ID: 1183314680

View in Genome Browser
Species Human (GRCh38)
Location 22:37130326-37130348
Sequence GCCTGTGGCCAGCTACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183314677_1183314680 -10 Left 1183314677 22:37130313-37130335 CCAGGGACCCACTGCCTGTGGCC No data
Right 1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 200
1183314671_1183314680 11 Left 1183314671 22:37130292-37130314 CCTGTGGCCAGTGCCGGTGAGCC 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 200
1183314670_1183314680 16 Left 1183314670 22:37130287-37130309 CCAGGCCTGTGGCCAGTGCCGGT 0: 1
1: 0
2: 0
3: 23
4: 278
Right 1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 200
1183314674_1183314680 4 Left 1183314674 22:37130299-37130321 CCAGTGCCGGTGAGCCAGGGACC No data
Right 1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 200
1183314675_1183314680 -2 Left 1183314675 22:37130305-37130327 CCGGTGAGCCAGGGACCCACTGC 0: 1
1: 0
2: 2
3: 23
4: 280
Right 1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183314680 Original CRISPR GCCTGTGGCCAGCTACTTCC TGG Intronic
900345547 1:2208696-2208718 GCCTGTGGGCAGCAGCTCCCTGG + Intronic
901633397 1:10658727-10658749 ACCTCTGGCCAGCTTCTGCCAGG - Intronic
902333481 1:15742339-15742361 GCCTGGAGCCAGCTGCTGCCCGG - Intergenic
902756940 1:18555284-18555306 GTCTGTGACCTGCTGCTTCCTGG - Intergenic
903759386 1:25687211-25687233 GCATGGGGCCTGCTACTGCCTGG + Intronic
904201073 1:28819401-28819423 GCCTGGAGCCTGCTTCTTCCTGG + Intronic
904489643 1:30850431-30850453 GCCTCAGCCCAGCTACATCCGGG - Intergenic
905800442 1:40839112-40839134 GCCTGAGACCAGCTACTGCTGGG - Exonic
906309473 1:44743028-44743050 GCTCGTGGCCAGCTTCTTCATGG - Intronic
907523665 1:55040877-55040899 GGCTGTGGGAAGCTTCTTCCCGG + Intronic
912334048 1:108846227-108846249 GCCTGTGGTCTGGGACTTCCAGG - Intronic
913174174 1:116258839-116258861 GGCATTAGCCAGCTACTTCCTGG + Intergenic
913218856 1:116643550-116643572 GCCTGTGGCCAGCCTGTCCCAGG + Intronic
914377104 1:147080948-147080970 GCCTTCGGCCACCTTCTTCCAGG - Intergenic
914490115 1:148146484-148146506 GCCGGAGGCCACCTACTCCCTGG + Intronic
914998307 1:152564048-152564070 GCCTGTGTCATGCTGCTTCCAGG + Intronic
917193604 1:172444064-172444086 GACTGTGGCCAAGCACTTCCGGG + Exonic
920690389 1:208142135-208142157 GCCGGGGGCCAGCCACTTCCCGG - Intronic
921187959 1:212685875-212685897 TGCTGGGGCCAGCTTCTTCCTGG + Intergenic
922421737 1:225465121-225465143 GCCTCTGGCCAGCTCTGTCCGGG - Intergenic
1063125586 10:3133971-3133993 GCCTGTGTGCAGCTCATTCCAGG - Intronic
1063927714 10:10996838-10996860 GCCTGTGGGCAGCACCTCCCAGG - Intergenic
1069601078 10:69708534-69708556 TCCTGTGGCCTGATTCTTCCTGG + Intergenic
1070432458 10:76354550-76354572 GACAGTAGCCAGCTGCTTCCTGG + Intronic
