292-179083314 GCCCCTGCCCTAGAGATTGGTGG - Intergenic
942829654 2:180224718-180224740 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
943006623 2:182393756-182393778 GCCCCTGCCCTGGAGATCTGTGG - Intronic
943017207 2:182528337-182528359 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
943205386 2:184887169-184887191 GCCCCTGCCCTGGAGATTTGTGG - Intronic
943219700 2:185089703-185089725 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
943223572 2:185140565-185140587 GCACATGCCCTAGAGATCTGTGG - Intergenic
943251133 2:185522955-185522977 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
943313153 2:186352915-186352937 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
943406472 2:187493719-187493741 GCCCCTGCCCTAGAGATTCGTGG - Intronic
943609549 2:190015863-190015885 GCCCTTGCCCTAGAGATCTGTGG - Intronic
943727587 2:191268052-191268074 GCTCTTCCCCTGGAGAAGGGAGG - Intronic
943776667 2:191773841-191773863 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
943788088 2:191900923-191900945 GCCCCTGCCCTGGAGATCTGTGG + Intergenic
943804830 2:192111411-192111433 GCCCCTGCCCTGGAGATTTGTGG + Intronic
943871778 2:193008824-193008846 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
943998001 2:194796540-194796562 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
944010226 2:194965656-194965678 TCCCCTGCCCTGGAGATCTGTGG - Intergenic
944021763 2:195114172-195114194 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
944043979 2:195387962-195387984 GTCCATGCCCTAGAGATTTGTGG + Intergenic
944307529 2:198195010-198195032 GCCCCTGCCCTAGAGATCTGTGG - Intronic
944470396 2:200046448-200046470 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
944808796 2:203308193-203308215 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
945090094 2:206170167-206170189 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
945644004 2:212467008-212467030 GCCCCTGCCCTAGAGATTTGTGG + Intronic
945760135 2:213903889-213903911 GCCCCTGCCCTAGAGATGTGTGG - Intronic
946108326 2:217391521-217391543 GCCCCTGCCCTAGAGATTTGTGG - Intronic
946313094 2:218893601-218893623 ACCCCTTCCCTGGAGATGGGAGG + Exonic
946432832 2:219634718-219634740 GGCCATGCCCTGGAGGGTGGTGG + Intronic
946544057 2:220716879-220716901 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
946903905 2:224397745-224397767 GCCCCTGCCCTAGAGATTTGTGG + Intronic
946930207 2:224663210-224663232 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
947008608 2:225539962-225539984 GCCCCTGCCCTAGAGATATGTGG - Intronic
947011591 2:225571970-225571992 GCCCCTGCCCTGGAGATCTGTGG - Intronic
947108391 2:226691960-226691982 GTCCAGCCCCTGGTGATGGGTGG + Intergenic
947236735 2:227949238-227949260 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
947296505 2:228636250-228636272 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
947345679 2:229186985-229187007 GCCCCTGCCCTAGAGATTTGTGG - Intronic
947888437 2:233594868-233594890 GCCCCTGCCCCAGAGATTGGTGG + Intergenic
947904444 2:233750292-233750314 GCCCCTGCCCTAGAGATCTGTGG + Intronic
948254512 2:236556263-236556285 GCGCTTGCCACGGAGATGGGAGG + Intergenic
948563106 2:238866921-238866943 GCCCATGCCCTGCACAAGTGGGG + Intronic
1168835983 20:877810-877832 TCCTATGCCCTGGGGCTGGGTGG - Intronic
1169171959 20:3471931-3471953 CCCGATGCACTGGAGATGTGGGG + Intronic
1169592715 20:7163262-7163284 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1169858083 20:10124777-10124799 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1169999335 20:11597069-11597091 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1170078871 20:12449898-12449920 GCCCATGCCCTAGAGATTTGTGG + Intergenic
1170122017 20:12922249-12922271 GCCCCTGCCCTGGGGATCTGTGG + Intergenic
1170456605 20:16539427-16539449 GTCCATGCCCTAGAGATCTGTGG + Intronic
1170474939 20:16705575-16705597 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1170750426 20:19140076-19140098 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1170875355 20:20244917-20244939 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1170941924 20:20855153-20855175 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1171031075 20:21676842-21676864 GCCCATGCTGAGGAGATGAGGGG - Intergenic
1171350358 20:24497612-24497634 GCCCATGCCATACAGAGGGGAGG + Intronic
1172720088 20:36993429-36993451 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1172804045 20:37598458-37598480 TCCCATCCCCTTGAAATGGGAGG - Intergenic
1173023453 20:39286883-39286905 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1173263803 20:41460098-41460120 GCCCCTGCCCTCGAGATTTGCGG + Intronic
1173412679 20:42828269-42828291 GCCCCTGCCCTAGAGATGTATGG + Intronic
1174180040 20:48668863-48668885 GCCCTAGCTCTGCAGATGGGAGG + Intronic
1174541859 20:51296131-51296153 GCCCTCGTCCTGGAGAAGGGAGG + Intergenic
1174662022 20:52221648-52221670 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1175253361 20:57623014-57623036 GCATGGGCCCTGGAGATGGGGGG - Intergenic
1175266208 20:57704920-57704942 GCCGCTGCCCAGGAGAAGGGAGG - Intronic
1175946696 20:62562270-62562292 GCCCATGCCTGGGAGGCGGGAGG + Intronic
1176416908 21:6481236-6481258 GCCTCTGCCCTGGAGAAGCGGGG - Intergenic
1176791213 21:13322448-13322470 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1177067866 21:16463537-16463559 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1177085325 21:16695664-16695686 GCCCCTGTCCTGGAGATCTGTGG - Intergenic
1177130363 21:17247913-17247935 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1177177233 21:17713403-17713425 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1177236201 21:18392360-18392382 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1177358279 21:20037082-20037104 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1177408251 21:20698504-20698526 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1177614500 21:23499670-23499692 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1177632650 21:23747009-23747031 GCCCCTGCCCTTGAGATTTGTGG - Intergenic
1177642020 21:23855712-23855734 GCCCATGCCCTGATGATGACAGG - Intergenic
1177662101 21:24098102-24098124 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1177741014 21:25154052-25154074 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1177742115 21:25167397-25167419 GCCCATGCCCTAGAGATTTGTGG + Intergenic
1177803149 21:25848126-25848148 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1177918800 21:27124574-27124596 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1177992792 21:28058617-28058639 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
1178046254 21:28697308-28697330 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1178469101 21:32875735-32875757 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1178615423 21:34128916-34128938 GTGCATGACCTGGAGCTGGGTGG + Intronic
1179235389 21:39540941-39540963 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1179331992 21:40412534-40412556 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1179384533 21:40929667-40929689 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1179659316 21:42864448-42864470 CCCCATGCCCTGCAGAGGGATGG + Intronic
1179678322 21:42999950-42999972 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1179692406 21:43089569-43089591 GCCTCTGCCCTGGAGAAGCGGGG - Intergenic
1179964110 21:44791085-44791107 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1180153350 21:45964424-45964446 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1180573589 22:16752047-16752069 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1180685764 22:17665197-17665219 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1180796630 22:18608961-18608983 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG + Exonic
1181253538 22:21548503-21548525 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181329098 22:22075240-22075262 GGACATGCCCTGGACATGGGAGG - Intergenic
1181894571 22:26095788-26095810 GCCCAAGACCTGGAGAGGAGGGG + Intergenic
1182094871 22:27619336-27619358 CCTCATGCCCTGGAGAGAGGAGG - Intergenic
1182182279 22:28362777-28362799 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1182866666 22:33610429-33610451 GTCCATGCCCTAGAGATCTGTGG + Intronic
1183175594 22:36222728-36222750 GCCAAGGATCTGGAGATGGGAGG - Intergenic
1183304736 22:37076539-37076561 GCCCATGCCCTGGAGATGGGAGG - Intronic
1183690976 22:39388372-39388394 GCCCACGCCCGGGAGAGGGGCGG + Intergenic
1183812357 22:40267784-40267806 GCCTAAGCCCTGGAGATGGGAGG + Intronic
1183830631 22:40416820-40416842 GCCCAGGCCTTGGAGACGGGAGG + Intronic
1184115817 22:42421575-42421597 GCCCATGACTTGGTGGTGGGAGG - Intronic
1184157547 22:42678234-42678256 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1184588712 22:45466077-45466099 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1184713339 22:46266110-46266132 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1185172964 22:49304210-49304232 ACCCCTGCCCCCGAGATGGGTGG - Intergenic
1185240410 22:49740051-49740073 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1185264075 22:49889112-49889134 GCCCAGGCCCTGGAAAAGGGAGG - Exonic
949261490 3:2106896-2106918 GCCCCTGCCCTAGAGATCTGTGG - Intronic
949292369 3:2482288-2482310 GCCCCTGCCCTAGAGATCTGTGG + Intronic
949662247 3:6292469-6292491 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
950145995 3:10650313-10650335 GCCCCTGCCCTAGAGATTTGTGG + Intronic
950412133 3:12845861-12845883 GCCCCTGCCCTAGAGATCTGTGG + Intronic
950700780 3:14744244-14744266 GCCCCTGCCCTAGAGATTTGTGG - Intronic
950800660 3:15549720-15549742 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
950963281 3:17128192-17128214 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
951058311 3:18173595-18173617 GCCCCTGCCCTGGAGATTTGTGG - Intronic
951093160 3:18598537-18598559 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
951199874 3:19864407-19864429 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
951317491 3:21204777-21204799 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
951385077 3:22031982-22032004 GCCCCTGCCCTAGAGATCTGTGG - Intronic
951446230 3:22783170-22783192 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
951755670 3:26088227-26088249 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
951756529 3:26096983-26097005 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
951865059 3:27298816-27298838 GCCCCTGCCCTAGAGATCTGTGG + Intronic
951936026 3:28024190-28024212 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
952022398 3:29039699-29039721 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
