ID: 1183312332 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:37117302-37117324 |
Sequence | GCATCTCCATGTACTGCTGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183312332_1183312335 | -5 | Left | 1183312332 | 22:37117302-37117324 | CCCTCAGCAGTACATGGAGATGC | No data | ||
Right | 1183312335 | 22:37117320-37117342 | GATGCTTCTTATGTGCTTGGAGG | No data | ||||
1183312332_1183312334 | -8 | Left | 1183312332 | 22:37117302-37117324 | CCCTCAGCAGTACATGGAGATGC | No data | ||
Right | 1183312334 | 22:37117317-37117339 | GGAGATGCTTCTTATGTGCTTGG | No data | ||||
1183312332_1183312336 | 16 | Left | 1183312332 | 22:37117302-37117324 | CCCTCAGCAGTACATGGAGATGC | No data | ||
Right | 1183312336 | 22:37117341-37117363 | GGAATAAGAATCCACCAGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183312332 | Original CRISPR | GCATCTCCATGTACTGCTGA GGG (reversed) | Intergenic | ||