ID: 1183306588

View in Genome Browser
Species Human (GRCh38)
Location 22:37086181-37086203
Sequence TTTTTTGCCCAAATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183306588_1183306592 1 Left 1183306588 22:37086181-37086203 CCATCCTCAATTTGGGCAAAAAA 0: 1
1: 0
2: 0
3: 20
4: 273
Right 1183306592 22:37086205-37086227 GTGAGCAGTGAGCCCAGTGGAGG 0: 1
1: 0
2: 2
3: 27
4: 276
1183306588_1183306591 -2 Left 1183306588 22:37086181-37086203 CCATCCTCAATTTGGGCAAAAAA 0: 1
1: 0
2: 0
3: 20
4: 273
Right 1183306591 22:37086202-37086224 AAGGTGAGCAGTGAGCCCAGTGG 0: 1
1: 0
2: 3
3: 43
4: 301
1183306588_1183306594 9 Left 1183306588 22:37086181-37086203 CCATCCTCAATTTGGGCAAAAAA 0: 1
1: 0
2: 0
3: 20
4: 273
Right 1183306594 22:37086213-37086235 TGAGCCCAGTGGAGGGCCCTTGG 0: 1
1: 1
2: 3
3: 29
4: 292
1183306588_1183306593 2 Left 1183306588 22:37086181-37086203 CCATCCTCAATTTGGGCAAAAAA 0: 1
1: 0
2: 0
3: 20
4: 273
Right 1183306593 22:37086206-37086228 TGAGCAGTGAGCCCAGTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183306588 Original CRISPR TTTTTTGCCCAAATTGAGGA TGG (reversed) Intronic
902661188 1:17905073-17905095 TCTTGTGCCCAACATGAGGAAGG - Intergenic
902707309 1:18214410-18214432 TTCATGGCCCAAATTTAGGATGG + Intronic
904557975 1:31377760-31377782 GTTTTCTCCCAAATAGAGGAAGG + Intergenic
908037998 1:60076375-60076397 TTTTTTGACCAAATGAATGAAGG + Intergenic
911751577 1:101502429-101502451 TGTTTTCCCCTACTTGAGGAGGG + Intergenic
912716321 1:111986541-111986563 TTGCTTTCACAAATTGAGGATGG - Intronic
914349160 1:146824906-146824928 TTTTTCGGGCAAATTAAGGATGG + Intergenic
915602140 1:156929214-156929236 TTTCATGCCCCCATTGAGGAAGG + Intronic
916347662 1:163812277-163812299 TATTTTGGCCAAAATGATGATGG + Intergenic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
918251856 1:182710134-182710156 GTTATGGCCCAAAATGAGGAAGG + Intergenic
920155509 1:203947078-203947100 TTTTTTGCCCAAATCAAAAATGG + Intergenic
921304549 1:213782770-213782792 TTCTTTGGCCAAATTTAGGGTGG - Intergenic
921678827 1:218007747-218007769 TATTTTGCCAAAGTTGAGGATGG - Intergenic
922217289 1:223530564-223530586 TATTTTGCCAAAGTTAAGGATGG - Intergenic
923005299 1:230044812-230044834 TGTTTTGCCCAAATTTTGCATGG + Intergenic
924551173 1:245079255-245079277 ATTTCTGCCCAAGTTGAAGATGG + Intronic
1063178087 10:3570317-3570339 TGTTTTGCCCAAGAAGAGGAAGG - Intergenic
1063507628 10:6615384-6615406 TTTTCTGTGCAAATTGGGGAAGG + Intergenic
1064289180 10:14017788-14017810 ATATTTTCCCAAAGTGAGGAAGG + Intronic
1064603394 10:17015299-17015321 TGTTTTCCCCTACTTGAGGAGGG - Intronic
1064904091 10:20326601-20326623 TTCTTTGCTCAAATTAAGAAAGG + Intergenic
1066000476 10:31100228-31100250 AATTTTGCAGAAATTGAGGAGGG + Intergenic