952105618 3:30066113-30066135 GCCCCTGCCATGGAGATTTGTGG - Intergenic
952185316 3:30961715-30961737 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
952219970 3:31315275-31315297 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
952247020 3:31606032-31606054 GCCCCTGCCCTAGAGATTTGTGG + Intronic
952606000 3:35146994-35147016 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
952715172 3:36472636-36472658 GCCCCTGCCCTAGAGATCTGTGG - Intronic
952939781 3:38433584-38433606 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
953446549 3:42973630-42973652 GCCCCTGCCCTAGAGATATGTGG + Intronic
953456469 3:43046361-43046383 GCCCCTGCCCTAGAGATCTGTGG + Intronic
954591478 3:51787377-51787399 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
954692315 3:52402154-52402176 GTCCAGGCCCTGGGAATGGGAGG - Exonic
954759640 3:52864771-52864793 GCCCCTGCCCTAGAGATCTGTGG - Intronic
955471978 3:59295457-59295479 GCCCCTGCCCTAGAGATGTGTGG - Intergenic
955826206 3:62950886-62950908 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
956169619 3:66422437-66422459 GCCCCTGCCCTAGAGATTTGTGG - Intronic
956246359 3:67187256-67187278 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
956306330 3:67831097-67831119 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
956327601 3:68070779-68070801 GCCCATGCCCTAGAGATTTGTGG - Intronic
956363132 3:68470613-68470635 GCCCCTGCCCTAGAGATTTGTGG + Intronic
956546451 3:70408502-70408524 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
957105723 3:75884214-75884236 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
957113101 3:75991918-75991940 GCCCCTGCCCTAGAGATTTGTGG + Intronic
957276017 3:78092751-78092773 GCCCCTGTCCTAGAGATGTGTGG + Intergenic
957300673 3:78388289-78388311 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
957630606 3:82711771-82711793 GCCCCTGCCCTAGAGATATGCGG - Intergenic
957981651 3:87519107-87519129 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
958018275 3:87968147-87968169 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
958057088 3:88427228-88427250 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
958065867 3:88544468-88544490 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
958146392 3:89630735-89630757 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
958157380 3:89771972-89771994 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
958588083 3:96117555-96117577 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
958688134 3:97425856-97425878 GCCCCTGCCCTAGAGATCTGTGG - Intronic
958860928 3:99444943-99444965 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
958887245 3:99740018-99740040 GCCCCTGCCCTAGAGATTTGTGG - Intronic
958955232 3:100459300-100459322 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
958956541 3:100470539-100470561 GCCCCTGCACTAGAGATGTGTGG - Intergenic
959004934 3:101009137-101009159 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
959054379 3:101553225-101553247 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
959113844 3:102152604-102152626 GCCCCTACCCTAGAGATGTGTGG - Intronic
959119261 3:102212845-102212867 GCCCCTGCCCTAGAGATCTGTGG - Intronic
959172114 3:102855684-102855706 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
959305904 3:104665818-104665840 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
959316960 3:104821428-104821450 GCCCCTGTCCTGGAGATTTGTGG + Intergenic
959342624 3:105149734-105149756 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
959368357 3:105491648-105491670 GCCCCTGCCCTAGAGATCTGTGG - Intronic
959381127 3:105642211-105642233 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
959609644 3:108278972-108278994 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
959719276 3:109469333-109469355 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
959815582 3:110670252-110670274 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
959818602 3:110704737-110704759 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
959893748 3:111584148-111584170 GCCTATGCCCTAGAGATTTGTGG - Intronic
960021742 3:112963526-112963548 GCTCCTGCCCTAGAGATGTGTGG + Intronic
960060088 3:113311923-113311945 GCCCCTGCCCTAGAGATTTGTGG + Intronic
960255296 3:115505374-115505396 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
960297931 3:115967246-115967268 GCCCCTGCCCTAGAGATTTGTGG - Intronic
960478429 3:118159132-118159154 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
960486428 3:118258772-118258794 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
960496653 3:118383565-118383587 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
960690445 3:120341718-120341740 GCACATTCCATGGAGCTGGGGGG + Intronic
960857926 3:122122381-122122403 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
961343588 3:126246633-126246655 GCCCAGCCGCTGGAGATGGGAGG + Intergenic
961363659 3:126385126-126385148 TCCCATGCCCTTGATCTGGGTGG - Intergenic
961702878 3:128760311-128760333 TCCCATGACCTGCAGTTGGGAGG - Intronic
962509396 3:136083861-136083883 GCCCCTGCCCTAGAGATCTGTGG + Intronic
962576839 3:136762788-136762810 GTCCCTGCCCTAGAGATGTGTGG + Intergenic
962589246 3:136872327-136872349 GCCCCTGCCCTAGAGATCTGTGG + Intronic
962646492 3:137445615-137445637 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
963297035 3:143557712-143557734 GCCCCTGCCCTAGAGATCTGTGG + Intronic
963363302 3:144303798-144303820 GCCCGTGCCCTAGAGATCTGTGG - Intergenic
963475224 3:145795379-145795401 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
964026509 3:152080567-152080589 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
964090942 3:152874623-152874645 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
964274535 3:154995568-154995590 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
964426649 3:156561249-156561271 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
964520817 3:157564323-157564345 GCCCCTGCCCTAGAGATTTGTGG - Intronic
964605438 3:158555767-158555789 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
964719457 3:159756819-159756841 GCCCCTGCCCTAGAGATCTGTGG - Intronic
964737893 3:159934836-159934858 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
964897136 3:161612261-161612283 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
964912715 3:161801671-161801693 GCCCCTGCCCTAGAGATATGTGG - Intergenic
964943507 3:162190293-162190315 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
964954364 3:162334417-162334439 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
965127460 3:164649164-164649186 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
965198689 3:165629871-165629893 GCCCATGCCCTAGAGATTTGTGG - Intergenic
965198777 3:165630776-165630798 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
965203712 3:165693392-165693414 GCCCCTGCCCTAGAGATATGTGG - Intergenic
965251472 3:166349318-166349340 GCCCCTGCCCTGGCGATTTGTGG + Intergenic
965275590 3:166677908-166677930 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
965305620 3:167059832-167059854 GCCCCTGCCCTAGAGATAGGTGG - Intergenic
965363199 3:167765845-167765867 GCCCCTGCCCTAGAGATCTGTGG - Intronic
965499933 3:169444936-169444958 GCCCCTGCCCTAGAGATCTGTGG + Intronic
965795395 3:172433631-172433653 GCCCCTGCCCTAGAGATCTGCGG - Intergenic
965863971 3:173182833-173182855 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
965897512 3:173595323-173595345 GCTTCTGCCCTGGAGATGTGTGG - Intronic
965989519 3:174799944-174799966 GCCCCTGCCCTAGAGATCTGTGG + Intronic
966097806 3:176227643-176227665 GCCCATGCCCTAGAGATCTGTGG + Intergenic
966123469 3:176548566-176548588 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
966299342 3:178461443-178461465 GCCCCTGCCCTAGAGATTTGTGG + Intronic
966325323 3:178746744-178746766 GCCCCTGCCCTAGAGATCTGTGG - Intronic
966346973 3:178990792-178990814 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
966446659 3:180008210-180008232 GCCCCTGCCCTAGAGATTTGTGG - Intronic
966576633 3:181510345-181510367 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
966741902 3:183241998-183242020 GCCCCTGCCCTAGAGATCTGTGG + Intronic
967412587 3:189181490-189181512 GCCCCTGCCCTAGAGATTTGTGG - Intronic
967449705 3:189610430-189610452 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
967564586 3:190959011-190959033 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
967566494 3:190979499-190979521 GCCTGTGCCCTAGAGATGTGTGG + Intergenic
967614459 3:191547905-191547927 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
967717053 3:192774815-192774837 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
967777096 3:193395855-193395877 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
967810323 3:193754415-193754437 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
967957396 3:194887725-194887747 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
968014626 3:195318565-195318587 GCCCCTGCCCTAGAGATCTGTGG + Intronic
968295059 3:197570139-197570161 GCCCCTGCCCTAGAGATTTGTGG + Intronic
968590534 4:1456915-1456937 GCCCCTGCCCTGGAGCTCTGTGG - Intergenic
968749597 4:2381227-2381249 GCCCCTGCCCTAGAGATTTGTGG + Intronic
968767078 4:2478113-2478135 GCCCCTGCCCTAGAGATTTGTGG + Intronic
969107896 4:4821795-4821817 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
969152166 4:5178684-5178706 GCCCTTGCCCTAGAGATCTGTGG - Intronic
969564157 4:7967810-7967832 GCCCACACCCTGGAGCTGTGGGG + Intronic
970150355 4:13082685-13082707 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
970339231 4:15086792-15086814 TCCCCTGCCCTGGAGATTCGTGG - Intergenic
970344106 4:15136505-15136527 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
970357333 4:15269025-15269047 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
970461981 4:16283873-16283895 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
970978958 4:22074798-22074820 GCCCCTGCCCTAGAGATGTGCGG + Intergenic
970999195 4:22303468-22303490 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
971070036 4:23080645-23080667 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
971111509 4:23591323-23591345 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
971710619 4:30106262-30106284 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
971889810 4:32506251-32506273 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
972057968 4:34827580-34827602 GCCCATGCCCTAGAGATTTGTGG - Intergenic
972192926 4:36616400-36616422 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
972199891 4:36702232-36702254 GCCCATGCCCTAGGGATCTGTGG + Intergenic
