ID: 1183312203

View in Genome Browser
Species Human (GRCh38)
Location 22:37116442-37116464
Sequence CATAAAAAGGATAAGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183312199_1183312203 13 Left 1183312199 22:37116406-37116428 CCTCAACACAGCCACAAAAGAGA No data
Right 1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG No data
1183312200_1183312203 2 Left 1183312200 22:37116417-37116439 CCACAAAAGAGAACAAGAAAAAT No data
Right 1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183312203 Original CRISPR CATAAAAAGGATAAGGAGTC TGG Intergenic
No off target data available for this crispr