ID: 1183313124

View in Genome Browser
Species Human (GRCh38)
Location 22:37122300-37122322
Sequence GACGCAGGTCGGGTAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183313124_1183313134 27 Left 1183313124 22:37122300-37122322 CCCTCCACTACCCGACCTGCGTC No data
Right 1183313134 22:37122350-37122372 CTTTCTGCCAGGCTCTGTGATGG No data
1183313124_1183313135 28 Left 1183313124 22:37122300-37122322 CCCTCCACTACCCGACCTGCGTC No data
Right 1183313135 22:37122351-37122373 TTTCTGCCAGGCTCTGTGATGGG No data
1183313124_1183313131 16 Left 1183313124 22:37122300-37122322 CCCTCCACTACCCGACCTGCGTC No data
Right 1183313131 22:37122339-37122361 TTCCTGCCTCACTTTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183313124 Original CRISPR GACGCAGGTCGGGTAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr