ID: 1183305579

View in Genome Browser
Species Human (GRCh38)
Location 22:37081380-37081402
Sequence TGTCGAAGCCAGACAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183305579_1183305589 28 Left 1183305579 22:37081380-37081402 CCCTGGCCTGTCTGGCTTCGACA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1183305589 22:37081431-37081453 ACTTGGAATGGCGTTTGGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 105
1183305579_1183305587 23 Left 1183305579 22:37081380-37081402 CCCTGGCCTGTCTGGCTTCGACA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1183305587 22:37081426-37081448 GCCTGACTTGGAATGGCGTTTGG No data
1183305579_1183305582 11 Left 1183305579 22:37081380-37081402 CCCTGGCCTGTCTGGCTTCGACA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1183305582 22:37081414-37081436 TCCACCTCACCAGCCTGACTTGG 0: 1
1: 0
2: 2
3: 22
4: 219
1183305579_1183305585 16 Left 1183305579 22:37081380-37081402 CCCTGGCCTGTCTGGCTTCGACA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1183305585 22:37081419-37081441 CTCACCAGCCTGACTTGGAATGG 0: 1
1: 0
2: 1
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183305579 Original CRISPR TGTCGAAGCCAGACAGGCCA GGG (reversed) Intronic
901187640 1:7385528-7385550 GATGGGAGCCAGACAGGCCAGGG + Intronic
903060602 1:20666129-20666151 TTTTGAAGTCAGACAGGCCTGGG - Intronic
903285852 1:22276160-22276182 TGTGGATGCCTGAAAGGCCAGGG - Intergenic
904899642 1:33846851-33846873 TGAGGAAGCCAGACAGTCCTGGG + Intronic
906878034 1:49559033-49559055 TGGCAAAGCCAGCCAGGCCATGG - Intronic
907524523 1:55046499-55046521 TGCAGAAGCCAGAGAGGCCGGGG - Intronic
908068282 1:60431707-60431729 TTTTGAAGCCAGAAAGGACAAGG - Intergenic
909839933 1:80307641-80307663 TGTTGAAGTCAGAGAGACCAAGG - Intergenic
912871778 1:113313268-113313290 AGTAGAAGCCTTACAGGCCAGGG + Intergenic
913168776 1:116213145-116213167 TGTCTAAGCCACACAGTCCATGG + Intergenic
916741552 1:167650903-167650925 TGTCTAAGCCATCCAGTCCATGG - Intronic
916769339 1:167892851-167892873 TGTAGAAGTCAGATAGACCAGGG + Intronic
917958797 1:180126355-180126377 TGTGGGAGCCAGACAGACCCAGG - Intergenic
918068087 1:181115141-181115163 TGTCCAGGGCAGAGAGGCCAAGG + Intergenic
1062960245 10:1567864-1567886 TTTAGCAGCCAGACAGGCCCGGG + Intronic
1063043479 10:2368187-2368209 AGTGGAAGCCACACAGGCCACGG - Intergenic
1064407129 10:15074047-15074069 GGTCCCAGCCAGACATGCCAGGG - Intergenic
1065178034 10:23097330-23097352 TGTTGAAGCCACCCAGTCCACGG - Intronic
1067926047 10:50508772-50508794 TGTGGAAGACAGAAAGCCCAAGG - Intronic
1069899046 10:71696514-71696536 TCTCCAAGTCAGACAGACCAGGG - Intronic
1069992259 10:72322952-72322974 TGAGGGAGCCAGACAGGCGAAGG + Intergenic
1073888680 10:108071402-108071424 TCTCAAAGCTAGAAAGGCCAAGG - Intergenic
1081351729 11:42061888-42061910 TGTTTAAGCCACACAGTCCATGG + Intergenic
1084493869 11:69492576-69492598 TCTGGAAGCCAGAAAGGGCAAGG + Intergenic
1088563026 11:111134959-111134981 TGCCGAGGCCAGAGAGGCAATGG + Intergenic
1089594188 11:119566447-119566469 TGCCGGAGTCAGACAGGCTAGGG + Intergenic
1089680647 11:120117222-120117244 GCTAGAAGCCAAACAGGCCAAGG + Intronic
1091204763 11:133812582-133812604 TATCCAAGCCAGACAGGACAAGG + Intergenic
1092553694 12:9531885-9531907 TGACGAAGCCAACCAGGTCAAGG - Intergenic