972268093 4:37482432-37482454 GCCCCTGCCCTGGAGACCTGTGG + Intronic
972467431 4:39370796-39370818 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
972749287 4:41972698-41972720 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
972809115 4:42563276-42563298 GCCCCTGCCCTAGAGATTTGTGG + Intronic
972849783 4:43035013-43035035 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
972887578 4:43510865-43510887 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
973022806 4:45224682-45224704 GCCCCTGCCCTAGAGATATGTGG + Intergenic
973032151 4:45358810-45358832 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
973182852 4:47290745-47290767 GCCCCTGCCCTAGAGATCGGTGG + Intronic
973212946 4:47637130-47637152 GCCCCTGCCCTAGAGATTTGTGG + Intronic
973718509 4:53700969-53700991 GCCCCTGCCCTAGAGATGTGTGG - Intronic
974037001 4:56826205-56826227 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
974071354 4:57127144-57127166 GCCCCTGCCCTAGAGATCTGCGG + Intergenic
974172184 4:58280984-58281006 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
974219538 4:58948451-58948473 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
974270941 4:59651077-59651099 GCCCATGCCCTAGAGATTTGAGG + Intergenic
974319856 4:60333552-60333574 GCTCTTGCCCTGGAGATCTGTGG + Intergenic
974395093 4:61323564-61323586 GCCCCTGCCCTAGAGATTTGTGG - Intronic
974467047 4:62271114-62271136 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
974480680 4:62438731-62438753 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
974587398 4:63896797-63896819 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
974623995 4:64398965-64398987 GCCCATGCCCTAGGGATCCGTGG + Intronic
974716804 4:65678456-65678478 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
974733528 4:65899656-65899678 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
974748077 4:66102348-66102370 GCCCCTGCCCTAGAGATATGTGG + Intergenic
974797030 4:66766387-66766409 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
974846098 4:67352391-67352413 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
974872421 4:67659961-67659983 GCCCCTGCCCTAGAGATCTGTGG + Intronic
974923533 4:68270821-68270843 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
974931321 4:68364560-68364582 GCCCCTGCCCTGGAGATCTGTGG + Intergenic
975284946 4:72606584-72606606 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
975350468 4:73340039-73340061 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
975542978 4:75533224-75533246 GCCCCTGCCCTAGAGATCTGTGG - Intronic
976259968 4:83136081-83136103 GCCCCTGCCCTAGAGATTTGTGG - Intronic
976286520 4:83376045-83376067 GCCCCTGCCCTAGAGATGTGTGG - Intergenic
976288099 4:83389547-83389569 GCTCAGGCCCAGGCGATGGGTGG + Intergenic
976365832 4:84231075-84231097 GCCCCTGCCCTGGAGATCTTTGG - Intergenic
976444726 4:85117500-85117522 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
976503210 4:85815479-85815501 GCCCCTGCCCTAGAGATTTGTGG - Intronic
976673010 4:87674480-87674502 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
976674688 4:87691444-87691466 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
976678038 4:87725078-87725100 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
976715575 4:88119644-88119666 GCCCCTGCCCTAGAGATCTGTGG + Intronic
976952335 4:90849351-90849373 GCCCCTGCCCTAGAGATCTGTGG + Intronic
977006139 4:91570995-91571017 GCCCCTGCCCTAGAGATCTGTGG - Intronic
977046284 4:92072103-92072125 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
977198735 4:94089959-94089981 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
977544974 4:98366748-98366770 GCCCCTGCCCTAGAGATTTGTGG + Intronic
977704149 4:100052617-100052639 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
977783356 4:101005260-101005282 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
977821151 4:101473616-101473638 GCCCCTGCCCTAGAGATCTGTGG + Intronic
977832178 4:101607640-101607662 GCCCCTGCCCTAGAGATCTGTGG + Intronic
978034410 4:103976032-103976054 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
978087228 4:104668576-104668598 GCCCCTGCCCTAGAGATGTGTGG - Intergenic
978153346 4:105463298-105463320 GCCCCTGCCCTAGAGATCTGTGG + Intronic
978213230 4:106163101-106163123 GCCCCTGCCCTGGAAATATGTGG - Intronic
978235012 4:106447306-106447328 GCCCCTGCACTGGAGATTTGTGG - Intergenic
978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG + Intergenic
978492533 4:109323957-109323979 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
978579619 4:110218838-110218860 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
978591488 4:110329307-110329329 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
978856487 4:113400317-113400339 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
978915768 4:114124596-114124618 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
978938989 4:114415025-114415047 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
978982016 4:114958292-114958314 GCCCCTGCCCTAGAGATCTGTGG - Intronic
978982093 4:114959012-114959034 GCCCCTGCCCTAGAGATCTGTGG - Intronic
979059904 4:116044256-116044278 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
979182777 4:117752670-117752692 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
979183343 4:117757424-117757446 GCCTCTGCCCTGGAGATTTGTGG + Intergenic
979356448 4:119711759-119711781 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
979411389 4:120384099-120384121 GCCCCTGCCCTTGAGATCTGTGG + Intergenic
979426490 4:120573115-120573137 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
979629277 4:122881502-122881524 GCCCCTGCCCTAGAGATTTGTGG - Intronic
979700088 4:123657229-123657251 GCCTCTGCCCTAGAGATGTGTGG - Intergenic
979839687 4:125422989-125423011 GCCCCTGCCCTAGAGATCTGTGG + Intronic
979974834 4:127184153-127184175 GCCCCTGCCCTGGAGATTTGTGG + Intergenic
980006778 4:127551884-127551906 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
980083686 4:128369769-128369791 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
980084539 4:128377739-128377761 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
980090920 4:128442078-128442100 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
980292371 4:130859902-130859924 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
980383465 4:132057725-132057747 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
980525754 4:133989393-133989415 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
980532641 4:134074236-134074258 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
980545864 4:134260662-134260684 GCCCATGCCCTAGAGATCTGTGG - Intergenic
980758070 4:137191255-137191277 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
980850480 4:138374835-138374857 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
981242317 4:142492629-142492651 GCCCCTGCCCTAGAGATCTGTGG + Intronic
981407278 4:144386040-144386062 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
981642963 4:146966727-146966749 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
981695163 4:147552398-147552420 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
981822139 4:148898712-148898734 GCCCCTGCCCTGTAGATCTGTGG - Intergenic
981872845 4:149507539-149507561 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
981915293 4:150026622-150026644 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
982075931 4:151737321-151737343 GCCCCTGCCCTGGAGATGTGTGG + Intronic
982098596 4:151946572-151946594 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
982131635 4:152233967-152233989 GCCCTTGACCTGGAAATGGCTGG + Intergenic
982392963 4:154885465-154885487 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
982478451 4:155879940-155879962 GCCCCTGCCCTGGAGGTCTGTGG - Intronic
982521070 4:156417281-156417303 GTCCCTGCCCTGGAGATTTGTGG - Intergenic
982554210 4:156839908-156839930 GCTCCTGCCCTAGAGATGTGTGG + Intronic
982608197 4:157539793-157539815 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
982609028 4:157550760-157550782 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
982730694 4:158952856-158952878 GCCCCTGCCCTAGAGATTTGTGG + Intronic
982799945 4:159692923-159692945 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
982920522 4:161267970-161267992 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
982923337 4:161304240-161304262 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
983089602 4:163487874-163487896 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
983317360 4:166149280-166149302 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
983320564 4:166191301-166191323 GCCCCTGCCCTCGAGATTTGTGG + Intergenic
983322768 4:166214343-166214365 GACCCTGCCCTAGAGATGTGTGG - Intergenic
983340420 4:166454254-166454276 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
983348563 4:166558706-166558728 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
983460781 4:168023458-168023480 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
983713881 4:170754059-170754081 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
983723922 4:170894098-170894120 GCCCCTGCCCTAGAGATTCGTGG - Intergenic
983789982 4:171784026-171784048 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
983889412 4:173015596-173015618 GCCCCTGCCCTAGAGATCTGTGG + Intronic
984219540 4:176955985-176956007 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
984232173 4:177112595-177112617 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
984436786 4:179719395-179719417 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
984454213 4:179944755-179944777 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
984553377 4:181186016-181186038 GCCCCTGCCATGGAGATTTGTGG - Intergenic
984774191 4:183466587-183466609 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
984900435 4:184581361-184581383 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
985076702 4:186223535-186223557 GCCCCTGCCCTAGAGATCTGTGG + Intronic
985156121 4:186988591-186988613 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
985201340 4:187488322-187488344 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
985394234 4:189525175-189525197 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
985674858 5:1225714-1225736 GCCCAAGCACTGGGGATGCGTGG - Intronic
985785983 5:1895006-1895028 GTCCCTGCCCTGGAGATTTGTGG + Intergenic
985809095 5:2070116-2070138 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
986138368 5:5005228-5005250 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
