ID: 1183312549

View in Genome Browser
Species Human (GRCh38)
Location 22:37118658-37118680
Sequence CAAGAGCTAGTCCCACAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183312549_1183312560 28 Left 1183312549 22:37118658-37118680 CCGGTTTGTGGGACTAGCTCTTG No data
Right 1183312560 22:37118709-37118731 CAGACACCTAAATTTCCCCAAGG No data
1183312549_1183312553 -10 Left 1183312549 22:37118658-37118680 CCGGTTTGTGGGACTAGCTCTTG No data
Right 1183312553 22:37118671-37118693 CTAGCTCTTGCCCTTGAAGGGGG No data
1183312549_1183312556 2 Left 1183312549 22:37118658-37118680 CCGGTTTGTGGGACTAGCTCTTG No data
Right 1183312556 22:37118683-37118705 CTTGAAGGGGGCCCTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183312549 Original CRISPR CAAGAGCTAGTCCCACAAAC CGG (reversed) Intergenic
No off target data available for this crispr