1092833283 12:12465221-12465243 TGTGGAAATCAGTCAGGCCAAGG - Intronic
1093205095 12:16239115-16239137 TGTCGAAGGAAGACAGGCAGAGG + Intronic
1093742038 12:22700008-22700030 TGTGGAAGCCACCCAGCCCATGG + Intergenic
1096102579 12:48978632-48978654 GGGCAAAGCCAGGCAGGCCATGG + Exonic
1096757323 12:53810722-53810744 AGTTGAAGCCAGGCAGGCCTGGG + Intergenic
1096995683 12:55836747-55836769 TGTCTAAGACAGACAGGAAATGG + Exonic
1099323587 12:81182208-81182230 AGTAGAAGCCTTACAGGCCAGGG + Intronic
1102988361 12:117296999-117297021 TGTCTAAGCCACCCAGGCAATGG + Intronic
1103001224 12:117386701-117386723 AGACCAAGCCAGACCGGCCAAGG + Intronic
1104662840 12:130623951-130623973 TGTGGAAGTGAGACAGGGCAGGG - Intronic
1105811510 13:24000417-24000439 TGTCTAAGCCAGACAGCTCTTGG + Intronic
1114182148 14:20376302-20376324 AGAGGAAGCCAGACAGGCCCTGG + Intronic
1117693340 14:58332670-58332692 TGACTAAGCCAGGTAGGCCATGG - Intronic
1119881169 14:78101024-78101046 TCTAGAAGCTGGACAGGCCAAGG - Intergenic
1120055906 14:79923900-79923922 TGTTTAAGCCACACAGGCTATGG - Intergenic
1121583405 14:95046916-95046938 TGTGGAACCCAGGCAGGGCATGG - Intergenic
1121755374 14:96398214-96398236 TGTCCAAGCCTGACAGCCCGCGG + Exonic
1122406909 14:101506182-101506204 TCTGGCAGCCACACAGGCCATGG - Intergenic
1123048041 14:105527918-105527940 TGTGGAAGCCCGACGGGCCTTGG + Intronic
1123113959 14:105885518-105885540 TGTCAGGGCCAGGCAGGCCAGGG + Intergenic
1123118140 14:105903986-105904008 TGTCAGGGCCAGGCAGGCCAGGG + Intergenic
1123120424 14:105913848-105913870 TGTCAGGGCCAGGCAGGCCAGGG + Intergenic
1123403145 15:20005426-20005448 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1123512484 15:21012080-21012102 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1125768958 15:42152773-42152795 TGTAGGAGCCAGACAGCCCACGG + Intronic
1126414130 15:48400221-48400243 AGTAGAAGCCAGACAGGGAAGGG + Intergenic
1128801125 15:70497820-70497842 TGTTAAAGCCAGGCAGGGCAGGG - Intergenic
1130556736 15:84928123-84928145 TGGGGAAGCCAGACTGCCCAGGG - Intronic
1132634835 16:938667-938689 TGTTGAAGCCAGGCAGCGCAGGG + Intronic
1134010117 16:10845777-10845799 TGCCGAAGCCACCCAGTCCATGG - Intergenic
1134882450 16:17757503-17757525 TGTGGAAGCCAGACCCACCAGGG - Intergenic
1135580592 16:23622783-23622805 GGTGGAAGCCAGACATGTCAGGG - Intronic
1136409698 16:30069115-30069137 TGTTGAAGGCAGAGGGGCCAAGG + Intronic
1137442130 16:48506678-48506700 TGTTGAAGCCACCCAGTCCATGG - Intergenic
1139330974 16:66189659-66189681 ACCCGAAGCCAGACAGCCCAAGG + Intergenic
1140321392 16:73955143-73955165 TGTAGAAACCAAATAGGCCATGG - Intergenic
1142898708 17:2999004-2999026 TGTCCAAAACAGCCAGGCCAGGG - Intronic
1144308906 17:13994424-13994446 CGTGAAAACCAGACAGGCCAGGG - Intergenic
1144468237 17:15514243-15514265 TGTTTAAGCCACACAGGCTATGG - Intronic
1145307823 17:21685123-21685145 TTTAGAAGCGGGACAGGCCATGG - Intergenic
1147572030 17:41577219-41577241 CTTCGAAGCCAGGCAGGTCATGG + Intergenic
1149664126 17:58353986-58354008 AGTATAAGCCATACAGGCCAGGG - Exonic
1153592338 18:6686873-6686895 TCTGGAAGCCAGAAAGGGCAAGG - Intergenic
1155907763 18:31472958-31472980 TATTGAAGCCAGACATGTCAGGG - Intronic
1156490830 18:37494983-37495005 TGTCAAAGGCAGGCATGCCATGG + Intronic