1066065268 10:31757128-31757150 TTTTTTGGCAAAAAAGAGGATGG - Intergenic
1067968140 10:50937629-50937651 TGTTTTGCTCAAATTGCGTATGG + Intergenic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1068975363 10:63003335-63003357 TTTTTTGCCCACATTTCTGAGGG - Intergenic
1069291227 10:66782478-66782500 TTTTATAGCAAAATTGAGGAGGG - Intronic
1071124409 10:82317759-82317781 TTATTTGCCAAAGTTAAGGACGG + Intronic
1074026165 10:109637661-109637683 TATTTTGCCAAAGTTGAGGATGG - Intergenic
1075594191 10:123716070-123716092 GTTTTTGCCGAAACAGAGGAAGG + Intronic
1077256505 11:1586067-1586089 ATTTTTTCCCAAGTTGAGTAGGG - Intergenic
1078124786 11:8550753-8550775 TTCTTTGCCCAAAATGCTGAAGG - Intronic
1079148761 11:17878336-17878358 ATTTTTGGCAAAATTTAGGAAGG + Intronic
1079318665 11:19431545-19431567 TTTTCTGGCCAAAGTGAGGTTGG + Intronic
1079421203 11:20290648-20290670 TCTCTGGTCCAAATTGAGGAAGG + Intergenic
1079491922 11:20998466-20998488 TTTTTTTTCCACAGTGAGGATGG + Intronic
1082173651 11:49036064-49036086 TTTTTTGCCCCAAATGTGTAAGG - Intronic
1082285716 11:50316026-50316048 TTTTGTGGCCAAATGGAGGAAGG + Intergenic
1083837684 11:65282542-65282564 TGTTTTGCCAACAATGAGGATGG + Intronic
1084986985 11:72883460-72883482 TCTTTTGCCCAAATTTAGATTGG - Intronic
1087027910 11:93670045-93670067 TTTTTTGACATCATTGAGGAAGG - Intronic
1088152417 11:106760569-106760591 TTTTTTGACATACTTGAGGATGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091022772 11:132115884-132115906 TTATTTGCCCCAATAGAGAAAGG - Intronic
1091075870 11:132616024-132616046 TTTTTTGCCCAAATAGGTGTTGG - Intronic
1091462747 12:657614-657636 TTTTTTGCCCATATTTAGTGGGG - Intronic
1091611620 12:2015202-2015224 TTGTCAGCCCTAATTGAGGATGG - Intronic
1092103761 12:5906022-5906044 TTTTCTTCCCAGACTGAGGAAGG + Intronic
1092887511 12:12937831-12937853 TTTTTTTCTAAAATTGATGAAGG - Intergenic
1093564686 12:20588684-20588706 CTTTTCCCCCATATTGAGGAGGG - Intronic
1095517669 12:43024503-43024525 TTTTTTTCCTAAATTCAAGATGG - Intergenic
1097157465 12:57023304-57023326 TTCTTTGCCCAAGCAGAGGAGGG - Intronic
1098368110 12:69727100-69727122 GTCTTTGCCCAAACTGATGACGG + Intergenic
1098466512 12:70793128-70793150 ATTTGTGCCCTAATTGAAGAGGG + Intronic
1099541666 12:83917321-83917343 GTTTGTGCCCTAATTGAAGAGGG - Intergenic
1100085799 12:90909080-90909102 TTATTTCTCCAAATTGAGGAAGG + Intronic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1103147461 12:118607978-118608000 TTTCTGGCCCAAACAGAGGATGG - Intergenic
1103803204 12:123553006-123553028 TTTTGTCCCCTACTTGAGGAAGG + Intergenic
1107419962 13:40236929-40236951 TTTCCTGGCCAAATTGAGGCGGG + Intergenic
1107681923 13:42861031-42861053 TTTTCTCCCCAAAATGAGAAGGG + Intergenic
