ID: 1183305317

View in Genome Browser
Species Human (GRCh38)
Location 22:37079965-37079987
Sequence CAGCTGGCCTAGGGAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183305299_1183305317 16 Left 1183305299 22:37079926-37079948 CCACCCCATAGCCAGGCCAGGCC 0: 1
1: 0
2: 3
3: 45
4: 408
Right 1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1183305311_1183305317 0 Left 1183305311 22:37079942-37079964 CCAGGCCGGGTCGGGGGTGGCTC 0: 1
1: 0
2: 0
3: 24
4: 235
Right 1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1183305312_1183305317 -5 Left 1183305312 22:37079947-37079969 CCGGGTCGGGGGTGGCTCCAGCT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1183305301_1183305317 13 Left 1183305301 22:37079929-37079951 CCCCATAGCCAGGCCAGGCCGGG No data
Right 1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1183305304_1183305317 11 Left 1183305304 22:37079931-37079953 CCATAGCCAGGCCAGGCCGGGTC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1183305303_1183305317 12 Left 1183305303 22:37079930-37079952 CCCATAGCCAGGCCAGGCCGGGT No data
Right 1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1183305309_1183305317 5 Left 1183305309 22:37079937-37079959 CCAGGCCAGGCCGGGTCGGGGGT 0: 1
1: 0
2: 6
3: 42
4: 342
Right 1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG 0: 1
1: 0
2: 0
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183305317 Original CRISPR CAGCTGGCCTAGGGAACCCA TGG Intronic
900174302 1:1285042-1285064 CAGATGGCCTTGGGGACGCAGGG + Intronic
900956775 1:5890972-5890994 CACCTGGCTTCAGGAACCCAGGG + Exonic
901050295 1:6422893-6422915 CAGCAGCCCTAGGGAGCTCACGG - Intronic
901303786 1:8217790-8217812 CAGCTGGAGAAGGGAACACAAGG - Intergenic
904374657 1:30072932-30072954 CTACTGGCCTAGGGAGCCCAGGG - Intergenic
905241329 1:36583377-36583399 CAGCTAAGCTAGGGAATCCAGGG - Intergenic
907499063 1:54865259-54865281 CAGCTGGCCTGGAGGAGCCAGGG + Intronic
907773005 1:57484718-57484740 AAGCTGGCTAAGGTAACCCAGGG + Intronic
912487949 1:110043837-110043859 CACCTGACCTTGGGAGCCCACGG - Exonic
913228979 1:116725445-116725467 CAGCTGGACAAGGGCACACAAGG + Intergenic
913529578 1:119724260-119724282 CCGCTGGTTTAGGGAATCCATGG - Intronic
915119017 1:153617080-153617102 CAGCTGGGTTAGGGAAGGCATGG - Intergenic
915633582 1:157171205-157171227 CAGCTGGCCTGGGAAAGCCCAGG - Intergenic
918407149 1:184222553-184222575 CAGAAGAACTAGGGAACCCAGGG - Intergenic
920541482 1:206781740-206781762 CAGCTGACTTAGGGAACCGGGGG - Intergenic
921122907 1:212152254-212152276 CAGCTGGAAATGGGAACCCATGG + Intergenic
922717708 1:227885923-227885945 CAGCTGGCCTCGGGCCACCATGG - Intergenic
923725698 1:236503446-236503468 GAGCTGGCCCAGGCATCCCAGGG - Intergenic
1062980334 10:1717315-1717337 CAGCTGCCCTGGGGTCCCCAGGG - Intronic
1066209646 10:33224254-33224276 CAGCTTGCCCTGGGAACCCCTGG - Intronic
1067685645 10:48464885-48464907 CAGCTGGCCACTGGAACCCTTGG + Intronic
1070401535 10:76057017-76057039 AAGGTGGCCTTGGGAACCCAAGG + Intronic
1071707250 10:88012450-88012472 CACCTGGGCTAGGGAACAAATGG + Intergenic
1073331504 10:102672961-102672983 CACCTGGGGCAGGGAACCCAGGG + Intergenic
1073370965 10:102988606-102988628 CAGCTGCCCTAGAGCATCCAGGG + Intronic