1156503781 18:37576383-37576405 GTTCAGAGCCAGACAGGCCAGGG - Intergenic
1162918585 19:13887330-13887352 TGTCAAAGCCAAACACGCCCAGG + Intronic
1165204374 19:34171700-34171722 TGTGGAAGCAAGACAGGGCAAGG + Intergenic
1165648130 19:37461869-37461891 AGTTGCAGCCAGACAGGCTAGGG - Intronic
925990284 2:9249303-9249325 TGGGGCAGACAGACAGGCCACGG - Intronic
929547636 2:42866129-42866151 TGTTGAAGCCACCCAGGCTATGG + Intergenic
931715399 2:65024838-65024860 AGTGGAACCCAGACAGCCCATGG - Intergenic
932368774 2:71170595-71170617 TGTTGAAGCCACCCAGTCCATGG - Intergenic
933633805 2:84684855-84684877 AGTAGAAGCCAGAAGGGCCAGGG + Intronic
934926474 2:98385139-98385161 TTTGGTACCCAGACAGGCCAAGG + Intronic
935219071 2:100996431-100996453 TTTACAAGCCAGACAGGCCTGGG + Exonic
939705287 2:145445330-145445352 TGTAGCAGCCAGAGAGGCAAGGG - Intergenic
947791995 2:232873780-232873802 TGTCGCAGCCAGAAAGGCAGGGG - Intronic
947881940 2:233523737-233523759 TGATGAAGCCAGATTGGCCAAGG + Intronic
1171461924 20:25302804-25302826 TGACGGAGCCACACAGGGCAGGG - Intronic
1175261068 20:57674428-57674450 TGTCTAAGCCACACAGTCCGGGG + Intronic
1175716095 20:61254547-61254569 TGGGGAAGCCAGGCCGGCCAGGG - Intronic
1176096640 20:63347395-63347417 TGTGAAAACGAGACAGGCCAGGG - Intronic
1176310592 21:5146948-5146970 TGAGGAAGGCAGACAGGGCAGGG - Intronic
1177347198 21:19889078-19889100 TTTCGATTCCAGAAAGGCCATGG - Intergenic
1179846463 21:44115087-44115109 TGAGGAAGGCAGACAGGGCAGGG + Intronic
1183305579 22:37081380-37081402 TGTCGAAGCCAGACAGGCCAGGG - Intronic
1185400464 22:50612977-50612999 GGTGGAAGGCAGACAGGCGAAGG - Intronic
949729159 3:7087956-7087978 TTTAGCAGCCAGACAGGCCTGGG + Intronic
950011293 3:9725899-9725921 GCTGAAAGCCAGACAGGCCAAGG - Intronic
952560151 3:34582819-34582841 CCTCGAAGGCAGAGAGGCCATGG + Intergenic
953361352 3:42300148-42300170 TGCTGAAACTAGACAGGCCAAGG - Intergenic
954116380 3:48469079-48469101 AGTGGCAGCCAGAGAGGCCAGGG + Exonic
955011108 3:55015247-55015269 TGCTGGAGCCAGACAGCCCAAGG + Intronic
955071231 3:55574237-55574259 TCTGGAAGCCAGGCAGGCCTGGG - Intronic
956344671 3:68265322-68265344 TGTAGAAAGCAGCCAGGCCAGGG - Intronic
956870597 3:73413586-73413608 TTTCGAAGCCAGGCAGACCTGGG - Intronic
957995955 3:87690479-87690501 TGTTGAAGCCAGCCAGTCCCTGG + Intergenic
958143174 3:89589470-89589492 TCTCGAAGCCTGACAGGAGAAGG + Intergenic
961054520 3:123776862-123776884 TGTGGAAGCATCACAGGCCATGG - Intronic
968726993 4:2252364-2252386 TGAGGCAGCCAGACAGGGCAGGG + Intronic
968859222 4:3153077-3153099 TGTTGAAGCCACCCAGGCTATGG - Intronic
971366810 4:25984237-25984259 TGTGGAAGCCAGCCAGGCTGTGG - Intergenic
977162494 4:93652696-93652718 TGTTCAAGCCAGCCAGTCCATGG + Intronic
978340168 4:107714162-107714184 TGCTGAAGGCAGGCAGGCCAAGG - Intronic
979428127 4:120593427-120593449 TGTCTAAGCCACTCAGTCCATGG - Intergenic
982224962 4:153156717-153156739 TCTCTAAGCCACACAAGCCACGG + Intronic
983198884 4:164839016-164839038 TGTCAAAGCAAGAGAGGCAATGG + Intergenic
983209017 4:164939815-164939837 TGACGGAGGCAGACAGGACAGGG + Intergenic
983209958 4:164948224-164948246 TGACGGAGGCAGACAGGACAGGG - Intergenic
985729732 5:1540429-1540451 TGTGGAAACCAAACAGGCCAGGG - Intergenic
985861495 5:2475265-2475287 TGTTGAAGCCACCCAGGCTATGG - Intergenic