1072530606 10:96315072-96315094 GCATGTGGCCAGCTAGATCTGGG - Intronic
1073318739 10:102600891-102600913 GCCTCCAGCCAGCTACTTCAGGG - Intronic
1075951271 10:126479577-126479599 GCCTGTTGTCAGCTGCGTCCTGG - Intronic
1076161555 10:128247738-128247760 GGCTGAGGCCAGCTGATTCCAGG - Intergenic
1076478736 10:130770038-130770060 GCCTGTGGGCGGCTCCTTACAGG - Intergenic
1076841753 10:133049330-133049352 GCCAGTGTCCAGCCTCTTCCCGG + Intergenic
1077943614 11:6870914-6870936 TTCTGTGGCCAACTATTTCCAGG + Intergenic
1078246154 11:9574314-9574336 GCCGGCGGCCCCCTACTTCCTGG + Exonic
1078694788 11:13620395-13620417 GGCTGTGGCCAGGTACGTGCAGG + Intergenic
1081576689 11:44323083-44323105 GCCTAACCCCAGCTACTTCCTGG - Intergenic
1082933076 11:58629531-58629553 GGCTGTGGCCAGATCATTCCTGG - Intergenic
1083618710 11:64038573-64038595 GGCTGTGCCCAGCTAGATCCTGG - Intronic
1083813934 11:65121506-65121528 GCATGCGGCCTGCTACTTCCAGG + Exonic
1083866343 11:65455553-65455575 GCCTGCGGCCAACCACTTCCAGG - Intergenic
1084157391 11:67321555-67321577 GCCTCTGTCCACCTACTTCAAGG + Intronic
1084906042 11:72348418-72348440 GCAGGTGGCCAGCTTCTACCAGG + Intronic
1085715547 11:78869985-78870007 GCCTGTGGCAAGTTGCTTACTGG - Intronic
1089659271 11:119975511-119975533 GCCTGGGGCCAGTTCCTCCCTGG + Intergenic
1091146190 11:133282498-133282520 CCCTGTGGCAAGCTTCTGCCTGG - Intronic
1091264807 11:134262251-134262273 GGCTGTGGGCAGCTTCTGCCTGG + Intronic
1093930482 12:24950599-24950621 GGCTGTGGTCAGTTACTTTCAGG - Intergenic
1099354954 12:81622403-81622425 GCCTGTGCCCAGTAACTTTCAGG + Intronic
1099687402 12:85907882-85907904 GCCTCTGGCCACCTCCTGCCAGG + Intergenic
1102003883 12:109576230-109576252 GCCAGGGGCCAGCTATTTCCCGG + Intronic
1104690234 12:130819846-130819868 GCCTGCGGCCAGATCTTTCCGGG - Intronic
1104921579 12:132293339-132293361 GCCTGTGGCCAGAGGCTCCCCGG - Intronic
1106456758 13:29934615-29934637 GTCTGTGTCCAGCCACTTCTGGG + Intergenic
1107617989 13:42192257-42192279 GCTTGTGGCCATCTGCTTCAAGG - Intronic
1110614527 13:77526484-77526506 ACCTGTGCCCAGCTACATCTGGG - Intergenic
1112086072 13:96033816-96033838 GCCTGTGCCAAGCTGCTCCCAGG - Intronic
1113453506 13:110430605-110430627 ACCTGTGTCCAGGTACTTACTGG - Exonic
1113765397 13:112877798-112877820 GCCTGTGGTCAGACACATCCGGG - Intronic
1113967473 13:114162203-114162225 GCCTGCGTCCAGCTACCTCCAGG + Intergenic
1114140244 14:19901432-19901454 CCCTGTGGCAAGCTTCTGCCTGG - Intergenic
1118316725 14:64730285-64730307 GGCTGTGGCCAGCTGCTTTGTGG + Intronic
1121367926 14:93332322-93332344 GCCTGAGGACTGCTACTCCCAGG - Intronic
1121958907 14:98240596-98240618 GGCTGGGGCCAGACACTTCCTGG + Intergenic
1122291405 14:100682177-100682199 GACTCTGGCCACCTACTTCGGGG - Intergenic
1122383169 14:101324706-101324728 GCCTGTTACCATCCACTTCCAGG + Intergenic