1108613955 13:52112752-52112774 CTTTATGCCCAAATTCAAGAAGG - Intronic
1108949577 13:56073940-56073962 TTTTTTGCCAATATTGAATATGG - Intergenic
1109627610 13:64996191-64996213 TTTTTCCCCCAAAGTGAGAAAGG + Intergenic
1110848301 13:80215077-80215099 TTTTTTTTCCAACTTGAGTATGG + Intergenic
1111490881 13:88973304-88973326 TTTTTTGCCCAGATTTTTGAAGG - Intergenic
1111886606 13:94029411-94029433 TTCTTTGCTAAAATTGTGGAGGG + Intronic
1113437262 13:110302932-110302954 ATTGTTCCCCAAATTGAAGAAGG - Intronic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1114757205 14:25272973-25272995 TTTTTTTCCCAAAGGGAAGAAGG - Intergenic
1115266258 14:31503784-31503806 TTTTATGCCTAAATTGGGTATGG - Intronic
1117818709 14:59625739-59625761 TTTTTTTCTAAAAATGAGGAAGG - Intronic
1118870839 14:69740021-69740043 TATTTTGCCAAGGTTGAGGACGG + Intronic
1119042646 14:71289055-71289077 TATTTTGCCAAAGTTAAGGAGGG + Intergenic
1119336061 14:73834592-73834614 TTGATTGACGAAATTGAGGAAGG - Intergenic
1119951096 14:78746220-78746242 ATTTTTGCCCACATTTATGAAGG + Intronic
1121843357 14:97152645-97152667 TTTTTTGGCCAGACTAAGGAAGG + Intergenic
1122362461 14:101175493-101175515 TTTTTTGGCCAAATGAATGAAGG + Intergenic
1124157671 15:27241436-27241458 TCTTTTACCCAAAATAAGGATGG - Intronic
1124160589 15:27265145-27265167 TTTTTTGGTAAAATGGAGGAGGG - Intronic
1125211757 15:37224995-37225017 AGGTTTGCCCGAATTGAGGACGG + Intergenic
1125295021 15:38193189-38193211 TTTTTTGACCAAATCCTGGAAGG + Intergenic
1126267965 15:46777074-46777096 TTTATTGCTTAAATAGAGGATGG + Intergenic
1127142408 15:55991591-55991613 TATTTTGTCCACATTGAGGAAGG - Intronic
1127202851 15:56675952-56675974 TTTTTAGCCCAAATAAAAGATGG + Intronic
1130083499 15:80756500-80756522 TGCTTTGCCAAAACTGAGGAGGG + Intergenic
1132077635 15:98835561-98835583 TAACTTTCCCAAATTGAGGAGGG - Intronic
1135988041 16:27198589-27198611 TATTTTGCCAAAGTTAAGGACGG - Intergenic
1137435643 16:48452498-48452520 TTATTTGGCCAAGTGGAGGATGG + Intergenic
1137771180 16:51016207-51016229 TTTTGTGCCCAAATTCAAGGAGG - Intergenic
1139027491 16:62836552-62836574 TATTTTGCTCAAATTGAGAGTGG + Intergenic
1139932343 16:70538398-70538420 TTTTTGGCTCAAACTGAGCAGGG + Exonic
1139984874 16:70890648-70890670 TTTTTCGGGCAAATTAAGGATGG - Intronic
1140783977 16:78322494-78322516 TTATTAGCCCAATTTAAGGATGG + Intronic
1142551674 17:744477-744499 TTATTTGCCAAAATCTAGGATGG + Exonic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1143269055 17:5662217-5662239 TTTTATGTCCAATTTGTGGATGG + Intergenic
1145314327 17:21720305-21720327 CATTTTGCTGAAATTGAGGATGG - Intergenic
1146433746 17:32823062-32823084 TTTATTTCCCACATTCAGGAAGG + Intronic