989299926 5:39878750-39878772 TGTAGAAGCTAGATAGGGCAAGG + Intergenic
990510672 5:56486638-56486660 GGTAGAAGCCAGAAGGGCCAGGG + Intergenic
990983513 5:61621721-61621743 GGTCTAACCCAGACAGTCCAGGG + Intergenic
991288703 5:65009802-65009824 TGTTTAAGCCACTCAGGCCATGG + Intronic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
995139211 5:108715638-108715660 TGTTGAAGCCACACAGTCCAGGG - Intergenic
995495107 5:112733554-112733576 TGTAGAAGCCAGAAAGGATAAGG + Intronic
996308694 5:122078547-122078569 AGGCGAAGGCAGCCAGGCCATGG + Intergenic
997475256 5:134138970-134138992 AGTAGAAGCCAGAGAGGTCAGGG - Exonic
998734298 5:145117928-145117950 GGTAGAAGTCAGACAGGTCATGG - Intergenic
1001685615 5:173592848-173592870 TGTTGAAGCCACCCAGTCCATGG + Intergenic
1003976498 6:11349940-11349962 TCTCTAAGCTAGATAGGCCAAGG - Intronic
1004526717 6:16415718-16415740 TGTCTTCGCCAGACAGGCAAAGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007474247 6:42108164-42108186 TGGCCAAGCCAGAAAGTCCAGGG + Intronic
1011102732 6:83742470-83742492 AGTGGAAGCCTTACAGGCCATGG - Intergenic
1012054942 6:94394326-94394348 TGTCTGAGAAAGACAGGCCAAGG - Intergenic
1013968555 6:115986348-115986370 TGTCTAAGGTAGACAGGCCTAGG - Intronic
1015700177 6:136027184-136027206 TGTCGAAGCCATCCAGTCTATGG + Intronic
1017920906 6:158871096-158871118 TGTCCAACCCGCACAGGCCACGG + Intronic
1019097732 6:169598712-169598734 TGTAGCAGCCACAGAGGCCAGGG + Intronic
1022840444 7:34159038-34159060 TCTTGAAGACAGTCAGGCCAGGG + Intergenic
1023022764 7:36025450-36025472 TCTGGGAGCCAGACAGGCTAGGG + Intergenic
1023872707 7:44271478-44271500 TGTAGGAGCCAGCCAGGTCATGG - Intronic
1026592894 7:71712068-71712090 GGTCGATGCCAGCCAGGCCCCGG - Exonic
1027899964 7:84100100-84100122 TTTGGAAGACAGACAGGCTATGG - Intronic
1030479394 7:110083194-110083216 TGTAGAAGCCAGACAGATCTTGG + Intergenic
1032837755 7:135689752-135689774 TGTCCAAGCCAGAAGTGCCATGG + Intronic
1034162757 7:149005068-149005090 TGCGGAATCCAGACAGGCCAGGG - Intronic
1035061448 7:156072421-156072443 TGTCTAAGCCACACAGGCACTGG + Intergenic
1036656849 8:10682363-10682385 TGTTGAACCCACACAGTCCATGG - Intronic
1038162192 8:25050378-25050400 TCTCAAAGCCAGAGAGACCAAGG + Intergenic
1041195279 8:55395845-55395867 TGTTGAAGCCACCCAGTCCATGG - Intronic
1045750750 8:105481283-105481305 TGTTTAAGCCACACAGTCCAAGG - Intronic
1048968188 8:139629002-139629024 AGTCGGAGCCAGGCTGGCCAAGG - Intronic
1050030194 9:1377991-1378013 TGTAAAAGCCAGAGAGCCCATGG + Intergenic
1051566017 9:18499043-18499065 TGTAAAAGCTATACAGGCCAAGG - Intronic
1054453355 9:65415559-65415581 TGCTGAAGCCTGGCAGGCCAAGG + Intergenic
1054879106 9:70126339-70126361 TCTGGAAAGCAGACAGGCCAGGG + Exonic
1057840000 9:98478605-98478627 TGTGGAAGGCAGACAAGCCAGGG + Intronic
1059200889 9:112415514-112415536 TGTTCAAGTCAGACAGACCAGGG - Intronic
1060299472 9:122366517-122366539 TGTTGAAATCATACAGGCCATGG + Intergenic
1189472187 X:41322897-41322919 AGTGGCAGCCAGAGAGGCCAGGG + Intergenic
1194540961 X:95171926-95171948 GTTCGAAGCCAGCCTGGCCAAGG + Intergenic
1197487537 X:127072687-127072709 TGTGGAAACTATACAGGCCAGGG - Intergenic
1198412104 X:136381010-136381032 TTAAGAAGCTAGACAGGCCAGGG - Intronic
1199691588 X:150312963-150312985 TGTGGCAGCCAGACATGCCATGG + Intergenic