ID: 1183312332

View in Genome Browser
Species Human (GRCh38)
Location 22:37117302-37117324
Sequence GCATCTCCATGTACTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183312332_1183312335 -5 Left 1183312332 22:37117302-37117324 CCCTCAGCAGTACATGGAGATGC No data
Right 1183312335 22:37117320-37117342 GATGCTTCTTATGTGCTTGGAGG No data
1183312332_1183312334 -8 Left 1183312332 22:37117302-37117324 CCCTCAGCAGTACATGGAGATGC No data
Right 1183312334 22:37117317-37117339 GGAGATGCTTCTTATGTGCTTGG No data
1183312332_1183312336 16 Left 1183312332 22:37117302-37117324 CCCTCAGCAGTACATGGAGATGC No data
Right 1183312336 22:37117341-37117363 GGAATAAGAATCCACCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183312332 Original CRISPR GCATCTCCATGTACTGCTGA GGG (reversed) Intergenic