986258787 5:6124467-6124489 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
986397159 5:7342601-7342623 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
986533128 5:8759977-8759999 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
986780145 5:11057927-11057949 GCCCCTGCCCTAGAGATTTGTGG + Intronic
987098012 5:14566978-14567000 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
987201792 5:15584427-15584449 GCCCCTGCCCTAGAGATCTGTGG - Intronic
987390778 5:17373520-17373542 CCCAAAGCCCTGGAGAGGGGAGG + Intergenic
987433480 5:17864856-17864878 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
987455453 5:18139061-18139083 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
987457628 5:18166196-18166218 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
987510244 5:18828256-18828278 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
987562464 5:19541099-19541121 GCCCCTGCCCTAGAGATCTGTGG - Intronic
987610598 5:20198444-20198466 GCCCCTGCCCTGGATATCTGTGG + Intronic
987620882 5:20337483-20337505 GCCCCTGCCCTAGAGATTTGTGG - Intronic
987642428 5:20629366-20629388 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
987654891 5:20794912-20794934 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
987655220 5:20797664-20797686 GCCCCTGCCCTAGAGATGCGTGG - Intergenic
987659484 5:20854441-20854463 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
987663537 5:20907281-20907303 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
987674975 5:21063013-21063035 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
987723168 5:21664106-21664128 GCCCCTGCCCTAGAGGTGTGTGG - Intergenic
987792048 5:22580868-22580890 GCCCATGGCCTAGAGATTTGTGG + Intronic
987799432 5:22674809-22674831 GCCCCTGCCCTAGAGATTTGTGG + Intronic
987873206 5:23647125-23647147 GCCCCTGCCCTGGAGATTTGTGG + Intergenic
987884794 5:23799769-23799791 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
988047759 5:25980281-25980303 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
988129203 5:27080675-27080697 GCCCCTGCCCTAGAGATTTGTGG - Intronic
988200005 5:28055252-28055274 GCCCCTGCCCTAGAGGTGTGTGG - Intergenic
988472048 5:31548414-31548436 GCCCCTGCCCTAGAGATGTGTGG - Intronic
988740753 5:34067025-34067047 GCCCCTGCCCTAGAGATCTGTGG - Intronic
988759147 5:34294906-34294928 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
988764165 5:34351206-34351228 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
988768338 5:34406238-34406260 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
988804422 5:34727232-34727254 GCCCCTGCCCTAGAGATCTGTGG + Intronic
988924856 5:35979446-35979468 GCCCCTGCCCTAGAGATTTGTGG - Intronic
989218372 5:38927943-38927965 GCCCCTGCCCTAGAGATCTGTGG - Intronic
990077760 5:51872612-51872634 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
990329518 5:54712332-54712354 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
990941539 5:61207150-61207172 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
990996550 5:61737667-61737689 GCCCCAGACCTGGAGAGGGGTGG + Intronic
991222849 5:64236300-64236322 GCCCCTGCCCTAGAGATCTGTGG + Intronic
991700019 5:69308959-69308981 GCCCCTGCCCTAGAGATCTGTGG + Intronic
992279618 5:75161338-75161360 GCCCCTGCCCTAGAGATTTGTGG + Intronic
992651632 5:78865793-78865815 GCCCCTGCCCTAGAGATTTGTGG - Intronic
992817989 5:80463852-80463874 GCCCCTGCCCTAGAGATCTGAGG - Intronic
993001025 5:82380463-82380485 GCCCCTGCCCTAGAGATCTGTGG - Intronic
993024084 5:82626237-82626259 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
993098356 5:83506392-83506414 GCCCCTGCCCTAGAGATTTGTGG - Intronic
993200738 5:84812383-84812405 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
993225839 5:85166693-85166715 GCCCCTGCCCTAGAGATATGTGG + Intergenic
993260654 5:85654750-85654772 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
993391076 5:87320037-87320059 GCCCCTGCCCTAGAGATGTATGG - Intronic
993531222 5:89027544-89027566 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
993561575 5:89417362-89417384 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
993711642 5:91230892-91230914 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
993724058 5:91348388-91348410 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
993792617 5:92225079-92225101 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
993801715 5:92351033-92351055 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
993893794 5:93506129-93506151 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
994018903 5:95001627-95001649 GCCCCTGCCCTTGAGATCTGTGG + Intronic
994524128 5:100882299-100882321 GCCCCTGCCCTAGAGATTGGTGG + Intronic
994535593 5:101025845-101025867 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
994548652 5:101204481-101204503 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
994561692 5:101382124-101382146 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
994615005 5:102092934-102092956 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
994689603 5:103000231-103000253 GCCCCTGCCCTAGAGATCTGTGG - Intronic
994808171 5:104478872-104478894 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
994813817 5:104557552-104557574 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
994823203 5:104679870-104679892 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
994902800 5:105797957-105797979 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
995011472 5:107260853-107260875 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
995113437 5:108453413-108453435 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
995129207 5:108612302-108612324 GCCCCTGCCCTAGAGATATGTGG + Intergenic
995283111 5:110357462-110357484 GCCCCTGCCCTAGAGATCTGTGG + Intronic
995370209 5:111409763-111409785 GCCCCTGCCCTAGAGATATGTGG - Intronic
995701289 5:114938657-114938679 TCCCATTCCCTGGAGATCTGTGG + Intergenic
995702755 5:114954739-114954761 GCCTATGCCCTAGAGATCTGTGG + Intergenic
995872226 5:116755694-116755716 GCCCCTGCCCTAGAGATCTGCGG + Intergenic
995997945 5:118323327-118323349 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
996011339 5:118484202-118484224 GCCCGTGACCTAGAGATGTGTGG - Intergenic
996031010 5:118703776-118703798 GCCCCTGCCCTAGAGATATGTGG - Intergenic
996126060 5:119727013-119727035 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
996179896 5:120406608-120406630 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
996196255 5:120611093-120611115 GCCCCTGCCCTAGAGATTTGTGG + Intronic
996247467 5:121282421-121282443 GACCCTGCCCTGGAGATTTGTGG + Intergenic
996526949 5:124489766-124489788 GCCCCTGCCCTAGAGATTTGCGG - Intergenic
996605321 5:125314167-125314189 CCCCCTGCCCTAGAGATGTGTGG - Intergenic
996641552 5:125761229-125761251 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
996911295 5:128660092-128660114 GCCCTTGCCCTAGAGATCTGTGG + Intronic
997092890 5:130878011-130878033 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
997349256 5:133218572-133218594 GCCCATGGCATGGAGTAGGGTGG - Intronic
997360372 5:133291017-133291039 GCGCAGGCTCAGGAGATGGGTGG - Intronic
997651414 5:135524202-135524224 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
997775538 5:136601279-136601301 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
998387775 5:141767883-141767905 GCCCATGCGGTGGTGATGGCTGG + Intergenic
998487605 5:142516787-142516809 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
998581938 5:143385603-143385625 GCCCCTGCCCTAGAGATCTGTGG - Intronic
998722902 5:144974982-144975004 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
998757006 5:145391820-145391842 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
998871580 5:146557761-146557783 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
998980443 5:147696876-147696898 GCCCCTGCCCTAGAGATCTGAGG + Intronic
999012229 5:148055664-148055686 GCCCCTGCCCTAGAGATTTGTGG + Intronic
999804977 5:155072677-155072699 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
999919702 5:156304895-156304917 GCCCCTGCCCTGGAGATTTGTGG + Intronic
1000030576 5:157397771-157397793 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1000226440 5:159266323-159266345 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1000516063 5:162237399-162237421 GCCCCTGCCCTAGAGATATGTGG - Intergenic
1000526918 5:162369624-162369646 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1000676416 5:164127450-164127472 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1000728578 5:164802405-164802427 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1000741391 5:164974270-164974292 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1000778036 5:165443358-165443380 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1000784578 5:165528081-165528103 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1000859468 5:166439001-166439023 CCCCCTGCCCTGGAGATCTGTGG + Intergenic
1000947050 5:167435887-167435909 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1001269213 5:170298575-170298597 GCACATTCCCTGGAGATAGGAGG + Intergenic
1001795430 5:174498441-174498463 GCCCCTGCCCTGGAGATTTGTGG + Intergenic
1002259139 5:177982152-177982174 TCCCGTGCCCTGGGGGTGGGAGG - Intergenic
1002314453 5:178334065-178334087 CCCCATGCCCTGGGGATGTCCGG + Intronic
1002464499 5:179399804-179399826 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1002815796 6:678676-678698 CCCCATGCCCTGGTTCTGGGAGG - Intronic
1003227868 6:4222896-4222918 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1003230111 6:4244027-4244049 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1003401836 6:5796911-5796933 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1004245508 6:13971833-13971855 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1004284205 6:14305461-14305483 CCCCATGCCCTGCACATGGAGGG - Intergenic
1004805786 6:19202188-19202210 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1005101056 6:22172953-22172975 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1005655344 6:27929675-27929697 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1005905076 6:30255372-30255394 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1005982915 6:30851243-30851265 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1006240324 6:32672389-32672411 GCCCTTGCCCTAGAGATTCGTGG + Intergenic
1006280275 6:33047022-33047044 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1006693201 6:35908449-35908471 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1006697056 6:35940234-35940256 GCCCCCGCCCTGGAGATTTGTGG + Intergenic