1074897934 10:117793100-117793122 GAGCTGGCCCAGGGAAGCCATGG + Intergenic
1075775119 10:124978234-124978256 CTCCTGGCCTAGAAAACCCACGG - Intronic
1076555863 10:131321057-131321079 GGGCTGGCCTGGGGCACCCAAGG + Intergenic
1077085188 11:746746-746768 CAGCTGGCAAGGCGAACCCATGG + Intergenic
1077437449 11:2549704-2549726 CACCAGGCCTGGGGAGCCCAGGG - Intronic
1080923325 11:36730851-36730873 CAGCTGTCCTAGGGAGCCTGCGG - Intergenic
1084653361 11:70501712-70501734 CAGCAGGCTTAGGGAACGCCCGG - Intronic
1084724803 11:70934500-70934522 CATCTGGCCTCGGAAAGCCAAGG - Intronic
1084957953 11:72701578-72701600 CTGCAGGGCTAGGGAAGCCAGGG - Intronic
1085560353 11:77466908-77466930 CACCTGTCCTAGCTAACCCAGGG + Intronic
1088713879 11:112531881-112531903 AAGGTGGCCAAGGCAACCCAAGG - Intergenic
1088997874 11:115018922-115018944 CAGTTATCCTTGGGAACCCATGG - Intergenic
1089176690 11:116553658-116553680 CAGCTGCCCTAGAAAACTCATGG + Intergenic
1089537437 11:119169213-119169235 CGGGTGGCCTCGGGAACGCAGGG - Exonic
1091214110 11:133889983-133890005 CAGCTGTCCTCGGGAGGCCAGGG - Intergenic
1091340487 11:134808852-134808874 CAGCTGGCCCCGGGAAACCGAGG + Intergenic
1091957095 12:4654891-4654913 AAGCTGGCCCAGGTCACCCATGG - Exonic
1094212118 12:27903843-27903865 CAGCAGGCAAAGTGAACCCATGG - Intergenic
1095743598 12:45633394-45633416 CATCTGGACTAGAGAAGCCAAGG + Intergenic
1096406610 12:51348452-51348474 GAGCTGCGCTAGGGAACCCGGGG + Intergenic
1096411419 12:51379490-51379512 CAGCTGGGGTATAGAACCCAGGG + Exonic
1096579826 12:52577689-52577711 CAGGTACCCCAGGGAACCCAAGG + Intergenic
1096812571 12:54181028-54181050 CAGCTGCCCAAGAGAACCCCTGG + Intronic
1097815579 12:64069935-64069957 CAACCGGCCTGGGGAACACAGGG - Intronic
1102523844 12:113496833-113496855 CAGCTGGCCTCAAGTACCCAAGG + Intergenic
1102959775 12:117085044-117085066 CAGCTGGCCAAGGGGCACCAGGG + Intronic
1106421473 13:29589510-29589532 CAGCTGCCCCAAGGACCCCAGGG + Intronic
1106529700 13:30578132-30578154 GAGCTGGCCAAGGGAAGCAAAGG - Intronic
1112159592 13:96853750-96853772 CCGTTGGCCTGGGGAAGCCAGGG - Intergenic
1112186540 13:97133388-97133410 CAGAAGGCCGATGGAACCCAGGG - Intergenic
1112778582 13:102872291-102872313 CAGCTGGGTTAGGAAAGCCAGGG - Exonic
1113421580 13:110175233-110175255 CACCTGGCATAGGCATCCCAGGG - Exonic
1114726803 14:24946557-24946579 CCGTTGGCTTAGGGAACACAGGG + Intronic
1115146116 14:30228077-30228099 AAGCCAGCCAAGGGAACCCAGGG + Intergenic
1117118860 14:52547540-52547562 CAACTGGCCTAGAGAACTCAGGG + Intronic
1121612420 14:95290749-95290771 CAGCAGCCCTAGGAAACCCACGG + Intronic
1123116310 14:105895702-105895724 CATCTGGCCTGGGGAAACCCGGG + Intergenic
1123808193 15:23897051-23897073 GAGCTGCCCTTGGGAACTCATGG + Intergenic
1123811587 15:23932311-23932333 GAGCTGCCCTTGGGAACTCAGGG + Intergenic
1124618004 15:31256500-31256522 CAGCTGCCCTGGGGAGCCCGGGG + Intergenic
1126508010 15:49430449-49430471 CCTCTAGCCTAGGAAACCCAGGG + Intronic
1128242230 15:66108884-66108906 CAGCTGGCCCAGGAAAACCCAGG + Intronic
1128748972 15:70134942-70134964 CTGCAGGCCAAGGGAAGCCAAGG - Intergenic
1128786337 15:70400145-70400167 CAGGTGGCTTGGGGACCCCATGG - Intergenic
