ID: 1183315742

View in Genome Browser
Species Human (GRCh38)
Location 22:37136020-37136042
Sequence GCCATGGGCCTTGTGAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183315742 Original CRISPR GCCATGGGCCTTGTGAGTTG GGG (reversed) Intronic
900960371 1:5915211-5915233 GCCTTGGGCCTTGGGCCTTGGGG + Intronic
901144633 1:7056740-7056762 GCCAGGAGCCTTGGGAGATGGGG + Intronic
901500819 1:9651852-9651874 GCCAGGGGCTTTGGGAGCTGCGG + Intronic
903445256 1:23418800-23418822 GCCCAGGGCCTTGGGAATTGGGG + Intronic
903615809 1:24655377-24655399 GCCGTGGGCTGTTTGAGTTGGGG + Intronic
904154063 1:28467502-28467524 GCCTTGCCCCTTGTGAGCTGAGG - Intronic
907409763 1:54275601-54275623 GCCTTGGGCACTGTGAGCTGTGG - Intronic
907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG + Intronic
908520474 1:64936306-64936328 TCCATGGGCCTGTGGAGTTGAGG - Intronic
908664785 1:66477776-66477798 GCCATGCCCCTTCTGAGTTCTGG - Intergenic
909227522 1:73044587-73044609 GCCATGGACCTTGTGGGGTTGGG - Intergenic
912651462 1:111443233-111443255 AACAAGGGCCTTGTGTGTTGTGG + Intronic
913122025 1:115751331-115751353 TCCAAGGGCCTTGTGATTTAAGG + Intronic
913219560 1:116648527-116648549 GCAAAGGGCCTTGTGAGTGCTGG - Intronic
915797553 1:158752524-158752546 GCCCTGCGCCTTCCGAGTTGGGG - Intergenic
916548427 1:165828000-165828022 GCCGCGGGCCGTGTCAGTTGCGG + Intronic
917181299 1:172301036-172301058 CACATGGGCCTTCTGAGTTTAGG + Intronic
917499698 1:175575096-175575118 GCCATGTGGCTTGTGAGTGGAGG + Intronic
922332795 1:224592435-224592457 GACATCAGTCTTGTGAGTTGTGG + Intronic
924596416 1:245448605-245448627 AACATGGACCTTGTGAGTTATGG + Intronic
1067179352 10:43973189-43973211 TCCATGGGTCTGGTGAGCTGGGG - Intergenic
1069576071 10:69529244-69529266 GCCCTGCTCCTTCTGAGTTGCGG - Intergenic
1070704916 10:78630652-78630674 CACATGGGCCTTGTGAGAGGGGG + Intergenic
1070789697 10:79181775-79181797 GCCATGGGGACTGTGGGTTGTGG - Intronic
1070813222 10:79308700-79308722 CCCATGGGGCTTGTGATTTCTGG + Intronic
1072760207 10:98050484-98050506 GCCATGGGCCTTGGCAGGAGAGG + Intergenic
1074415472 10:113263502-113263524 TGCATGGCCCTGGTGAGTTGTGG + Intergenic
1074897824 10:117792392-117792414 GCCGTGGGCCCTTTGAGGTGGGG + Intergenic
1075188349 10:120283492-120283514 GCCATGGGCTTGGTGAGACGTGG + Intergenic
1075299824 10:121312172-121312194 ACAAAGGGCCTTGTCAGTTGAGG - Intergenic
1076114823 10:127888058-127888080 GCCATCTGCCTTTTGAGTTCTGG + Intronic
1076451153 10:130557848-130557870 TCCCTGCGCCATGTGAGTTGGGG + Intergenic
1076753299 10:132554544-132554566 GGCATGGGTGTTGTGGGTTGTGG + Intronic
1076889941 10:133278492-133278514 GCCCTGGGCCTTGAGAAGTGGGG - Intergenic
1081665608 11:44915417-44915439 ACCATGGGCATTGTGACCTGGGG + Intronic
1083133372 11:60647612-60647634 GCTGTTGGCCTTGTGAGTTGTGG + Intergenic
1083625474 11:64069905-64069927 GACATGTGCCTTCTCAGTTGAGG - Intronic
1085660854 11:78365453-78365475 GCCAGTGGCTTTGTTAGTTGAGG - Intronic
1087476533 11:98642642-98642664 GCCTTTGGCCTTTTGAGTTTAGG + Intergenic
1088513090 11:110598775-110598797 GCCCTGCCCCTTCTGAGTTGGGG + Intronic