1148251012 17:46080349-46080371 TTTTTTCCCCAAATGGAGGTAGG - Intronic
1151144284 17:72026193-72026215 TGTTTTACTCAAATTGAGGTAGG - Intergenic
1152141554 17:78540241-78540263 TTTGATGCCCAAATTCATGAAGG + Intronic
1155693050 18:28650584-28650606 TTTTTTGCTCAACTTTAAGAGGG + Intergenic
1157430767 18:47623516-47623538 TTTTTTATCCAATTTGATGATGG - Intergenic
1157752464 18:50192098-50192120 GTTTGTGCCCTAATTGAAGAGGG + Intronic
1158843553 18:61415728-61415750 TTTTCTGCCCAAAATGATAAAGG - Intronic
1159745435 18:72228769-72228791 TTATTTGCCAAAGTTAAGGATGG - Intergenic
1161136919 19:2625388-2625410 TTTTTTGCAGAAATAGAGGGGGG + Intronic
1161399657 19:4061632-4061654 TTTATTGCCCTAAATGGGGAGGG + Intronic
1162297881 19:9826011-9826033 TTGTTTGACTGAATTGAGGAAGG + Intronic
927462467 2:23310825-23310847 ATTTTTGCCCAAGAGGAGGAAGG + Intergenic
928182075 2:29075271-29075293 TTTTCTGCTCAAACTGAGCATGG + Intergenic
928782649 2:34843704-34843726 TTTTTTCCCAAAATTTATGAGGG + Intergenic
930982280 2:57541730-57541752 TTTTCTTCCCAAATATAGGAGGG + Intergenic
935809364 2:106782009-106782031 TTTTCTGGGCAAATGGAGGAAGG + Intergenic
938111682 2:128571810-128571832 GTTTGTGCCCTAATTGAAGAGGG - Intergenic
942436841 2:175988016-175988038 TTCTTTACCCAAAGTAAGGAAGG - Intronic
942554820 2:177160933-177160955 TTTTTTGCCAAAATAGTGTAAGG - Intergenic
942883252 2:180889403-180889425 TTTTGTGCCCACATTCATGATGG - Intergenic
945135035 2:206617889-206617911 TTTTTTTCCCTAATGGACGAAGG + Exonic
945285759 2:208079539-208079561 TATTTTGCCAAGGTTGAGGACGG - Intergenic
945804611 2:214475225-214475247 TTTTATGCCCAAATGGACCAGGG + Intronic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
946913651 2:224492097-224492119 TTTTTTGCTAAAACTGAGCAAGG - Intronic
947121959 2:226825140-226825162 TATTTTGCCAGAATTTAGGAGGG + Intergenic
947635295 2:231677622-231677644 TTTTTTGCAGAAATTGCGGGGGG + Intergenic
947781998 2:232775882-232775904 GTGTTTGCCCTAATTGTGGAGGG - Intronic
1170675320 20:18474349-18474371 GTTTTTGTCCCACTTGAGGATGG + Intronic
1175496759 20:59419872-59419894 TATTTTCTCCGAATTGAGGAGGG + Intergenic
1177869639 21:26555871-26555893 TTTGTTGATAAAATTGAGGAGGG - Intronic
1177872285 21:26588476-26588498 TTTTTGGCCTAAATTAATGAGGG + Intergenic
1178183456 21:30191577-30191599 TGTTTTGCCAAGATTAAGGAAGG + Intergenic
1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG + Intergenic
1178674474 21:34619214-34619236 TTTTTTTTTCAAATGGAGGAAGG + Intergenic
1178736793 21:35159873-35159895 TTGTTTCCCCAAATTCAGAATGG - Intronic
1178842847 21:36151747-36151769 TATTTTGCCAAGGTTGAGGATGG - Intergenic
1179366938 21:40767368-40767390 TGTTTTGCCCAAAGTGATGTGGG - Intronic
1180822958 22:18844618-18844640 TTTTTGTCCCAAATTGTGGAAGG - Intergenic