1129687663 15:77695775-77695797 CAGCCGGCCTCGGGAACACCTGG - Intronic
1130806278 15:87326903-87326925 CCGCTCTCCAAGGGAACCCATGG - Intergenic
1131144784 15:90003538-90003560 CAGGGGGCCTAGAGAACCAATGG + Intronic
1132375939 15:101328164-101328186 CAGCTGGCCCAGCGAACGCGGGG + Intronic
1133795134 16:9040149-9040171 AAGCTGGCCTGGGGAAATCAAGG + Intergenic
1134632310 16:15765675-15765697 GAGCTGGGCCAGGGACCCCATGG - Intronic
1137231023 16:46568496-46568518 CACCTGGCCTGGGGAAACCTTGG - Intergenic
1137571378 16:49568446-49568468 CAGCTGGTCTAGGGAACAAGGGG - Intronic
1138081427 16:54094604-54094626 CAGGTGGACTTGGGAATCCAGGG + Intronic
1140037897 16:71385003-71385025 CCGGTGGCCTATGGAGCCCAAGG + Intronic
1140356435 16:74310862-74310884 CACCTGGCCTTGGGAGGCCAAGG + Intergenic
1141821960 16:86452656-86452678 CAGCTGGCCCAGTGACCGCATGG + Intergenic
1142192733 16:88725386-88725408 CAGCTGGAGTCGGGCACCCAGGG - Intronic
1144209514 17:13002753-13002775 CAGCTGAGCTAGGGAACACCGGG - Intronic
1146062700 17:29615488-29615510 GAGCTGGCCTAGGGAGGCCTGGG - Exonic
1146654128 17:34625374-34625396 CAGCTGGTGTAGGGTCCCCAGGG - Intronic
1147580025 17:41622910-41622932 CAGCTGGCCCAGGCTGCCCAAGG + Intronic
1147882852 17:43665270-43665292 CATCTGGCCCAGGGACCTCATGG + Intergenic
1150345181 17:64399165-64399187 CAGCTGACTTAGTGAACCCAAGG + Intronic
1150451626 17:65273602-65273624 CAGCGGGCAAAGTGAACCCATGG + Intergenic
1151955154 17:77376456-77376478 CCGCTGGCCTCAGGAACCCTGGG - Intronic
1152193543 17:78902966-78902988 CCGCTGGCCTTGCGAACCCACGG + Intronic
1152206341 17:78976554-78976576 CAGCAGGCCTAGGGACCCCTGGG + Intronic
1152218634 17:79048847-79048869 CTGCAGGCCTGGGGGACCCAGGG - Exonic
1153974992 18:10261417-10261439 CAGCTGACTTAGGGAATCAAGGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157741787 18:50099909-50099931 GAACTGGCCCAGTGAACCCATGG - Intronic
1157811420 18:50699696-50699718 CAGGTGACCTAGGGACCCCCGGG - Intronic
1158867888 18:61655525-61655547 CTGCTAGGCTAGGGGACCCACGG + Intergenic
1160238037 18:77101217-77101239 CAGCTGCCCTGGAGAACCCAGGG - Intronic
1163062058 19:14768088-14768110 CAGCTGTCCTGGGGAAATCAAGG - Intronic
1163253569 19:16141314-16141336 CAGCTGGGCTAGATAACCCCAGG - Intronic
1163268359 19:16234566-16234588 CAGATGGCCTGGGGAAGGCAGGG - Exonic
1163472451 19:17505454-17505476 CAGTTGGCCTGGGGGACCCCCGG - Exonic
1163512985 19:17747275-17747297 CAGCCGGCCTAGGGCAGCCCCGG - Intergenic
1163638661 19:18449662-18449684 CAGCTGGCCCAGGGCAGCCCAGG - Intronic
1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG + Intronic
1165670643 19:37675762-37675784 AAGCTGACCTAAGGAACACAAGG + Intronic
1165707612 19:37987662-37987684 CAGCTGGCCTAGGGGGTCCCAGG - Intronic
1166808334 19:45499987-45500009 CAGAAGGCCTAGGGGCCCCAGGG - Exonic
1166817306 19:45553990-45554012 CACCTAGCCTGGGTAACCCAGGG + Intronic
1166873099 19:45882669-45882691 CAGATGTCCTCGGGAACCCAGGG - Intergenic
926496246 2:13592433-13592455 CAGCTGGGCTAGAGAGTCCAAGG + Intergenic
927062874 2:19440819-19440841 GAGTTGGCCTAGGTAACCAAGGG - Intergenic
927487217 2:23496664-23496686 GAGCTGCCCTAGGGGGCCCAGGG + Intronic
927517478 2:23680688-23680710 AAGATGGCCTAGAGACCCCAGGG - Intronic
