ID: 1183308352

View in Genome Browser
Species Human (GRCh38)
Location 22:37096011-37096033
Sequence GCTGATGCTGAGCCCCGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183308352_1183308363 26 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308363 22:37096060-37096082 GAACCAGAAGAAGCAGGTGAGGG 0: 1
1: 0
2: 1
3: 39
4: 828
1183308352_1183308356 -10 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308356 22:37096024-37096046 CAGCATCAGCCGGCGGTGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 108
1183308352_1183308361 20 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308361 22:37096054-37096076 GAGAATGAACCAGAAGAAGCAGG 0: 1
1: 0
2: 3
3: 45
4: 392
1183308352_1183308362 25 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308362 22:37096059-37096081 TGAACCAGAAGAAGCAGGTGAGG 0: 1
1: 0
2: 4
3: 30
4: 357
1183308352_1183308359 -2 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308359 22:37096032-37096054 GCCGGCGGTGCTCGGGGATTTGG 0: 1
1: 0
2: 0
3: 6
4: 143
1183308352_1183308364 27 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308364 22:37096061-37096083 AACCAGAAGAAGCAGGTGAGGGG 0: 1
1: 0
2: 4
3: 36
4: 407
1183308352_1183308358 -8 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308358 22:37096026-37096048 GCATCAGCCGGCGGTGCTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 47
1183308352_1183308357 -9 Left 1183308352 22:37096011-37096033 CCACCTCGGGGCTCAGCATCAGC 0: 2
1: 0
2: 0
3: 18
4: 182
Right 1183308357 22:37096025-37096047 AGCATCAGCCGGCGGTGCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183308352 Original CRISPR GCTGATGCTGAGCCCCGAGG TGG (reversed) Exonic
900287523 1:1908788-1908810 GCTGCCACTGCGCCCCGAGGTGG + Intergenic
900372260 1:2337246-2337268 CCTCATGCTGCGCTCCGAGGAGG - Intronic
900564423 1:3325333-3325355 GCTGATGCTCAGGCCTGAGCTGG - Intronic
900631716 1:3639862-3639884 GCTGAGGATGAGGCCCGGGGTGG + Intronic
901056409 1:6450497-6450519 GCTGAGGCTGAGGCGCGGGGTGG + Intronic
902404170 1:16174038-16174060 GCTGATGCTGAGCCCCAGACGGG - Intergenic
902477940 1:16697988-16698010 GCTGAGGCTGAGGCGCGGGGTGG - Intergenic
903265293 1:22154344-22154366 ACTGAGGCTGAGGCCCGAGTGGG + Intergenic
906877771 1:49557199-49557221 GCGGACGCTGAGGCCTGAGGAGG + Intronic
907517886 1:55004858-55004880 GCTGGTGCTGTGCCCCAAGTAGG + Intronic
910676461 1:89821239-89821261 GCTTATGCTGAGGCCGGAGGTGG - Exonic
913969710 1:143405464-143405486 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
914064083 1:144231057-144231079 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
914115067 1:144735297-144735319 GCTGAGGCTCAGCCATGAGGAGG + Intergenic
915251775 1:154595136-154595158 GCTGCTGCTGATCCCACAGGAGG - Intronic
915633931 1:157173477-157173499 GCTGTCACTGAGCCCCTAGGTGG - Intergenic
915637710 1:157198129-157198151 GCTGTCACTGAGCCCCTAGGTGG - Intergenic
915670728 1:157486600-157486622 GCTGTCACTGAGCCCCTAGGTGG + Intergenic
1063382904 10:5597354-5597376 GCTGATGCTGAGACCCTATGAGG + Intergenic
1067055325 10:43046510-43046532 GCTGCTGCTGGGCCCTCAGGTGG - Intergenic
1067267448 10:44757687-44757709 GCTGCAGCTGTGCCCTGAGGGGG - Intergenic