1007078774 6:39084485-39084507 GCCCTTCCGCTGGAGAGGGGGGG - Intronic
1007386427 6:41523304-41523326 ACCCAGGCCATGGAGGTGGGTGG + Intergenic
1007627698 6:43255538-43255560 GCCCATCTCCTGGAGGTGGGGGG - Exonic
1008499950 6:52170659-52170681 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1008650011 6:53552381-53552403 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1009300221 6:62009256-62009278 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1009490592 6:64285335-64285357 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1009538756 6:64924700-64924722 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1009554837 6:65149308-65149330 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1009715819 6:67394103-67394125 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1009726498 6:67542541-67542563 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1009757239 6:67955855-67955877 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1009824237 6:68846122-68846144 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1009901087 6:69808392-69808414 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1010263663 6:73844526-73844548 GCCCATGCCCTAGAGATTTGTGG + Intergenic
1010366705 6:75059609-75059631 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
1010458278 6:76083417-76083439 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1010674021 6:78720542-78720564 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1010781270 6:79947797-79947819 GCCGATGCCCGGGACAGGGGCGG - Intergenic
1010882818 6:81200824-81200846 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1010884286 6:81217604-81217626 GCCCCTGCTCTAGAGATGTGTGG + Intergenic
1010909619 6:81537120-81537142 GCCCCTGCCCTAGAGATATGTGG - Intronic
1010920449 6:81673711-81673733 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1011122006 6:83964420-83964442 GCCCCTGCCCTGGAGATTTGTGG + Exonic
1011136348 6:84104928-84104950 GCCTCTGCCCTAGAGATTGGTGG - Intergenic
1011237004 6:85228910-85228932 GCCCTTACCCTAGAGATGTGTGG - Intergenic
1011294340 6:85810141-85810163 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1011346180 6:86371566-86371588 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1011353800 6:86453100-86453122 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1011382597 6:86759177-86759199 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1011439251 6:87369884-87369906 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1011883281 6:92058877-92058899 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1011916339 6:92511125-92511147 GCCCCTGCCCTAGAGATCGGTGG + Intergenic
1011981765 6:93387235-93387257 GCTCCTGCCCTAGAGATTGGTGG - Intronic
1012005345 6:93707182-93707204 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1012029146 6:94036543-94036565 GCCCCTGCCCTAGAGATCTGAGG + Intergenic
1012196076 6:96342596-96342618 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1012224021 6:96685135-96685157 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1012239849 6:96859657-96859679 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1012475681 6:99613401-99613423 GACCGTGCCCTGGACATGAGCGG + Exonic
1012478288 6:99638209-99638231 GCCCCTGACCTAGAGATGTGTGG - Intergenic
1012771197 6:103437113-103437135 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1012826449 6:104152175-104152197 GCCCCTGCCCTAGAGATTCGTGG - Intergenic
1013076937 6:106780203-106780225 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1013086563 6:106862691-106862713 GCCCTTGCCCTAGAGATATGTGG + Intergenic
1013338593 6:109191161-109191183 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
1013404520 6:109831193-109831215 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
1013829662 6:114256522-114256544 GCCCCTGCCCTAGAGATGTGTGG - Intronic
1013865500 6:114691318-114691340 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1013928529 6:115502301-115502323 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1013947160 6:115735453-115735475 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1014061309 6:117074638-117074660 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1014067754 6:117146432-117146454 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1014068221 6:117151265-117151287 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1014115970 6:117669474-117669496 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1014247553 6:119083588-119083610 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1014327678 6:120018939-120018961 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1014406913 6:121064169-121064191 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1014449288 6:121564986-121565008 GCCCCCACCCTGGAGATGTGTGG + Intergenic
1014476029 6:121872870-121872892 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1014562946 6:122913419-122913441 GCCCCTGCCCTAGAGATATGTGG + Intergenic
1014576744 6:123082737-123082759 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1014581066 6:123137875-123137897 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1014691605 6:124570081-124570103 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1014714480 6:124848596-124848618 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1014731032 6:125031538-125031560 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1014863326 6:126497159-126497181 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1014875517 6:126654543-126654565 GCCCTTGCCCTAGAGATATGTGG + Intergenic
1014883979 6:126757044-126757066 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1014951689 6:127563182-127563204 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1015013253 6:128376818-128376840 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1015239521 6:131007752-131007774 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1015347365 6:132175505-132175527 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1015523098 6:134151118-134151140 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1015674118 6:135725699-135725721 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1015677170 6:135762907-135762929 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1015777870 6:136832747-136832769 GCCCCTGCCCTAGAGATCCGTGG - Intronic
1015901630 6:138074192-138074214 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1015969738 6:138731696-138731718 GCCCCTGCCCTAGAGATTTGAGG - Intergenic
1015995691 6:138993670-138993692 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1016230613 6:141800061-141800083 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1016242862 6:141952580-141952602 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1016253137 6:142071398-142071420 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1016264402 6:142214208-142214230 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1016411258 6:143786237-143786259 GCCCCTGCCCTAGAGATTCGTGG - Intronic
1016424081 6:143915728-143915750 GCCCCTGCCATAGAGATGTGTGG + Intronic
1016512882 6:144863412-144863434 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1016564964 6:145441997-145442019 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1016592802 6:145765384-145765406 GCCCATGCCCTAGAGATCTGTGG + Intergenic
1016613665 6:146023509-146023531 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1017525469 6:155238158-155238180 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1017580384 6:155858779-155858801 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1017602287 6:156096674-156096696 TACCCTGCCCTGGAGATGGCTGG + Intergenic
1017640593 6:156490295-156490317 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1017693666 6:156992626-156992648 GCCCAGGCCCCACAGATGGGAGG - Intronic
1017764804 6:157597797-157597819 GGCCATGTCCTGGATGTGGGAGG - Intronic
1017774714 6:157671939-157671961 GAAGAAGCCCTGGAGATGGGTGG - Intronic
1017804316 6:157930455-157930477 GTCCATGGCCTGGGGATTGGGGG - Intronic
1017893940 6:158663191-158663213 GCTCACGCCCTGCAGATGAGCGG - Exonic
1018004940 6:159613005-159613027 TCACATGGCCAGGAGATGGGGGG + Intergenic
1018031932 6:159848382-159848404 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1018358176 6:163039669-163039691 GCCCCTGCCCTTGAGATCTGTGG + Intronic
1018477797 6:164160080-164160102 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1018548189 6:164962029-164962051 GTCCATGCCCAGGAGACTGGTGG + Intergenic
1018642858 6:165921032-165921054 ACCCATCCCCTGGAAATAGGAGG + Intronic
1018721489 6:166576561-166576583 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1019081550 6:169434617-169434639 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1019098747 6:169609955-169609977 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1019150497 6:170002341-170002363 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1019558976 7:1646589-1646611 GTCCATCCCCTGGGGAGGGGAGG - Intergenic
1019748862 7:2716411-2716433 ACCCATGCTCTGGAAACGGGTGG - Exonic
1020137523 7:5595085-5595107 CCCCAGGCCTTGGAGATGGCTGG + Intronic
1020470027 7:8525231-8525253 GCCCATGCCCTAGAGATTTTTGG + Intronic
1020550353 7:9596371-9596393 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1020578958 7:9970750-9970772 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1020581706 7:10011257-10011279 GCCCCTGCCCTAGAGATCTGCGG + Intergenic
1020942729 7:14561677-14561699 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1021001893 7:15341342-15341364 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1021170738 7:17395093-17395115 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1021175059 7:17440529-17440551 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
1021646830 7:22796958-22796980 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1022352216 7:29577046-29577068 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1022512961 7:30952963-30952985 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1022533768 7:31083248-31083270 CCCCCTGCCCTGGACATGAGTGG + Intronic
1022687815 7:32613005-32613027 GCTCATGCCATGGAAATGGGTGG + Intergenic
1023406819 7:39842562-39842584 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1023709417 7:42975982-42976004 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1024030510 7:45456227-45456249 GGCCAGGCACTGGGGATGGGAGG + Intergenic
1024045875 7:45585378-45585400 GACCATGTCCTGGTGCTGGGTGG + Intronic
1024138060 7:46430620-46430642 GCCCTTCCCCTAGAGATGTGTGG - Intergenic