1124053932 15:26224472-26224494 GCCTGTGACCAGGAACTGCCAGG + Intergenic
1125120873 15:36157284-36157306 GCCTCTTCCCAGCTGCTTCCTGG - Intergenic
1128787699 15:70410455-70410477 ACCTGGGGCCAGCTGCTGCCAGG + Intergenic
1129076216 15:72998469-72998491 TCCTCTGGCCAGCCTCTTCCGGG - Intergenic
1129153823 15:73705145-73705167 GCCTCTGGTCAGTCACTTCCTGG + Intronic
1129743875 15:78004436-78004458 GTCTGTGGCCAGCTTCTGCCTGG - Intronic
1129803978 15:78438631-78438653 GCCTGCTGCCAGCGGCTTCCTGG + Intronic
1130015066 15:80180048-80180070 GGCTGTGCCCAGCTGCCTCCGGG + Intronic
1130693924 15:86111098-86111120 GCCTGAGCCCAGCTGCCTCCAGG - Intergenic
1132733592 16:1375022-1375044 GACTGGTGCCAGCTGCTTCCAGG - Intronic
1133222406 16:4324342-4324364 GTCTGCGGCCAGCTCCTTCCAGG + Intronic
1134090550 16:11389328-11389350 GCCTGTGGCCAGCTTCTGCACGG + Intronic
1136078621 16:27837000-27837022 GGCTCTGCCCAGTTACTTCCAGG + Intronic
1136083431 16:27867815-27867837 CCCTGAGGCCAGCCACTTCCTGG + Intronic
1136630032 16:31484696-31484718 CACTGTGGGCGGCTACTTCCTGG + Exonic
1139704919 16:68734689-68734711 CCCTGTGGCCAGCCACGTCTGGG - Intergenic
1140389298 16:74571527-74571549 GCCAGGTGCCAGCTACTTTCAGG + Intronic
1141158420 16:81612736-81612758 GCCTGCGGGCAGCTGGTTCCAGG - Intronic
1141218017 16:82043260-82043282 GCATGTGGCCAGATCCTGCCTGG - Intronic
1141569354 16:84924970-84924992 GCCCGTGGCCAGGTCCTCCCAGG + Intergenic
1142247688 16:88977321-88977343 GCCTGAGGGCAGCTCCATCCTGG + Intergenic
1142712763 17:1732436-1732458 GCCCGTGGCCACCTTTTTCCAGG + Exonic
1144392990 17:14813346-14813368 GGATGCGGCCAGCTGCTTCCGGG - Intergenic
1144721109 17:17470492-17470514 CCCTGTGGCCACCTAATACCTGG - Intergenic
1147563745 17:41524232-41524254 CCGTGTGGCCAGCGACCTCCCGG + Exonic
1147949181 17:44097503-44097525 GGCTGTGGCTAGTTACCTCCAGG - Intronic
1148807445 17:50271111-50271133 GCCTGGGACCACCCACTTCCAGG + Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151967598 17:77439537-77439559 CCCTGTGGCCAGCAGCTTGCAGG + Intronic
1151975280 17:77480798-77480820 GCCTGAGGCCAGATCCTCCCTGG + Intronic
1152308784 17:79536619-79536641 CCCTGTGGCCGGCTCCTTCAGGG - Intergenic
1152331853 17:79678019-79678041 GGCTGTTGCCAGCACCTTCCAGG + Intergenic
1154329567 18:13418400-13418422 GCCTGAGGCAAGCCTCTTCCGGG + Intronic
1155260620 18:24038789-24038811 GCTTGTGGACAGCTACTTTCTGG + Intronic
1156556211 18:38071078-38071100 GCCTGTGACCTTCTACCTCCAGG - Intergenic
1159455688 18:68658000-68658022 GCCTGTTGGCAACTACCTCCAGG - Intergenic
1159938842 18:74390084-74390106 GCATGCGGCCTGCTACTTCCAGG + Intergenic
1160028528 18:75238945-75238967 GCGTGAGGCCAGGTATTTCCTGG - Intronic
1160227295 18:77020826-77020848 GCCTGTGGTGAGCTAGGTCCCGG - Intronic