1181190003 22:21131394-21131416 TTTTTGTCCCAAATTGTGGAAGG + Intergenic
1181209201 22:21279111-21279133 TTTTTGTCCCAAATTGTGGAAGG - Intergenic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1181502708 22:23327075-23327097 TTTTTGTCCCAAATTGTGGAAGG + Intergenic
1181653506 22:24275477-24275499 TTTTTATCCCAAATTGTGGAAGG + Intronic
1182329863 22:29543617-29543639 TTTTTGGCCCCAGATGAGGATGG - Intronic
1182684912 22:32114591-32114613 TCATTTCCCCAAATTGAAGATGG - Intergenic
1183133534 22:35863890-35863912 TGCTTTGCCCGAAGTGAGGAGGG - Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
1203217743 22_KI270731v1_random:16332-16354 TTTTTGTCCCAAATTGTGGAAGG + Intergenic
1203273098 22_KI270734v1_random:70524-70546 TTTTTGTCCCAAATTGTGGAAGG - Intergenic
949093091 3:52573-52595 TGTTTTCCCAAAATGGAGGAAGG + Intergenic
949304816 3:2627992-2628014 TTTTGTGTACAAATTGATGAGGG + Intronic
952598878 3:35054680-35054702 TTTTTTCACCAAATTGTTGAAGG + Intergenic
953528569 3:43716473-43716495 TTTTCTGCCAAAAGTGAGGGAGG - Intronic
954860597 3:53686413-53686435 TTTTGTGTCCAAATTAATGAAGG - Intronic
954914999 3:54141197-54141219 TTTTTCCCCCAAATAGAGAAGGG - Intronic
955962502 3:64355287-64355309 TTTTATGCTGAAATTTAGGAGGG - Intronic
956150206 3:66233167-66233189 TTTTTTTCTCAAAAGGAGGAGGG - Intronic
957028042 3:75207672-75207694 TTTTTTTGCCAAATTTAGGAAGG + Intergenic
957158348 3:76575590-76575612 TTTTTGGCCCAAAAGGGGGAAGG - Intronic
958667336 3:97158501-97158523 TTATTTGCCAAAGTTAAGGATGG + Intronic
958858151 3:99411793-99411815 TTTTTTGCCAAACTTGTGAATGG - Intergenic
962226105 3:133610873-133610895 TTTTTTCCCCAAATTTTTGATGG - Intronic
962334473 3:134514430-134514452 GATTTTGCCAAAAGTGAGGAAGG + Intronic
962453187 3:135539040-135539062 TGTTTTGGCCATGTTGAGGATGG + Intergenic
962541096 3:136383080-136383102 GATTTTGCTCAAGTTGAGGAAGG + Intronic
963604547 3:147403653-147403675 TTTCTAGGCCAAATTGAGGGTGG - Intronic
963914802 3:150849149-150849171 TTATTTGCCCAAATCAAGGAAGG + Intergenic
965710853 3:171555134-171555156 TTTTAAGCCCAAATAGAGGAAGG + Intergenic
967129180 3:186454928-186454950 TTTGATGCCCAAATTGATGCAGG + Intergenic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
971247996 4:24947875-24947897 TTATTTGGCCATATTGCGGATGG - Intronic
971957546 4:33441185-33441207 TTTCTTTCCCAAATTCAAGATGG + Intergenic
972348930 4:38217840-38217862 TTTTTTGCTAAGATTGATGATGG + Intergenic
973046015 4:45534984-45535006 TTTTGTCCCCTACTTGAGGAGGG + Intergenic
975048119 4:69828187-69828209 TTTTATTCCCTTATTGAGGACGG - Intronic
976114654 4:81713923-81713945 TTTTTTCCCCATTGTGAGGATGG - Intronic
976190760 4:82484426-82484448 TCTTTTGCTCAAATTTAGTAGGG - Exonic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
