ID: 1183311679

View in Genome Browser
Species Human (GRCh38)
Location 22:37113209-37113231
Sequence CCCGGAGGCTTCTTTTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183311679_1183311695 16 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311695 22:37113248-37113270 TGAGGGGAGGCTTGAAGGCTGGG No data
1183311679_1183311696 21 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311696 22:37113253-37113275 GGAGGCTTGAAGGCTGGGCATGG No data
1183311679_1183311699 26 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311699 22:37113258-37113280 CTTGAAGGCTGGGCATGGTGGGG No data
1183311679_1183311692 3 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311692 22:37113235-37113257 CCTGGTGAGGGGATGAGGGGAGG No data
1183311679_1183311689 -1 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311689 22:37113231-37113253 GAGGCCTGGTGAGGGGATGAGGG No data
1183311679_1183311693 11 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311693 22:37113243-37113265 GGGGATGAGGGGAGGCTTGAAGG No data
1183311679_1183311686 -8 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311686 22:37113224-37113246 CCTCCGGGAGGCCTGGTGAGGGG No data
1183311679_1183311697 24 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311697 22:37113256-37113278 GGCTTGAAGGCTGGGCATGGTGG No data
1183311679_1183311700 27 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311700 22:37113259-37113281 TTGAAGGCTGGGCATGGTGGGGG No data
1183311679_1183311684 -9 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311684 22:37113223-37113245 GCCTCCGGGAGGCCTGGTGAGGG No data
1183311679_1183311688 -2 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311688 22:37113230-37113252 GGAGGCCTGGTGAGGGGATGAGG No data
1183311679_1183311698 25 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311698 22:37113257-37113279 GCTTGAAGGCTGGGCATGGTGGG No data
1183311679_1183311694 15 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311694 22:37113247-37113269 ATGAGGGGAGGCTTGAAGGCTGG No data
1183311679_1183311690 0 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311690 22:37113232-37113254 AGGCCTGGTGAGGGGATGAGGGG No data
1183311679_1183311683 -10 Left 1183311679 22:37113209-37113231 CCAAGGAAAAAGAAGCCTCCGGG No data
Right 1183311683 22:37113222-37113244 AGCCTCCGGGAGGCCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183311679 Original CRISPR CCCGGAGGCTTCTTTTTCCT TGG (reversed) Intergenic