ID: 1183310190

View in Genome Browser
Species Human (GRCh38)
Location 22:37105388-37105410
Sequence CTGTGAACATTTGAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183310190_1183310193 -3 Left 1183310190 22:37105388-37105410 CCCACTTCCTCAAATGTTCACAG No data
Right 1183310193 22:37105408-37105430 CAGCATCCCTAGTGAGAAACAGG 0: 1
1: 0
2: 0
3: 17
4: 184
1183310190_1183310196 19 Left 1183310190 22:37105388-37105410 CCCACTTCCTCAAATGTTCACAG No data
Right 1183310196 22:37105430-37105452 GCAAGAAACAGACCAGTAACAGG 0: 1
1: 0
2: 0
3: 13
4: 168
1183310190_1183310197 20 Left 1183310190 22:37105388-37105410 CCCACTTCCTCAAATGTTCACAG No data
Right 1183310197 22:37105431-37105453 CAAGAAACAGACCAGTAACAGGG 0: 1
1: 0
2: 1
3: 16
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183310190 Original CRISPR CTGTGAACATTTGAGGAAGT GGG (reversed) Intronic
No off target data available for this crispr