976543879 4:86310296-86310318 TATTTTGCCAAGATTTAGGATGG - Intronic
977247502 4:94650324-94650346 GTATTTGCCAACATTGAGGAAGG - Intronic
977348796 4:95853294-95853316 TTTTTAGACAAAAATGAGGAGGG + Intergenic
977884242 4:102238837-102238859 TATTTTCCCCTACTTGAGGAGGG + Intergenic
978651371 4:111009723-111009745 TTTTTCTCCCAAATTCTGGAAGG + Intergenic
978679324 4:111359773-111359795 TATTTTGCCTAAATTGAGTCAGG + Intergenic
978747332 4:112208980-112209002 TTTTGTGCCCTGCTTGAGGAGGG + Intergenic
980026762 4:127777497-127777519 TTTTTTGCACAAATTGGGGGAGG + Intergenic
980178636 4:129377229-129377251 TTTTTTTTTCAACTTGAGGAAGG + Intergenic
981230594 4:142350234-142350256 TTTTTTGCTCAAATAAAGCAAGG - Intronic
981545028 4:145884816-145884838 TTTTTTTCCCAAATGGATCAGGG + Intronic
981679308 4:147376845-147376867 TTCCCTGCCCACATTGAGGATGG + Intergenic
983310876 4:166059631-166059653 TTTTTTGTCGGAATTGAGAAGGG - Intronic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984580694 4:181506613-181506635 TGTTCTGCCCAAATCCAGGAGGG - Intergenic
984669071 4:182462076-182462098 TTTTTTTTCCAAATTGAGACAGG + Intronic
984797390 4:183675972-183675994 ATTTATCCCAAAATTGAGGAGGG + Intronic
985713293 5:1442230-1442252 TTTTATGCCCATCTTGAAGAGGG - Intronic
986404323 5:7410737-7410759 TTTTTTCCACAAAGGGAGGAGGG + Intronic
986884731 5:12219234-12219256 TTTTTTACTAAAAATGAGGAAGG - Intergenic
987933663 5:24435086-24435108 TTGTTTGCTCAAAATGAGCAAGG + Intergenic
987963417 5:24840330-24840352 TTTTTTCCACAAGCTGAGGACGG - Intergenic
988798104 5:34671161-34671183 TTGTCAGCCCTAATTGAGGATGG + Intronic
989642301 5:43594622-43594644 TCTTTATCCCAAATTCAGGATGG + Intergenic
989705894 5:44329829-44329851 TTGTTTGCCCAGATTCAGTAGGG - Intronic
990526344 5:56631576-56631598 TTTATGACCCAGATTGAGGAAGG - Intergenic
991307400 5:65193072-65193094 TGTTTTGCCTGATTTGAGGAAGG - Intronic
991359853 5:65808209-65808231 TTTTTTGCATAAAGAGAGGAAGG + Intronic
995123819 5:108560415-108560437 TCTTTTGCCCAAATTCATAAAGG - Intergenic
995196583 5:109376562-109376584 TATTTTGCCCAAAATGACAAAGG + Intronic
995549503 5:113266778-113266800 TTTTTTGTCCATATGGAGGGAGG - Intronic
995863525 5:116665825-116665847 TTTCTTGCTCAAAATGGGGAGGG - Intergenic
1000182573 5:158826088-158826110 TTTATTGACAAAATTTAGGAAGG - Intronic
1000690316 5:164310214-164310236 TTTTTTTCCCAAAATGAAAAAGG + Intergenic
1003110235 6:3247110-3247132 TTTTTTTTCCAAATTGAGACAGG - Intronic
1003684634 6:8289653-8289675 TGTTTTGGTCAAATTGATGAGGG - Intergenic
1003780200 6:9415919-9415941 TTTTCTGTCAAAATTGAGCAAGG - Intergenic
1004478666 6:15998505-15998527 TTTTATTCCCAAAGTCAGGATGG - Intergenic