1160995790 19:1881455-1881477 GCCGGAGGCCACCTACTCCCTGG - Exonic
1161466250 19:4432241-4432263 TCCTGGGCCCAGCTAATTCCAGG + Intronic
1167854321 19:52225868-52225890 GCCTGTGGGCAGCAGCTTCTGGG + Intronic
1167904078 19:52643958-52643980 GCCAGTGTCCAGCTTCCTCCTGG - Intronic
925057292 2:865000-865022 GTCCGTGGCCAGCTACCTGCTGG - Intergenic
925166923 2:1721480-1721502 GCCTGGAGTCAGTTACTTCCTGG - Intronic
925638438 2:5964974-5964996 CCCTGTAGCAAGCTTCTTCCTGG + Intergenic
929768256 2:44868966-44868988 GCCTGTGGCCATCTATATCCCGG + Intergenic
931022286 2:58061363-58061385 GTCTTTGGCCAGTTACTTACTGG - Intronic
932750140 2:74366286-74366308 GGCTGTGGCCAGCTTGTTCATGG + Exonic
937924321 2:127156144-127156166 GGCTGTGGCCAGTTACACCCAGG + Intergenic
938383702 2:130850397-130850419 GCCTGTGGCCAGAGGCTTTCTGG + Intronic
938405587 2:131031512-131031534 GCCTGTGGGCAGCTCCCTGCAGG - Intronic
940780773 2:157931540-157931562 GCCTCTGGCCTGGTACTACCTGG - Intronic
940887295 2:159000800-159000822 GACTCTGGCCAGCCATTTCCAGG - Intronic
941449327 2:165640669-165640691 GCCTGTGAACAGCTGCTCCCAGG - Intronic
944015070 2:195026309-195026331 GGCTGTGGCCAGCTGCTTTAGGG - Intergenic
948389484 2:237601772-237601794 GGCTTTGGCCAGCTACCCCCAGG + Intergenic
948776237 2:240290349-240290371 GCCTGTGGGCAGCCACTCCATGG - Intergenic
1168900942 20:1364316-1364338 TTCTGTGGCCAGCCATTTCCTGG + Intronic
1171296024 20:24018018-24018040 GTCTGTGGCCAGTGACTTCTTGG + Intergenic
1171881383 20:30620166-30620188 GCCTGGGTCCAGGTCCTTCCTGG + Intergenic
1173098122 20:40057532-40057554 GCTTGTAGACAGCTACTTTCTGG - Intergenic
1173601441 20:44298349-44298371 GCCTGTGGCTTTCTACCTCCAGG + Intergenic
1175495387 20:59410837-59410859 GCCCGAGGCCAGCTACAGCCTGG - Intergenic
1175599736 20:60263530-60263552 ACCAGTGGCCAGGTAATTCCTGG - Intergenic
1175654143 20:60753955-60753977 GCCTTTGGACAGCACCTTCCTGG + Intergenic
1175795874 20:61770317-61770339 GCCTGTGGTCAGATGCCTCCCGG + Intronic
1175969325 20:62675853-62675875 CCCTGTGGCCGGCACCTTCCTGG - Intronic
1178279332 21:31267257-31267279 GCCTGTGGCCATCTTCTCTCTGG - Intronic
1178427894 21:32493473-32493495 GCCTGTGGCCAGCCCCTGCAGGG + Intronic
1178894477 21:36547739-36547761 TCCTGTGGCCAGCTCCGGCCAGG - Intronic
1179804092 21:43826203-43826225 GCCTGGGGACAGCTGCTCCCAGG - Intergenic
1179997645 21:44981341-44981363 GCCTTTGTCCAGCACCTTCCTGG + Intergenic
1180787363 22:18554423-18554445 GCCTGCAGTCAGCTGCTTCCAGG - Intergenic
1181121570 22:20670873-20670895 GCCGGAGGCCACCTACTCCCTGG - Intergenic
1181234376 22:21440882-21440904 GCCTGCAGTCAGCTGCTTCCAGG + Intronic
1181244272 22:21493949-21493971 GCCTGCAGTCAGCTGCTTCCAGG - Intergenic
1181334531 22:22117897-22117919 GCCGGAGGCCACCTACTCCCTGG - Intergenic