1070615886 10:77968840-77968862 CCTGAAGCTGAGCCCCAAGACGG - Intergenic
1072519611 10:96219415-96219437 GGAGAGGCTGAGCCCCCAGGAGG + Intronic
1073455811 10:103636084-103636106 ACTGATGCTGACACCAGAGGAGG + Intronic
1074882133 10:117667608-117667630 GCAGACGCTGAGGCCCAAGGAGG + Intergenic
1075545492 10:123351674-123351696 TCTGATGCTGAGAGCAGAGGAGG + Intergenic
1076787071 10:132755777-132755799 GCAGGTGCTGACCCCAGAGGAGG + Intronic
1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG + Intergenic
1078433138 11:11302937-11302959 GGAGAGGCTGAGCCCCGAGGGGG - Intronic
1081688579 11:45059625-45059647 GCTGGTGCAAAGCCCAGAGGTGG + Intergenic
1084274307 11:68043856-68043878 GCTGCTGCAGGGCCCCGAGGCGG - Exonic
1085252153 11:75150997-75151019 GCTGAGGCTGAGCCTCAGGGAGG + Exonic
1085530366 11:77189053-77189075 GCGGCTGCTGAGCCCAGAGCAGG + Intronic
1088004873 11:104927557-104927579 CCTGAGCCTGAGCCCCTAGGGGG + Intergenic
1089249006 11:117144299-117144321 GCTGGTGCTGGGGCCGGAGGAGG + Exonic
1089889803 11:121869694-121869716 GCAGGTGCTGAGCCACCAGGCGG - Intergenic
1091122712 11:133069894-133069916 GCTGATGCTGTGGCTCTAGGTGG + Intronic
1092200921 12:6582195-6582217 GCTGATGGTGTCCCCCGAGAAGG - Exonic
1097676143 12:62603775-62603797 GGTGATGCTCAGCGCCGCGGAGG + Intergenic
1097920524 12:65067775-65067797 GCTGAAGCTGAGTGCCCAGGCGG - Exonic
1100283518 12:93141069-93141091 CCTGAGGCTGTGCCCCAAGGGGG - Intergenic
1100754310 12:97733372-97733394 GCTGGTGCTGGGGCCCGAGGAGG - Intergenic
1101143597 12:101820698-101820720 GCTGAGGCTGAGGACAGAGGAGG - Intronic
1101411127 12:104469450-104469472 TCTGAAGCTGAACTCCGAGGAGG + Intronic
1103082060 12:118032363-118032385 GCAGATGCTGAGCCTCTGGGTGG - Intronic
1103702533 12:122855315-122855337 GGTGGTGGTGATCCCCGAGGAGG + Exonic
1103908864 12:124340881-124340903 GCTGGTGCTGGGAGCCGAGGAGG - Intronic
1103980629 12:124734763-124734785 GCAGATGCTAAACCCAGAGGGGG + Intergenic
1105894015 13:24703072-24703094 ACTGCTGCTGTGCCCAGAGGCGG - Intronic
1107092367 13:36495721-36495743 GATGAAGCTGAGCCTCCAGGTGG + Intergenic
1108267957 13:48731078-48731100 GCTGCTGCTGAGGCCCAGGGAGG + Intergenic
1108454132 13:50596408-50596430 GCTGGAGCTGAGCCCCTGGGAGG + Intronic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113588414 13:111481287-111481309 GCTGGTGCTGAAACCCCAGGAGG + Intergenic
1114438327 14:22726436-22726458 TCTGCTGCTGAGCCCAGAGAGGG + Intergenic
1114492739 14:23113569-23113591 GCTCATGCTGAGTCGGGAGGAGG + Intergenic
1116817909 14:49599921-49599943 GCTGAGGCTGAGCCCGGGGCCGG + Intronic
1122700005 14:103581967-103581989 GCTGATGCTCCGGCCCAAGGGGG - Intronic
1124848055 15:33310894-33310916 GCTGAGGCTGAGCCAGGAGCTGG + Intergenic
1125028231 15:35051880-35051902 GCTGAGGCTGAGGCAGGAGGTGG - Intergenic
1129904059 15:79173483-79173505 GTGGATGCTAAGCCCCAAGGTGG + Intergenic
1131820318 15:96266074-96266096 CCTGAGGCTGAACCCCGAAGAGG - Intergenic
1132804299 16:1768583-1768605 GCTGGTGCTGAGCGGCGGGGAGG + Exonic
1132936461 16:2483741-2483763 GCTGCTGCTCGGCCCAGAGGAGG + Intronic
1134814829 16:17197234-17197256 GCAGGGGCTGAGCCCAGAGGTGG - Intronic