927517486 2:23680712-23680734 AAGATGGCCTAGAGACCCCAGGG - Intronic
927517494 2:23680736-23680758 AAGATGGCCTAGAGACCCCAGGG - Intronic
927944100 2:27124229-27124251 CAGCTGGCATGGGGATCACATGG - Intronic
929538945 2:42804946-42804968 GGGCTGACATAGGGAACCCAAGG + Intergenic
929906026 2:46047285-46047307 CAGTTGGCCAAGGGAACCCGAGG + Intronic
932412077 2:71553478-71553500 GAGCTGCCCTGGGAAACCCAAGG - Intronic
937346725 2:121130581-121130603 CAGCTGGCCATGGGACCACAGGG - Intergenic
938240379 2:129738439-129738461 CAGCTGGCTTGAGGACCCCAGGG - Intergenic
941063176 2:160871232-160871254 CAGCTGTCCTAGGGAACATCTGG - Intergenic
943950482 2:194128666-194128688 CAGCTGCCCAAGGCCACCCATGG - Intergenic
945967619 2:216205696-216205718 CAGCTGGGTTAGGAAAACCATGG + Exonic
946284430 2:218692481-218692503 CAGCAGGAGTAGGGAACCTAAGG - Intronic
946353989 2:219173359-219173381 CCGCTGGCAGAGGGAGCCCAGGG + Exonic
948646068 2:239405944-239405966 AAGCTGGGCAAGGGGACCCAGGG - Intergenic
1169763308 20:9120730-9120752 CACCTGGCCGTGGAAACCCATGG - Intronic
1172520926 20:35565010-35565032 CAGCTGGCCTAGGAATGGCAAGG - Intergenic
1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG + Intergenic
1175246170 20:57583454-57583476 CAGCTGACCTGGGGTACGCAAGG + Intergenic
1175747479 20:61468238-61468260 CAGCTGGCCCAAGGTGCCCAGGG + Intronic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1181624918 22:24116735-24116757 CTGATGGCCTAGTGAACTCAGGG - Intronic
1182748335 22:32622670-32622692 CAGCTCAACAAGGGAACCCAGGG - Intronic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
953178206 3:40571265-40571287 CTGCTGGCCTTGGCATCCCAAGG + Intronic
953541297 3:43820949-43820971 CAGATGGCCTGGGAAACCAAAGG - Intergenic
953698927 3:45181166-45181188 CAGCTGGCCCAGGGCCCCCCTGG + Intergenic
953757784 3:45662605-45662627 CAGCTGCCCTAGGGAAGGAAGGG - Intronic
954870837 3:53766424-53766446 CAGCTGGGCCAGGTAACCCGAGG - Intronic
955117088 3:56016690-56016712 ACACTGGCCTAGGAAACCCATGG + Intronic
961348069 3:126277764-126277786 CATCTGGCCTGGGGAGCTCAGGG - Intergenic
962865461 3:139444906-139444928 CCGCTGGCCTGGGCAAGCCAGGG - Intergenic
963729389 3:148956917-148956939 AAGCTGGAAGAGGGAACCCAGGG - Intergenic
963855477 3:150248885-150248907 CTGCTGGCCCAGGGAAAACACGG + Intergenic
964481295 3:157141088-157141110 CAGCAGCCCTAGGAAACCCTAGG + Intergenic
965566872 3:170128996-170129018 CTGCTGGCCTGGGGATACCAAGG + Exonic
967852937 3:194095750-194095772 CAGGTGGCAAAGGGATCCCAGGG - Intergenic
968509388 4:988691-988713 CAGCTGCCCTGGGGAAACCGGGG - Exonic
969208491 4:5667529-5667551 CAGGTGGCCTTGGGGACCCTTGG - Intronic
969374500 4:6754274-6754296 GAGCTGGCCTAGAGAAGTCAGGG - Intergenic
969675832 4:8613886-8613908 CTGCTGGCCTGGAGACCCCATGG - Intronic
974471859 4:62329373-62329395 CAGAAGGACTAGGGAACCAAAGG + Intergenic
975450405 4:74518943-74518965 CTGCTGGCTTAGGGACCCTAAGG - Intergenic
981029748 4:140112549-140112571 CAGCTGGGCTATGAAAGCCATGG + Intronic
981205466 4:142034858-142034880 CAGCAGGCCTAGAAAAGCCATGG - Intronic
984246323 4:177278989-177279011 CAGATGGCAGAGTGAACCCATGG + Intergenic
985017003 4:185646992-185647014 CAGCTGCCATTAGGAACCCAGGG - Intronic