1008650486 6:53556199-53556221 TATTTTGCCAAGGTTGAGGATGG - Intronic
1008684318 6:53907430-53907452 TTTTTTCCCCAAATGGTTGAGGG + Intronic
1009404837 6:63299420-63299442 TCTTTTGCTCAAATCAAGGAGGG - Intronic
1010057432 6:71583197-71583219 TGTTTTGCCCACATTGGGCAGGG - Intergenic
1010341724 6:74761444-74761466 TTTTTTTCCAAAATTAGGGAAGG - Intergenic
1015115891 6:129649199-129649221 TTTTTTTCCCAAAATGAAAAGGG - Intronic
1015821852 6:137269790-137269812 TGATTTGCCCAAAATGAGGTGGG + Intergenic
1017656551 6:156634614-156634636 TTTTTTACCTAAATGGATGATGG + Intergenic
1019099981 6:169622324-169622346 TATTTTGCCCAGGTTGGGGATGG - Intronic
1019453477 7:1112211-1112233 TCTTTGGCCCAGAATGAGGATGG + Intronic
1019993171 7:4706568-4706590 GATTCTGCCCACATTGAGGAAGG - Intronic
1020840295 7:13209266-13209288 TTTTTTTACCAAAATGAGAAGGG - Intergenic
1022834771 7:34102981-34103003 TTTTTTTCCAAATTTGAGCATGG - Intronic
1026771055 7:73199308-73199330 TTTTTTTCCCAGATGGAGTATGG - Intergenic
1027011923 7:74752705-74752727 TTTTTTTCCCAGATGGAGTATGG - Intronic
1027076118 7:75193346-75193368 TTTTTTTCCCAGATGGAGTATGG + Intergenic
1028025322 7:85829857-85829879 TTGTTTGCCCAGAATGAGCATGG + Intergenic
1030005523 7:105114871-105114893 TTTGTTGGACAAATTGAGGATGG - Intronic
1031885206 7:127239178-127239200 TTTTTTGGACAACTTTAGGAAGG - Intronic
1031927861 7:127655199-127655221 TCTTTTGCCAAAAAAGAGGAAGG - Intronic
1032860981 7:135879025-135879047 TTTTTTGCCCAGTATGAAGATGG + Intergenic
1034391578 7:150791613-150791635 TTTTTTTTCCAGAATGAGGAAGG - Exonic
1038223436 8:25632356-25632378 TTTGTTGGCCAGATTGAGGCAGG - Intergenic
1038650120 8:29394836-29394858 TCTGTTGCACAAATTGAGAAAGG - Intergenic
1040529921 8:48258276-48258298 TTTTTCTCCCAAATTGAAAATGG + Intergenic
1041330057 8:56714470-56714492 TTTATTGCCCCAAGTGGGGAAGG - Intergenic
1041505252 8:58590239-58590261 GTTTTTTCCCAAATGCAGGAAGG + Intronic
1042093812 8:65189672-65189694 TTTTTTGCCAAAATAGATTAAGG - Intergenic
1042211198 8:66382130-66382152 TTATTTGGCCAAATTCTGGAAGG + Intergenic
1043582208 8:81727120-81727142 GTTTTTGCCCAAAATAAGGTGGG + Intronic
1043919187 8:85961813-85961835 AAGTTTGCCCAAATTCAGGATGG - Intergenic
1044926732 8:97215559-97215581 TTTTCTTCCCCAGTTGAGGATGG + Intergenic
1044938001 8:97311602-97311624 TTTTTAGCACAAATTAAAGATGG + Intergenic
1045595001 8:103644379-103644401 TTTTTTTCTCATTTTGAGGATGG + Intronic
1045687419 8:104726655-104726677 TTTTTTGTGGAATTTGAGGAAGG + Intronic
1047287277 8:123498387-123498409 ATTTTTGGCCAAATGGAGCAGGG + Exonic
1047335018 8:123927248-123927270 TTTTTTTCCCAAAATGAGATTGG - Intronic
1047488577 8:125355299-125355321 TATTTTGCCAAAATTAAAGAAGG + Intronic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1048456231 8:134580886-134580908 ATTTTGCCCCAAACTGAGGAAGG + Intronic