1135408910 16:22218445-22218467 GGTGAGGGTGAGCCCCGAGGGGG + Intronic
1136682450 16:31976151-31976173 GCTGACCCTGAGGCCCGATGCGG + Intergenic
1136782709 16:32917319-32917341 GCTGACCCTGAGGCCCGATGCGG + Intergenic
1136887087 16:33936531-33936553 GCTGACCCTGAGGCCCGATGTGG - Intergenic
1138371555 16:56530958-56530980 GCTGATGCTGAGCTAGGATGTGG - Intergenic
1138568601 16:57852361-57852383 GCTGATGATGAGGCAGGAGGTGG - Intronic
1142188088 16:88704023-88704045 GCTCCTGCTGGGCCCCCAGGGGG + Intronic
1142363323 16:89637374-89637396 GCTGGTGGTGAGGGCCGAGGGGG + Exonic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1143268632 17:5659218-5659240 CTTGATGCTGAGCCCAGAAGGGG - Intergenic
1143625998 17:8110408-8110430 GCTGTGGCTCAGCCCCCAGGGGG - Exonic
1144695793 17:17303310-17303332 GCGGAGGCGGAGCCCCGGGGCGG - Intergenic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1147142972 17:38469489-38469511 GCTGACCCTGAGGCCCGATGTGG + Intronic
1148766965 17:50045189-50045211 GCTGAAGGTGAGCCCTGAGAAGG + Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1151702986 17:75753239-75753261 GCCCAAGCTGAGCCCCGTGGGGG - Intronic
1151759126 17:76090687-76090709 GCTGATGCTTGGCCCCAGGGGGG + Intronic
1152801475 17:82332803-82332825 GCTGCTGCTGAGCCCAGAGCGGG - Intronic
1154231218 18:12557635-12557657 GTGGATGCTGAGGCCTGAGGAGG + Intronic
1157716827 18:49893732-49893754 GATGGTGCTGAGGCCCGAGGTGG + Intronic
1160321439 18:77900014-77900036 TCTCCAGCTGAGCCCCGAGGAGG + Intergenic
1160859029 19:1229929-1229951 GCTGCTGCTGTGGTCCGAGGCGG + Exonic
1161073332 19:2273111-2273133 CCGGATGCCCAGCCCCGAGGCGG - Exonic
1161576653 19:5058251-5058273 GCTCATGCTGGGCCCTGAGCAGG - Intronic
1162752061 19:12834964-12834986 CCTGGGGCTGAGCCCCAAGGAGG - Intronic
1162758589 19:12874802-12874824 GCTGAAGCTGTGCCCCCAGCAGG + Exonic
1162920149 19:13896564-13896586 GCTGAGGCTGAATCCTGAGGTGG - Intronic
1163557234 19:17999699-17999721 GCAGATGCTGAGCCCTGGGTGGG + Exonic
1163688183 19:18724181-18724203 GCAGATGGTGAGGCCCCAGGAGG + Intronic
1163727197 19:18929438-18929460 GCTGAGGCTGCGCCCTGAGCCGG - Exonic
1164822366 19:31260091-31260113 GCTGAGGCTGAGCCTGCAGGAGG - Intergenic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1167134833 19:47609932-47609954 GCTGAGGCTCATCCCGGAGGGGG + Intronic
1168111075 19:54191511-54191533 GCTGCTGCTGATGCCCGAAGAGG + Exonic
1168240676 19:55087366-55087388 GCGGGCGGTGAGCCCCGAGGAGG + Exonic
1168335124 19:55593043-55593065 GCTGCTCCTGGGCCCCGCGGGGG - Exonic
1202711960 1_KI270714v1_random:23815-23837 GCTGAGGCTGAGGCGCGGGGTGG - Intergenic
926446261 2:12946461-12946483 GAAGAGGCTGAGTCCCGAGGTGG + Intergenic
926801234 2:16662816-16662838 GCTGATGTAGGGCCCAGAGGTGG - Intronic
927191462 2:20519846-20519868 GCTGCTGCTGATCCCTGGGGAGG - Intergenic
930026039 2:47029689-47029711 GCTGATGCAGAGCCCAGGGCAGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931832995 2:66071982-66072004 GCTGATGGTCAGCCCCTTGGAGG - Intergenic
934174404 2:89566375-89566397 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
934284720 2:91640725-91640747 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
934756515 2:96828211-96828233 GCTGATGCTGAGGGCCAGGGTGG + Intronic
934761194 2:96858010-96858032 GCTGAGCCTGAGACCCGGGGCGG - Exonic
935334555 2:102004334-102004356 GCTGATGCACAGCCCTGAGTTGG - Intronic
940410765 2:153360720-153360742 CCTGAACCTGAGCCCCTAGGGGG + Intergenic
941088512 2:161146966-161146988 CCTGGGGCTGAGCCCCTAGGGGG - Intronic
948028497 2:234797851-234797873 ACCGATGCTGAGCCCGGATGTGG + Intergenic
948931386 2:241134704-241134726 CACGATGCAGAGCCCCGAGGTGG + Intronic
1169204458 20:3732321-3732343 GCCGAGGCTGAGCCCCAAGGTGG + Intergenic
1173460252 20:43237536-43237558 GGTGGTGCAGAGCCCCGAGGTGG + Intergenic
1174407321 20:50310669-50310691 GCTGCCGCTGGGCCCCCAGGAGG - Intergenic
1176226746 20:64004613-64004635 GCTGATCTTGAGACCTGAGGAGG + Intronic
1178357986 21:31924063-31924085 GATGATGGTGAGTCCTGAGGGGG + Intronic
1180056775 21:45362963-45362985 GGTGACGCTGAGCCCCAAGGAGG - Intergenic
1180628333 22:17209509-17209531 GCTGGTGCTGAACACCAAGGAGG - Exonic
1181764604 22:25082209-25082231 GAAGATGCTGGGCCCAGAGGGGG - Intronic
1181824988 22:25507753-25507775 GCTGAAGGTGAGCCAGGAGGAGG + Intergenic
1182554579 22:31122409-31122431 GCTGGTGCTGAGGCCTGAGATGG + Intergenic
1183079400 22:35446949-35446971 GGTGATGCTGAGGCCCCCGGAGG - Intergenic
1183167701 22:36160215-36160237 GCTGCTGCTGAGGCCCGATGGGG - Intronic
1183180009 22:36253613-36253635 GCTGCTGCTGAGGCCCAATGGGG + Intronic
1183308352 22:37096011-37096033 GCTGATGCTGAGCCCCGAGGTGG - Exonic
1183394941 22:37566346-37566368 GCTGATGCCCGGCCCCCAGGGGG + Exonic
1183933511 22:41249167-41249189 GCAGATGCTGAGAGCCCAGGAGG + Intronic
1184116789 22:42426960-42426982 GAGGATGCTGAGCACCCAGGCGG + Intronic
1184854284 22:47137936-47137958 GGAGATGCTGAGCCCTGAAGAGG - Intronic
950264487 3:11564017-11564039 GATGGTGCCGTGCCCCGAGGGGG - Intronic
954664983 3:52246791-52246813 GCTGACCCTGTGCCCAGAGGAGG + Exonic
955961438 3:64345078-64345100 TGTCATGCTGAGCCCCCAGGTGG - Intronic
957519128 3:81296183-81296205 GCTGATGCTGTGCACCATGGAGG - Intergenic
960234276 3:115263458-115263480 GAGGATGCTAAGGCCCGAGGGGG + Intergenic
961046867 3:123714653-123714675 GCTGAGACTGAGCCCAGAGAGGG + Intronic
961514200 3:127422774-127422796 GCTGAAACTGAGACCCAAGGGGG + Intergenic
965757552 3:172040674-172040696 GCGGAATCTGCGCCCCGAGGCGG + Intronic
965781147 3:172287371-172287393 GCCGATGCTGAGGAGCGAGGAGG + Intronic
966301540 3:178484843-178484865 TCTGATGTTCAGCCCAGAGGAGG + Intronic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
969828257 4:9775318-9775340 GCTGAGGCTCAGCCATGAGGAGG - Intronic
974042745 4:56871572-56871594 GCTGATACTGAGGGCCTAGGCGG - Intergenic
974171420 4:58271102-58271124 GGTCATGCTGAGCCAAGAGGTGG - Intergenic
975173404 4:71259361-71259383 GCTGCTGCTGAGCTCAGAGGGGG - Intronic
976061738 4:81136689-81136711 GTAGATGGTGAGCTCCGAGGAGG - Intronic
983652688 4:170049161-170049183 GCTGATGCTGAGTTCCAAGGGGG + Intergenic
983972280 4:173889985-173890007 GCTGGGCCTGAGCCCCTAGGGGG - Intergenic
985565297 5:612382-612404 GCTGGTGCTGAGCGAGGAGGCGG + Exonic
987050415 5:14143586-14143608 GCGGACGCAGAGCCCCGGGGCGG - Intergenic
991474306 5:67003822-67003844 GGTAATGGTGAGCCCCGATGTGG - Intronic