1182149916 22:28020678-28020700 GCCTGTGTGCAGCTGCTCCCTGG + Intronic
1182415321 22:30217707-30217729 GCCTGTGGCCACTTTCCTCCTGG + Intergenic
1183055118 22:35300348-35300370 GGCTCTGGCCAGCTCCTTCCTGG + Intronic
1183283133 22:36943675-36943697 CCCTGAGCCCAGCTACTGCCAGG + Intergenic
1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG + Intronic
1183937931 22:41274508-41274530 GCCTGTGTCCAGTCTCTTCCAGG - Intronic
1185292138 22:50032473-50032495 GCCCCTGGCCAGCTCCTCCCAGG + Intronic
950736605 3:15014011-15014033 TCCTGTGGCCACTGACTTCCAGG - Intronic
951133371 3:19075045-19075067 CCCTGTGGCAGGCTTCTTCCTGG - Intergenic
952867501 3:37863594-37863616 GGCTGTGGCCAGCTCCGGCCTGG - Intronic
954381632 3:50221929-50221951 GCCAGTGACCAGCTCTTTCCTGG - Intergenic
955334760 3:58075973-58075995 GCCCCTGGCCAGCACCTTCCAGG - Intronic
956293859 3:67691111-67691133 GCCTGTTCCCAGCTACTTGGGGG - Intergenic
956890912 3:73613351-73613373 TCCTGTGGCCATCCCCTTCCAGG - Intronic
957952303 3:87141997-87142019 GGGTGTGGCCAGTTACTGCCTGG + Intergenic
962932976 3:140054515-140054537 GCCTGTGGCCAGATAGATCTAGG - Intronic
962973359 3:140425209-140425231 TACTGTGGCCAGCTTCTTCCAGG + Intronic
963720815 3:148859966-148859988 GTATGTTGCCAGCTACGTCCTGG + Exonic
964645650 3:158956307-158956329 GCCTGTGTCCATCTCCTTCAAGG - Intergenic
965376487 3:167930761-167930783 GCATGTGACCAGCTACCTACTGG - Intergenic
966554373 3:181242688-181242710 GCATGTGGATGGCTACTTCCAGG + Intergenic
967975688 3:195033582-195033604 GCCTGTGGCCTGCGACCTCCTGG - Intergenic
968488652 4:877631-877653 GCGTGTGGCCAGCACCTCCCAGG - Exonic
968599436 4:1502071-1502093 GCCTGTGGCCAACTTCTTATTGG - Intergenic
968905780 4:3449928-3449950 GCCTGTGGCCTCCTCCCTCCCGG - Intergenic
969832341 4:9807926-9807948 GCCTGGGGCCAACTATTTCAGGG - Intronic
975128261 4:70806366-70806388 GCCTGTGTTCAGATACTACCTGG + Intronic
975800810 4:78057674-78057696 GCCAGTGACCAGCAACTTTCCGG + Exonic
982014993 4:151144779-151144801 GCCTGATCCCAGCCACTTCCTGG + Intronic
985258505 4:188092688-188092710 GCCTGTTGTCAGCAATTTCCAGG - Intronic
990344315 5:54856264-54856286 GCATGTGGGCAGCTCCTGCCAGG - Intergenic
997768223 5:136526441-136526463 GGCAGTGCCCACCTACTTCCAGG - Intergenic
997953094 5:138257676-138257698 GCCTGTGGCCCCCAACTGCCTGG - Exonic
999319942 5:150608159-150608181 GCCTCAGTCCAGCTTCTTCCTGG - Intronic
999953538 5:156675979-156676001 TCCTGTTGCCAGCTGCTGCCAGG + Intronic
1001568541 5:172715612-172715634 GCCTGAGCCCAGGCACTTCCTGG + Intergenic
1001765479 5:174242533-174242555 GCCTGTGGCATGCTCCCTCCTGG + Intronic
1007409229 6:41652213-41652235 GCCTGTGGCAAGATTGTTCCAGG + Intronic
1011765029 6:90611101-90611123 GCCTGGCGCCGGCTCCTTCCCGG - Intergenic
1013194349 6:107832380-107832402 TTCTGTTGCCAGCTGCTTCCAGG + Intergenic