1048460647 8:134618547-134618569 ATATTTAACCAAATTGAGGAGGG - Intronic
1048596517 8:135872569-135872591 TTTACTGTCAAAATTGAGGACGG + Intergenic
1048654413 8:136519670-136519692 TTTTTTTCTCCAATTGAAGAGGG + Intergenic
1052254590 9:26439819-26439841 TACTTTGCATAAATTGAGGAAGG - Intergenic
1053341985 9:37344855-37344877 TTTTTTGAACAAATTAATGAAGG + Intronic
1055271653 9:74566996-74567018 TTTGTTGCCCCAAATGAGGTAGG - Intronic
1056479146 9:86983366-86983388 TTTTTTTCTGAAATTGATGAAGG - Intergenic
1059046257 9:110871215-110871237 TTTATTGGACAAATTGATGAAGG + Intergenic
1185934290 X:4238259-4238281 TTTTGGGACCAAATTCAGGAGGG - Intergenic
1186250353 X:7659552-7659574 TTTTGTGTCCACATAGAGGAGGG + Intergenic
1187062261 X:15798285-15798307 TTTTTTTCCCAAATTTTGAATGG + Intronic
1187285276 X:17898497-17898519 CTTACTGCCCAAATTGGGGATGG + Intergenic
1188025120 X:25200188-25200210 TTTTTTGACAAGACTGAGGATGG + Intergenic
1188136656 X:26501009-26501031 TGTTTTTCCCTACTTGAGGAGGG + Intergenic
1188632775 X:32388350-32388372 TTTTTTGGCAAAATTTAAGATGG + Intronic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1190580891 X:51892708-51892730 TCTGTTGCTCAAATGGAGGAGGG + Intronic
1192497616 X:71626683-71626705 TCTTTTTCCCAAACTGAAGAGGG + Intergenic
1192956449 X:76075833-76075855 TTTTTTCCCCAGACTGAGGGTGG - Intergenic
1193278882 X:79624942-79624964 TTTTTTTGCCACATTGATGACGG + Intergenic
1193439766 X:81525204-81525226 TTATTTGCCTATATTGAGAAAGG + Intergenic
1193614876 X:83674646-83674668 TTTTTTGCCTAAATTCATCAGGG - Intergenic
1194673853 X:96769751-96769773 TTCTTTGCCCTAATGGAGCATGG + Intronic
1195588673 X:106598599-106598621 GATTTTCCACAAATTGAGGAAGG - Intergenic
1196293924 X:113977736-113977758 TATTTTGCCAAGGTTGAGGATGG - Intergenic
1196333770 X:114505278-114505300 TTTTTTGCCCATTTTAATGAGGG - Intergenic
1197612922 X:128658675-128658697 TTTTTTGACCAAATTGAGTTAGG - Intergenic
1197850025 X:130848416-130848438 TTTTTTTACCAAATGGAGAATGG + Intronic
1198491739 X:137148049-137148071 TTTTTTGCTCAAGTAGATGATGG + Intergenic
1198747162 X:139902336-139902358 TATTTTGCCAAAGTTAAGGATGG - Intronic
1199021634 X:142885067-142885089 TTTATTGCCCATATTGCAGAGGG - Intergenic
1199478236 X:148269795-148269817 TTTATAGCCCTAATAGAGGAAGG - Intergenic
1200159217 X:153996479-153996501 TGTTTTGCCAAGGTTGAGGATGG - Intergenic
1200955133 Y:8937199-8937221 TTTCTTGCTCAAATTGGTGAGGG + Intergenic
1201332262 Y:12837291-12837313 TTTTTTTCACAGACTGAGGATGG + Intronic
1201908100 Y:19105680-19105702 TTTTGTCCCCTACTTGAGGAGGG - Intergenic
1202147188 Y:21810690-21810712 TTTTTTGCTGAAAATGATGAAGG + Intergenic