995214753 5:109582547-109582569 GCTGATGCTGACACCCAAGTAGG + Intergenic
995263732 5:110135539-110135561 GCTGAAGCTGAGCCCACAGCTGG + Intergenic
995608164 5:113880428-113880450 GCTCATGCTGATGCCAGAGGTGG - Intergenic
997782400 5:136673373-136673395 CTTGATGCTGGGCCCCCAGGTGG + Intergenic
1002397996 5:178972736-178972758 CCTGAGGCTGAGCCACGTGGGGG + Intergenic
1002541252 5:179907800-179907822 GATGTGGCTGAGCCCGGAGGAGG - Exonic
1010408855 6:75537658-75537680 GCTGATGCTGAAATCAGAGGTGG - Intergenic
1010703288 6:79077711-79077733 GCAGGTGCTGATCCGCGAGGTGG - Exonic
1015881983 6:137879085-137879107 GCTGGTGCTGAGGCTGGAGGAGG - Exonic
1017049331 6:150375764-150375786 GCAGATGCTGAGCCCTGAAGTGG + Intronic
1017787470 6:157768370-157768392 GGTGCTGCTGAGCCCCAGGGTGG - Intronic
1017869539 6:158475192-158475214 GCTGAGGCTGAGCCCCGGAAAGG - Intronic
1019530166 7:1499274-1499296 GGAGAAGCTGAGCCCCGAGCAGG - Exonic
1019539944 7:1546960-1546982 GCGGATGCTGATCCCCTCGGAGG - Exonic
1019768977 7:2871422-2871444 GCTTATGCAGGGCCCCGAGGTGG + Intergenic
1020621820 7:10528099-10528121 CCTGGTCCTGAGCCCCTAGGGGG + Intergenic
1021705199 7:23360698-23360720 GCTGACTCTGAGCCCTGAAGGGG - Intronic
1023382587 7:39623578-39623600 GCTGCTGCAGAGCCGCCAGGAGG + Exonic
1023765742 7:43508920-43508942 GCTCATTCTGTGCCCGGAGGTGG - Intronic
1024099530 7:46015912-46015934 ACTGAGCCTGAGCCCCTAGGGGG + Intergenic
1024289856 7:47794788-47794810 GGTGATGCTGATGCCAGAGGTGG - Intronic
1032524545 7:132569811-132569833 GCAAATGCTGAGGCCAGAGGTGG + Intronic
1033656784 7:143380716-143380738 GCTGACTCTGTGCCCGGAGGGGG - Intergenic
1034909047 7:154977375-154977397 CCTGTTGCAGAGCCCCAAGGTGG + Intronic
1039685897 8:39801659-39801681 CCTGAGCCTGAGCCCCCAGGGGG - Intronic
1040645947 8:49396764-49396786 TCAGATCCTGAGCCCCGAGAAGG - Intergenic
1040861997 8:52008584-52008606 GATGTGGCTGAGCCCCGAGCGGG - Intergenic
1044778728 8:95721721-95721743 GGTAATGCAGAGGCCCGAGGGGG + Intergenic
1045156455 8:99479102-99479124 GCTGATGAAGAGTCCCTAGGTGG - Intronic
1049611854 8:143559567-143559589 GCTGAGGCAGAGCCCCAGGGAGG + Intronic
1049613857 8:143567923-143567945 GCTGATCCTGAGTGCGGAGGAGG + Intronic
1049831119 8:144701121-144701143 GCTGAGGATGAGGCCAGAGGTGG - Intergenic
1058650496 9:107171481-107171503 GCTGATGGTGAGCTTCTAGGGGG + Intergenic
1060794517 9:126504871-126504893 ACTGATGCTGAGCAGGGAGGGGG + Exonic
1061548820 9:131320504-131320526 TCTGATGCTGAGCCCTGGGCCGG + Intergenic
1061700118 9:132409636-132409658 GCTGATGCTGACCCACTGGGAGG - Intergenic
1062037842 9:134390595-134390617 GCTGAGGCTGAGCTCGGAAGAGG + Intronic
1188007877 X:25029419-25029441 GCTGGTACTGGGGCCCGAGGAGG + Intergenic
1188980256 X:36720868-36720890 CCTGATGCTGGGGCCTGAGGTGG + Intergenic
1189082713 X:37991605-37991627 CCTGATGCTGGGGCCTGAGGTGG + Intronic
1192196580 X:69032809-69032831 GCTGCTGCTGCTCCCAGAGGTGG + Intergenic
1194961843 X:100245043-100245065 CCTGATGCTGAGGCCAGTGGAGG + Intergenic
1198280144 X:135133641-135133663 CCTGATGCTGAGCCGCCTGGGGG + Intergenic
1198290814 X:135238873-135238895 CCTGATGCTGAGCCGCCTGGGGG - Intergenic
1200035993 X:153330829-153330851 ACTGAGTCTGAGGCCCGAGGTGG - Intergenic