1024310650 7:47966083-47966105 GGCCAATCCCAGGAGATGGGAGG + Intronic
1024415918 7:49107264-49107286 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1024792705 7:52984965-52984987 GCCCCTTCCCTGGAGATGTGTGG + Intergenic
1024912086 7:54457676-54457698 TCCCATGCCCTAGAGATCTGTGG + Intergenic
1025099116 7:56121032-56121054 GCTCATGCCTGGGATATGGGAGG + Intergenic
1026124697 7:67569331-67569353 GGACATGTCCTGGAAATGGGAGG - Intergenic
1026278606 7:68902330-68902352 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1027201062 7:76064223-76064245 TCCCATGCCCTGGTGATGGGAGG + Intronic
1027369497 7:77493643-77493665 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1027556409 7:79669823-79669845 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1027937759 7:84631764-84631786 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1028048323 7:86151792-86151814 GCCCCTGCCCTGGAGATCTGTGG + Intergenic
1028066644 7:86392402-86392424 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1028084160 7:86616435-86616457 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1028109568 7:86922988-86923010 GGCTATTCCTTGGAGATGGGAGG - Intronic
1028143821 7:87299489-87299511 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1028314418 7:89383151-89383173 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1028404796 7:90463798-90463820 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1028624608 7:92863631-92863653 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1028844085 7:95460532-95460554 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1028928376 7:96385809-96385831 GCCCATGCCCTGTATACGTGAGG - Intergenic
1029016044 7:97316356-97316378 GCCCATAGCCTGGGGGTGGGAGG - Intergenic
1029148020 7:98460332-98460354 GACAAAGCTCTGGAGATGGGTGG - Intergenic
1029914815 7:104198457-104198479 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1030458980 7:109807548-109807570 GCCCCTGCCCTAGAGATTTGAGG + Intergenic
1030655416 7:112162291-112162313 GCCCAGGCCCTGCAGAGTGGAGG - Intronic
1030806737 7:113929178-113929200 GCCCCTGCCTTAGAGAAGGGTGG + Intronic
1030904361 7:115163638-115163660 GCCCCTGCCCTAGAGATTCGTGG - Intergenic
1030970016 7:116045311-116045333 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1031158106 7:118134893-118134915 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1031172562 7:118309733-118309755 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1031230250 7:119096392-119096414 GCCCCTGCCCTAGAGATCCGTGG - Intergenic
1031238610 7:119210401-119210423 GCCCCTGCCCTAGAGAGGTGTGG + Intergenic
1031242748 7:119266938-119266960 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1031289022 7:119908690-119908712 GCCCATGCCCTAGAGATTTGTGG - Intergenic
1031298907 7:120039757-120039779 GCCCATGCCCCAGAGATTTGTGG - Intergenic
1031396992 7:121285576-121285598 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1031435691 7:121729254-121729276 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1031522006 7:122778230-122778252 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1031545861 7:123050704-123050726 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1031576218 7:123418315-123418337 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1031637485 7:124119444-124119466 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1031725397 7:125231088-125231110 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1031803351 7:126276314-126276336 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1031806898 7:126317662-126317684 GCCCCTGCCCTGGAGATCTGTGG - Intergenic
1031807825 7:126328792-126328814 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1031914191 7:127546818-127546840 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1032022922 7:128419996-128420018 CCCCATCCCCTGGACATGGGTGG - Intergenic
1032053078 7:128661927-128661949 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1032179293 7:129661533-129661555 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1032453967 7:132057873-132057895 GCCCCTGCCCTGGAGATCTGTGG + Intergenic
1032470656 7:132176079-132176101 GCCCTTGCCCATGAGTTGGGTGG + Intronic
1033031669 7:137832912-137832934 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1033224900 7:139553802-139553824 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1033256104 7:139803327-139803349 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1033456498 7:141508205-141508227 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1033721020 7:144059678-144059700 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1033832994 7:145275953-145275975 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
1034011366 7:147532280-147532302 GCCCCTGCCCTAGAGATGTGTGG - Intronic
1034040818 7:147874868-147874890 GCCCCTGCCCTAGAGATCTGCGG - Intronic
1034739606 7:153461974-153461996 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1034740018 7:153465273-153465295 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1034750124 7:153560592-153560614 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1034751126 7:153569825-153569847 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1034851832 7:154501069-154501091 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1035029899 7:155850027-155850049 GCCCAGGCTCTGGGGAAGGGTGG + Intergenic
1035135507 7:156699099-156699121 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1037155691 8:15695817-15695839 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1037664087 8:20952908-20952930 GCACCTGCCCTGTAGATGGAAGG + Intergenic
1037882169 8:22578765-22578787 GCCCAGGACCTGGGGATGCGGGG + Exonic
1037979189 8:23238539-23238561 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1038280513 8:26159861-26159883 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1038432309 8:27510081-27510103 CCAGATGCCATGGAGATGGGAGG + Intronic
1038880533 8:31605946-31605968 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1039107486 8:34004784-34004806 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1039298307 8:36181791-36181813 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1039642813 8:39242057-39242079 GTCCATGCCCTAGAGATTTGTGG - Intronic
1040644929 8:49387476-49387498 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1040900014 8:52409180-52409202 GCCCATGCCCACGAGAGGGAGGG + Intronic
1040965844 8:53080256-53080278 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1041138762 8:54790215-54790237 GCCCATGCTCTGATGTTGGGTGG - Intergenic
1041222876 8:55669630-55669652 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1041339013 8:56822361-56822383 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1041434272 8:57820235-57820257 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1041479863 8:58307781-58307803 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1041494339 8:58469278-58469300 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1041826056 8:62097096-62097118 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1041955536 8:63554683-63554705 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1041965060 8:63666937-63666959 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1041984914 8:63909961-63909983 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1042080681 8:65047519-65047541 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1042782819 8:72510545-72510567 GGCCAAGCCCAGGTGATGGGGGG - Intergenic
1042953683 8:74226004-74226026 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1043062276 8:75519122-75519144 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1043336363 8:79181293-79181315 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1043584336 8:81749913-81749935 GCCCCTGCCCTAGAGATGTGTGG + Intronic
1043680875 8:83022992-83023014 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1043719740 8:83532946-83532968 TCCCATACCCTGGAGATAGAAGG + Intergenic
1043834829 8:85034094-85034116 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1044125379 8:88452807-88452829 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1044194123 8:89353874-89353896 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1044220516 8:89663959-89663981 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1044228300 8:89744417-89744439 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1044279642 8:90340497-90340519 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1044303859 8:90616016-90616038 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1044324914 8:90848165-90848187 GCCCCTGCCCTAGAGATATGTGG - Intronic
1044784622 8:95781152-95781174 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1044938617 8:97317847-97317869 GCCCATTCCAAGGACATGGGTGG - Intergenic
1045053683 8:98350207-98350229 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1045139719 8:99267291-99267313 GCTCCTGCCCTGGAGATCTGTGG + Intronic
1045732334 8:105256494-105256516 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1045940193 8:107729294-107729316 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1046004202 8:108459022-108459044 GCCCCTGCCCTAGAGATGTGTGG - Intronic
1046146754 8:110171311-110171333 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1046226413 8:111286041-111286063 GCTCCTGCCCTAGAGATGTGTGG - Intergenic
1046243838 8:111532695-111532717 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1046264630 8:111814788-111814810 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1046300245 8:112277307-112277329 GCCCTTGCCCTAGAGATTTGTGG - Intronic
1046305230 8:112357250-112357272 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1046368578 8:113271011-113271033 GCACCTGCCCTAGAGATGTGTGG + Intronic
1046400340 8:113697060-113697082 GCCCCTGCCCTAGAGATTTGAGG + Intergenic
1046618186 8:116500174-116500196 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1046689660 8:117268277-117268299 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1046735079 8:117768198-117768220 GCCCATGCCCTAGAGATCTGTGG + Intergenic
1046928909 8:119823955-119823977 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1047490501 8:125370361-125370383 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1047565534 8:126040067-126040089 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1047597384 8:126392573-126392595 GCCCAAGAGCTGGAGATGGAGGG - Intergenic
1047941517 8:129831326-129831348 GCCCCTGCCCTAGAGATTGGTGG - Intergenic