985619628 5:947403-947425 CAGACAGCCTAGGGAGCCCAAGG - Intergenic
986030535 5:3889045-3889067 GAGGAGGCCGAGGGAACCCAAGG - Intergenic
986344489 5:6822249-6822271 GAGCTGGGCGATGGAACCCATGG + Intergenic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
988503408 5:31801642-31801664 CAGCTAGTAAAGGGAACCCAAGG - Intronic
992012370 5:72541546-72541568 CAGCTGGCCTGGAGAAAACATGG - Intergenic
993565628 5:89471381-89471403 CAGCTGGCATGGTGAACCCTGGG - Intergenic
997904053 5:137797087-137797109 CAGCTAGACTATGGAAACCAAGG + Intergenic
1001843152 5:174897729-174897751 CAGCTGGGAGAGGGAACTCAAGG - Intergenic
1006088716 6:31615435-31615457 CAGCTGGCCTAGGGTAGCCCGGG + Intronic
1006119344 6:31794954-31794976 CAGCAGGCCTGGGGGGCCCAGGG - Exonic
1006659092 6:35624215-35624237 AAGCTGGCCTAGGGATCATAGGG + Intronic
1007309553 6:40934658-40934680 CAGCAGGGCCAGGGATCCCAAGG + Intergenic
1010180565 6:73082130-73082152 CAGCTGGCCTCAGGAATCCCTGG - Intronic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018279471 6:162170086-162170108 CAGCTGTTATAGGAAACCCAGGG - Intronic
1018698810 6:166411459-166411481 CAGCCGGCAGAGGGAACACACGG - Exonic
1018714758 6:166523419-166523441 CAGCTGGCCCAGGGAGGCCTGGG + Intronic
1021816401 7:24451449-24451471 CAGCTTGACTGGGGACCCCAGGG + Intergenic
1021939804 7:25668457-25668479 CAGGTAGCCCAGGGAGCCCAAGG - Intergenic
1022561938 7:31358564-31358586 CAGCAGGCCTAGGGACCATAGGG + Intergenic
1023131488 7:37007521-37007543 GAGCTGGCCTAGGGAATGAAAGG - Intronic
1023472612 7:40540872-40540894 CAGCTGGCCAAGGGAAGTCATGG + Intronic
1029606162 7:101600734-101600756 CAGGTGGCCCAGGCCACCCAGGG + Intergenic
1030257505 7:107527653-107527675 CAAATGTCCTAGGGAACACACGG + Intronic
1032721181 7:134551927-134551949 CACTTGGCCCCGGGAACCCATGG + Intronic
1034493610 7:151407491-151407513 CAGCTGGCCCCGGGAGCCCCTGG - Intronic
1035122356 7:156579220-156579242 CAGCTGGGTTAGGGAAGCCCGGG + Intergenic
1035477778 7:159155812-159155834 CAGCTGGCACAGGGTAGCCAGGG + Intergenic
1035690711 8:1557680-1557702 GAGCTGGCCTTGGGACTCCACGG - Intronic
1037817130 8:22118241-22118263 CAGCTGGACTTGGGAACCACGGG + Intronic
1039840528 8:41289956-41289978 CAGCTGGCCTGGGCTTCCCAGGG - Intronic
1040641688 8:49341763-49341785 CAGCTGGTCTAGAGAAAACATGG - Intergenic
1041798928 8:61776914-61776936 TAGATGGCTTAGGGAAGCCAGGG - Intergenic
1044863047 8:96541990-96542012 CTGCTGGAATAGGGAACACAAGG + Intronic
1045398538 8:101786288-101786310 CTGCTGGCATAGAGAACCCAAGG - Intronic
1045520358 8:102897808-102897830 CAGCTGTCCCAGGGAACTCCTGG + Intronic
1047512812 8:125528704-125528726 CATCTTGCCTCAGGAACCCATGG + Intergenic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1050106047 9:2167893-2167915 TAGCTGGCCTGGGGAATTCAGGG + Intronic
1052818981 9:33124055-33124077 CTGCTGGCCTGGTGTACCCACGG - Intronic
1053071545 9:35104990-35105012 AAGCTGGCCTGGGAAACCCAAGG + Exonic
1185500162 X:590910-590932 CATCTGGCAAAGGGAACGCAGGG + Intergenic
1187531684 X:20102850-20102872 CAGCTGGCCTAGGAAGCAGAGGG - Intronic
1191111026 X:56803257-56803279 GAGATGGCCAGGGGAACCCATGG - Intergenic
1199811381 X:151353157-151353179 CAGTGTGCCTTGGGAACCCAGGG + Intergenic