1013592281 6:111629291-111629313 CCCAGTGGCCAGCAGCTTCCTGG - Intergenic
1013850244 6:114505028-114505050 CCCTGTGGCGAGTTACTGCCGGG + Intergenic
1014268762 6:119312685-119312707 GCCTGAGGCCAGCTGCCTCAGGG + Intronic
1019433535 7:1010578-1010600 GCCTGGGGCCTGCTGCTTTCTGG + Intronic
1019622809 7:2000881-2000903 GCCGCTGGGCAGCTTCTTCCAGG + Intronic
1019634864 7:2070129-2070151 CCCTGAGGCCCGCTACTGCCAGG - Intronic
1022467683 7:30662463-30662485 GCCTTTGGACAGGTCCTTCCTGG + Intronic
1024403376 7:48950087-48950109 CCCTGTGGCAAGCTTCTGCCTGG + Intergenic
1026923541 7:74173846-74173868 TCGTGTGGCCAGCTCCTGCCTGG + Intergenic
1029688542 7:102165287-102165309 GGATGTAGACAGCTACTTCCAGG - Intronic
1032076778 7:128839843-128839865 GCCTGTAGCCAGCTCCAGCCCGG + Intronic
1032955069 7:136961001-136961023 GCCTGTAACCAGCTACTTGGAGG + Intronic
1034181076 7:149138453-149138475 GCCTGTATCCAGCTACTCTCAGG + Intronic
1034213560 7:149385734-149385756 GCCTGCTGCCAGCTACTACTTGG + Intergenic
1035610893 8:963163-963185 ACCAGTGGCCATCTCCTTCCTGG - Intergenic
1038313982 8:26467242-26467264 TCCCGGGGCCAGCTAATTCCTGG + Intronic
1039910755 8:41825094-41825116 GGCTGAGCCCGGCTACTTCCAGG + Intronic
1042659619 8:71140234-71140256 TCCTGTTGCCAGCTAATCCCTGG + Intergenic
1042865033 8:73349473-73349495 GCCTGTTGCCAGATCCTGCCAGG + Intergenic
1044744265 8:95356977-95356999 GCCTGTGGCCAGCATGGTCCAGG + Intergenic
1047365888 8:124211171-124211193 AGCTGTGGCCAGCTCCTCCCTGG + Intergenic
1048469660 8:134695588-134695610 GCCTGAGGGCAGCGCCTTCCTGG - Intronic
1048898343 8:139015104-139015126 GGCTGTGGGCAGCTCCTCCCTGG + Intergenic
1049433665 8:142576586-142576608 GTCTGAGGCCTGCTCCTTCCCGG + Intergenic
1049452572 8:142670005-142670027 GCCTTCCCCCAGCTACTTCCGGG + Intronic
1053382203 9:37658252-37658274 GCCTGAGGCCAGTTAGGTCCCGG + Intronic
1056073721 9:83016366-83016388 CCCTGTGGCCTGGTACTTCTCGG + Intronic
1060325589 9:122611295-122611317 GCCTGTGCCCAGATGCTACCTGG - Intergenic
1060474151 9:123974496-123974518 GCCCGGGGCCAGCTAATTACTGG + Intergenic
1061000235 9:127898823-127898845 GCCTGTGCCGAGCCACGTCCTGG - Intronic
1061202422 9:129145622-129145644 TCCTGAGGCCACCTACTGCCAGG - Intronic
1062592292 9:137279796-137279818 GGATGTGGTCAGCTGCTTCCGGG + Exonic
1185870900 X:3664023-3664045 GCCTGTGGGCATGTACTTCCTGG - Intronic
1187137189 X:16559356-16559378 GCCTGTGGCCAGCTGTGTCCTGG - Intergenic
1191864028 X:65689549-65689571 GTCTGTGGCCAGGTAGTTCCTGG + Intronic
1192245109 X:69365541-69365563 GACTGTGGCCAGGCACTTCCTGG + Intergenic
1192917895 X:75673548-75673570 GCCTGCTGCCAGCCACTCCCAGG + Intergenic
1199881689 X:151978612-151978634 CTCTTTGGCCAGATACTTCCTGG - Intergenic
1200793183 Y:7317486-7317508 GCCTGTGGGCATGCACTTCCTGG + Intergenic