1048069719 8:131008918-131008940 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1048479120 8:134771435-134771457 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1048726228 8:137387979-137388001 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1048729269 8:137419323-137419345 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1048782883 8:138021345-138021367 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1048923282 8:139249765-139249787 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1049076229 8:140398574-140398596 GCCCCTGCCCTGGAGATTTGTGG + Intronic
1049170066 8:141154371-141154393 GCCCATGCTCTGGTGCTTGGAGG + Intronic
1049475660 8:142795928-142795950 GCCCATCACCTGGGGAAGGGAGG + Intergenic
1049672205 8:143874954-143874976 GCCCATGTGGTGGAGGTGGGTGG - Intronic
1049725429 8:144143470-144143492 GCGCTTGCCCTGCAGGTGGGAGG + Intergenic
1049825506 8:144665161-144665183 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1049862825 8:144911894-144911916 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1050053077 9:1623230-1623252 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1050121496 9:2313311-2313333 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1050264126 9:3872057-3872079 GCCTCTGCCCTGGAGATTTGTGG - Intronic
1050660218 9:7876327-7876349 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1051013464 9:12447504-12447526 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1051015778 9:12474444-12474466 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1051020385 9:12535482-12535504 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1051285668 9:15493227-15493249 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1051309717 9:15757367-15757389 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1051860899 9:21623692-21623714 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1051946148 9:22572446-22572468 GCCCCTGCCCTGGAGAATTGCGG + Intergenic
1052061875 9:23970098-23970120 GAACAAGCCCTGGAAATGGGGGG - Intergenic
1052093524 9:24357687-24357709 GCCCTTGCCCTAGAGATTTGTGG - Intergenic
1052187861 9:25620594-25620616 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1052210255 9:25894710-25894732 GCCCCTGCCCTAGAGATTCGTGG - Intergenic
1052414309 9:28157769-28157791 GCCCCTGCCCTGGAGAGTTGTGG - Intronic
1052522139 9:29562312-29562334 GCCTCTGCCCTAGAGATGTGTGG + Intergenic
1052557204 9:30032625-30032647 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1052596049 9:30559655-30559677 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1052688334 9:31781634-31781656 GCCCCTGCCCTAGAGATCCGTGG - Intergenic
1052702270 9:31951292-31951314 GCCCCTGCCCTGGGGATCTGTGG - Intergenic
1052768025 9:32661135-32661157 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1052846491 9:33340780-33340802 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1052969504 9:34368542-34368564 GCCCCTGCCCTAGAGATTTGTGG - Exonic
1053245880 9:36534376-36534398 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1053384253 9:37674238-37674260 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1053436949 9:38082076-38082098 GCCCAGGTCCAGGAGCTGGGTGG - Intergenic
1053571873 9:39318332-39318354 GCCCCTGCCCTGGAGAGCTGTGG + Intergenic
1053574432 9:39344585-39344607 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1053592894 9:39532404-39532426 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1053625542 9:39867284-39867306 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1053675296 9:40419984-40420006 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1053838996 9:42172833-42172855 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1053850627 9:42287113-42287135 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1053879317 9:42575939-42575961 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1053893342 9:42718419-42718441 GCCCCTGCCCTAGAGATTTGAGG + Intergenic
1053925081 9:43046319-43046341 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1054093427 9:60877043-60877065 GCCCCTGCCCTGGAGAGCTGTGG + Intergenic
1054095998 9:60903275-60903297 GCTCCTGCCCTGGAGATGTGTGG + Intergenic
1054114910 9:61152963-61152985 GCCCCTGCCCTGGAGAGCTGTGG + Intergenic
1054117459 9:61179214-61179236 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1054125272 9:61300679-61300701 GCCCCTGCCCTGGAGAGCTGTGG - Intergenic
1054218346 9:62383417-62383439 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1054232372 9:62525758-62525780 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1054288569 9:63258510-63258532 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1054386396 9:64560047-64560069 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1054509324 9:65956308-65956330 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1054573411 9:66832875-66832897 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1054590296 9:67003352-67003374 GCCCCTGCCCTGGAGATGTGTGG - Intergenic
1054592846 9:67029571-67029593 GCCCCTGCCCTGGAGAGCTGTGG - Intergenic
1054868398 9:70026076-70026098 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1055083570 9:72291270-72291292 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1055170673 9:73254464-73254486 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1055180569 9:73381080-73381102 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1055595812 9:77863306-77863328 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1055679780 9:78703603-78703625 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1055843368 9:80532049-80532071 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1056064261 9:82916833-82916855 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1056086970 9:83160416-83160438 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1056148863 9:83764773-83764795 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1056595081 9:88001450-88001472 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1056702115 9:88919364-88919386 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1056743053 9:89276542-89276564 TCCCTTGCCCTGGAGATCTGTGG - Intergenic
1056886472 9:90448501-90448523 GCTCATCCCCTGGAGAGGGTGGG - Intergenic
1056915138 9:90739612-90739634 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1056966217 9:91164832-91164854 GCCCAAGCCCTGCAGAGGGAAGG + Intergenic
1057233219 9:93337989-93338011 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1057749340 9:97779197-97779219 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1058004655 9:99902373-99902395 GCCCCTGCCCTGGAGATTTGTGG - Intergenic
1058082321 9:100713047-100713069 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1058221845 9:102313166-102313188 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1058230261 9:102416729-102416751 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1058246004 9:102626052-102626074 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1058380375 9:104371274-104371296 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1058401467 9:104624743-104624765 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1058567546 9:106302661-106302683 GCCCATGCCATGAAAATAGGAGG + Intergenic
1058809940 9:108629851-108629873 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1059045348 9:110860934-110860956 GCCCCTGCCCTGGAGATCTCTGG + Intergenic
1059251543 9:112891156-112891178 GCCCCTGCCCCGGTGGTGGGGGG - Intergenic
1059587340 9:115620236-115620258 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1059753697 9:117272685-117272707 GCCCTTGCCCTAGAGATTTGTGG - Intronic
1059986207 9:119823125-119823147 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1060622572 9:125081449-125081471 GCCCCTACCCTGGAGATCTGTGG + Intronic
1060653744 9:125353224-125353246 GCCCTTGCCCTAGAGATTTGTGG - Intronic
1060726230 9:126007643-126007665 GCTCATGCCCTAGAGCTGGAGGG - Intergenic
1060798926 9:126531631-126531653 GTCCAGGCCCCGGAGATGTGGGG + Intergenic
1061000510 9:127899650-127899672 GCCCAGGCCTGGGAGGTGGGCGG + Intronic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061165850 9:128921863-128921885 GCCCATTACCTGGAGAAGGGGGG + Intronic
1061660319 9:132125784-132125806 GCCCAAGCACTGAAGATGGTTGG - Intergenic
1062013543 9:134280043-134280065 GCCCATGCCCAGGACATAGCAGG + Intergenic
1062070833 9:134554157-134554179 GCCGATGCCCTGTGGATGGAGGG + Intergenic
1062239094 9:135526330-135526352 TCCCCTGCCCTGGAAAGGGGGGG - Exonic
1062359960 9:136183004-136183026 CCCCAGGCCCTGGAGAGGTGAGG + Intergenic
1062384869 9:136305207-136305229 GCTCATGCCCTGGCGCTAGGAGG - Intronic
1062389824 9:136329535-136329557 GTGGATGCCCTGGAGGTGGGCGG + Intronic
1062426177 9:136507250-136507272 GCCCCTGCCCTGGCCATGGATGG + Intronic
1062581184 9:137229955-137229977 GCCCTTGCTCTGGGGGTGGGGGG - Intergenic
1185735075 X:2490057-2490079 GCCCAGGCCCAGGAAGTGGGCGG + Exonic
1186222644 X:7366105-7366127 TCCCCTGCCCTGGAGATTTGTGG + Intergenic
1186372952 X:8965825-8965847 GCCACTGCCCTGGAGATCTGTGG - Intergenic
1186426341 X:9466056-9466078 GCTCAGGCCGGGGAGATGGGCGG - Intronic
1186545936 X:10449557-10449579 GCCCACGCGCCGGAGGTGGGGGG + Exonic
1186620526 X:11235691-11235713 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1186679395 X:11855560-11855582 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1186700213 X:12082816-12082838 CCCCCTGCCCTAGAGATTGGTGG + Intergenic
1186742532 X:12533684-12533706 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1186840988 X:13484537-13484559 ACACATGGACTGGAGATGGGTGG - Intergenic
1187070192 X:15880176-15880198 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1187097426 X:16162854-16162876 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1187555097 X:20344061-20344083 GCCCCTGCCCTAGAGATTTGCGG + Intergenic
1187598338 X:20799599-20799621 GCCCCTGCCCTAGAGATATGTGG + Intergenic
1187643486 X:21319856-21319878 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1187734311 X:22289082-22289104 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1187859334 X:23666492-23666514 GCCCACGGCGGGGAGATGGGTGG + Intronic
1187894500 X:23967532-23967554 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1188169838 X:26911240-26911262 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1188187387 X:27131339-27131361 GCCCCTGCCCTAGAGATATGGGG - Intergenic
1188221573 X:27547105-27547127 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1188261693 X:28031494-28031516 GCCCATGCACTGGAGTTCTGTGG - Intergenic
1188428121 X:30073169-30073191 GCCCCAGCCCTAGAGATGTGTGG - Intergenic
1188755245 X:33953540-33953562 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1188785173 X:34336690-34336712 GCCCCTGGCCTGGAGATTTGTGG - Intergenic
1188804576 X:34571009-34571031 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1188807915 X:34614264-34614286 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1188863501 X:35286149-35286171 GCCCGTGCCCTAGAGATCAGTGG - Intergenic
1188865108 X:35304939-35304961 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1188926015 X:36044536-36044558 GCCCTTGCCCTAGAGATCTGTGG - Intronic
1188947623 X:36326629-36326651 GCCCCTGCCCTAGAGATTTGCGG + Intronic
1189088077 X:38047845-38047867 TCCCCTGCCCTAGAGATGTGTGG - Intronic
1189371202 X:40431013-40431035 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1189637280 X:43024149-43024171 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1189815702 X:44822565-44822587 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1190269751 X:48853384-48853406 GCCCCTGCCTTGGAGATCTGTGG - Intergenic
1190514229 X:51206554-51206576 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1191025472 X:55908746-55908768 GCCCAGGCCCCGGGGCTGGGAGG + Intergenic
1191674340 X:63778753-63778775 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1191688121 X:63913560-63913582 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1191856252 X:65629185-65629207 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1192008455 X:67242168-67242190 GCCCCTGCCCTTGAGATTTGTGG + Intergenic
1192278874 X:69662882-69662904 GCCCCTGCCCTAGAGATGTGTGG + Intronic
1192510840 X:71719573-71719595 GCCCCAGCCCTGGAGAATGGCGG + Intergenic
1192515857 X:71761980-71762002 GCCCCAGCCCTGGAGAATGGCGG - Intergenic
1192689621 X:73348776-73348798 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1192760473 X:74090653-74090675 GTCCATGCCCTGGAGATCTGTGG - Intergenic
1192814550 X:74577218-74577240 GTCCATTCCCTGGAGTTGGAAGG + Intergenic
1192846211 X:74909382-74909404 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1192887069 X:75347120-75347142 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1192934975 X:75849824-75849846 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1193066311 X:77264286-77264308 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1193167742 X:78301467-78301489 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1193250278 X:79282354-79282376 GCCCTTGCCCTAGAGATCTGTGG - Intergenic
1193316597 X:80072183-80072205 GCCCCTGCCCCAGAGATAGGTGG - Intergenic
1193320318 X:80114306-80114328 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1193346769 X:80412614-80412636 GCCCCTGCCCTAGAGATTTGTGG - Intronic
1193449107 X:81644795-81644817 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1193489763 X:82134578-82134600 GCCCCTGCTCTAGAGATGTGTGG - Intergenic
1193497369 X:82231444-82231466 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1193534748 X:82699793-82699815 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1193606970 X:83581004-83581026 GCCCAATCTCTGGAGAGGGGAGG + Intergenic
1193614478 X:83671050-83671072 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1193807867 X:86015747-86015769 GCCCATGCCCTAGAGATCTGTGG + Intronic
1193827214 X:86241346-86241368 GCCCCTGCCCTAGAGATGTTTGG + Intronic
1193865145 X:86721379-86721401 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1193930488 X:87545922-87545944 GCCCACGCCCTAGAGATCTGTGG + Intronic
1194089147 X:89564153-89564175 GCCACTGCCCTGGAGATTTGTGG - Intergenic
1194132209 X:90095232-90095254 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1194159649 X:90434868-90434890 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1194215874 X:91129500-91129522 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1194216319 X:91134271-91134293 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1194220394 X:91182818-91182840 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1194244519 X:91494324-91494346 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1194264457 X:91738005-91738027 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1194364331 X:92995847-92995869 GCCCCTGCCCTAGAGATGTGTGG + Intergenic
1194395898 X:93385824-93385846 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1194497392 X:94634793-94634815 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1194500653 X:94677110-94677132 GCCCCTGCCCTCGAGATCTGTGG - Intergenic
1194522411 X:94935418-94935440 GCCCCTGTCCTGGAGATCTGTGG + Intergenic
1194554293 X:95338109-95338131 GCCTCTGCCCTAGAGATGTGTGG - Intergenic
1194756232 X:97742847-97742869 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1194779766 X:98010421-98010443 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1194829037 X:98597569-98597591 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1194830843 X:98620530-98620552 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1194841799 X:98752773-98752795 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1194864515 X:99049183-99049205 GCCCCTGCCCTAGAGACGTGTGG - Intergenic
1194903327 X:99542503-99542525 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1194952573 X:100144704-100144726 GCACATGCCCTAGAGATCTGCGG + Intergenic
1194982263 X:100452855-100452877 GCCACTGCCCTAGAGATTGGTGG + Intergenic
1195154463 X:102109496-102109518 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1195196003 X:102498624-102498646 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1195428662 X:104763169-104763191 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1195536232 X:106012306-106012328 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1195545151 X:106105645-106105667 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1195667943 X:107447758-107447780 CTCCAGTCCCTGGAGATGGGAGG + Intergenic
1195863628 X:109407265-109407287 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1196012697 X:110905331-110905353 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1196098981 X:111828906-111828928 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1196136970 X:112220703-112220725 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1196391250 X:115209900-115209922 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1196480321 X:116140737-116140759 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1196540465 X:116901002-116901024 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1196567937 X:117230431-117230453 GCCCCTGCCCTGGAGATTAGTGG - Intergenic
1196576250 X:117322625-117322647 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1196973954 X:121138490-121138512 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1197160654 X:123318521-123318543 GCCCTTGCCCTAGAGATCTGTGG - Intronic
1197202264 X:123758588-123758610 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1197301783 X:124789588-124789610 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1197368719 X:125600079-125600101 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1197400178 X:125979986-125980008 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1197441220 X:126493877-126493899 GCCCATGCCCTAGAGATCTGTGG + Intergenic
1197442928 X:126512486-126512508 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1197466131 X:126806610-126806632 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1197527092 X:127576863-127576885 GCCCCTGCCCTAGAGATTTGGGG - Intergenic
1197560605 X:128015585-128015607 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1197561310 X:128025225-128025247 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1197975590 X:132162877-132162899 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1198568928 X:137934710-137934732 GCCCTTGCCCTAGAGATTTGTGG + Intergenic
1198569696 X:137941855-137941877 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1198612521 X:138417885-138417907 GCCCCTGCCCTAGAGATTTGGGG + Intergenic
1198836157 X:140806702-140806724 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1198913472 X:141639031-141639053 GCCCCTGCCCTGGAGATCTGTGG - Intronic
1198919435 X:141708880-141708902 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1198951763 X:142080132-142080154 GCCCCTGCCCTAGAGATGTGTGG - Intergenic
1198996291 X:142577842-142577864 ACCCCTGCCCTGGAGATTTGGGG + Intergenic
1199002961 X:142662397-142662419 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1199079043 X:143556083-143556105 GTCCATGGCCTGGAGGTTGGGGG - Intergenic
1199083632 X:143605369-143605391 GCCCTTGCCCTAGAGATCTGTGG + Intergenic
1199106500 X:143875263-143875285 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1199193220 X:144996823-144996845 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1199194195 X:145007439-145007461 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1199203931 X:145125044-145125066 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1199325374 X:146492789-146492811 GCCCCTGCCCTGGAGATTTGTGG + Intergenic
1199329627 X:146543576-146543598 GCCCCTGCCCTGGGGATCTGTGG - Intergenic
1199362965 X:146943967-146943989 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1199370418 X:147041853-147041875 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1199389326 X:147261669-147261691 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1199462568 X:148100667-148100689 GCCTATGCCCTAGAGATCTGTGG + Intergenic
1199476661 X:148254064-148254086 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1199566014 X:149216658-149216680 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1199820729 X:151443088-151443110 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1199868857 X:151878291-151878313 GCCCCTGCCCTAGAGATTTGTGG - Intergenic
1199869712 X:151887617-151887639 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1199909574 X:152271421-152271443 GCCCCTGCCCTAGAGATCTGTGG + Intronic
1199928166 X:152491388-152491410 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1199931923 X:152531538-152531560 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1200016632 X:153169556-153169578 GCCCCTGCCCTAGAGATCTGTGG + Intergenic
1200039937 X:153357723-153357745 GCCCCTGCCCTAGAGATTTGTGG + Intronic
1200144374 X:153918955-153918977 GCCCAGGCCCTGCACTTGGGAGG + Exonic
1200295450 X:154914548-154914570 GCCCCTGCCCTAGAGATCTGTGG - Intronic
1200342039 X:155408260-155408282 GCCCCTGCCCTAGAGATCTGCGG + Intergenic
1200441815 Y:3220203-3220225 GCCACTGCCCTGGAGATTTGTGG - Intergenic
1200505950 Y:4011834-4011856 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1200556906 Y:4646570-4646592 GCCCCTGCCCTAGAGATTTGTGG + Intergenic
1200563495 Y:4735621-4735643 GCCCCTGCCCTAGAGATCTGTGG - Intergenic
1200672563 Y:6112112-6112134 GCCCCTGCCCTAGAGATGTGTGG + Intergenic