1091121239 11:133059475-133059497 GCAATGGGCTTTGTGTGCTGGGG - Intronic
1091455598 12:605099-605121 GGCATGTGCCGTGTGAGATGCGG + Intronic
1091541946 12:1470007-1470029 TCCATGGCCCTTGTGAGTTACGG + Intronic
1100208247 12:92374811-92374833 GTCAGTGGCCTTGAGAGTTGGGG + Intergenic
1101764137 12:107682792-107682814 GCCCTGCCCCTTCTGAGTTGGGG - Intergenic
1108473246 13:50788265-50788287 GCCATGAGCCCTGAGAGGTGAGG - Intronic
1108477676 13:50836987-50837009 GCTCTGGGCCCTGTGATTTGTGG - Intronic
1109362727 13:61317004-61317026 GCAATGTGTCCTGTGAGTTGAGG + Intergenic
1109948851 13:69475180-69475202 GCCATGGGTTTTGTGGGTGGGGG - Intergenic
1110462567 13:75761517-75761539 GCCAAGGACCTTGTCAGTTGTGG + Intronic
1111881706 13:93965543-93965565 GCCATGGGACTTCTGAGCTGAGG + Intronic
1113415907 13:110128279-110128301 GCAAAGGGGCTTGTGATTTGGGG - Intergenic
1117195511 14:53336222-53336244 GCCATGGCCCCTCTGAGTTATGG - Intergenic
1117204199 14:53424294-53424316 GCAGTAGGCCTTGTGAGCTGTGG - Intergenic
1119558534 14:75571659-75571681 CCCATGGGCTCTGTGAGGTGTGG + Intergenic
1120328057 14:83054049-83054071 GCCAGGATGCTTGTGAGTTGTGG + Intergenic
1121414554 14:93770178-93770200 GCCATGGGCCAGGTGAGTGACGG - Intronic
1122106968 14:99465284-99465306 GCCAAGGGCCTTGTGAGATGTGG - Intronic
1122324122 14:100872613-100872635 GCTGTGTGCCTTGTGAGTAGAGG - Intergenic
1125639551 15:41218583-41218605 GCCATCAGCCTCCTGAGTTGGGG + Intronic
1126172233 15:45704583-45704605 GCTGTGGTCCTTGTGCGTTGTGG - Intergenic
1128290972 15:66477948-66477970 GCCATGGGCATGGTGGGATGAGG + Intronic
1128670537 15:69571664-69571686 GCCAATGTCCTTGTGAGTAGTGG + Intergenic
1129524320 15:76204321-76204343 GCCATGGGCTGGGTGAGATGAGG + Exonic
1131061577 15:89407804-89407826 GCCGCGGGCTTTGTGAGCTGGGG + Intergenic
1131112055 15:89770657-89770679 GCCCTGGGCCTGGTTTGTTGTGG - Intronic
1131315052 15:91328727-91328749 GCCATGGGCCTGGACAGTGGTGG - Intergenic
1132755244 16:1481351-1481373 GACTTGGGTCTTGTGGGTTGAGG + Intergenic
1139952409 16:70678754-70678776 TCCCTGGACCTTGTGAGGTGAGG - Intronic
1140930837 16:79626367-79626389 ACCAGGTGCCTTGTGAGTTAAGG - Intergenic
1142067644 16:88072001-88072023 GCCATGTGGGTTGTGGGTTGTGG + Intronic
1143384208 17:6517425-6517447 GCCAGGGGCCATGGGAGCTGGGG + Intronic
1143966589 17:10759851-10759873 GCCATAGGCCTATTGAGGTGGGG + Intergenic
1146668302 17:34719623-34719645 GGCATGAGCCTGGTGAGTTTGGG + Intergenic
1148386111 17:47236364-47236386 GCAATGAGTCTTGTGGGTTGTGG + Intergenic
1149629929 17:58114329-58114351 GCCAGGGAGCTTCTGAGTTGAGG - Intergenic
1149974076 17:61248505-61248527 GCCTTGGGCCTTGGGAGGAGGGG + Intronic
1151522431 17:74640019-74640041 GTCATGGGCGTGGTGAGGTGGGG - Intergenic
1152096871 17:78277783-78277805 GCCGTGGGCCTGGAGAGTGGGGG - Intergenic
1152747965 17:82049907-82049929 CCCATGGGCCAGGTGAGTGGGGG - Exonic
1155168884 18:23252525-23252547 GACATGGGACTTGAGATTTGGGG + Intronic
1157810804 18:50694363-50694385 GCCAGGGGACTTCTGAGGTGAGG - Intronic
1158338955 18:56444952-56444974 TCCATGGGCCATGTGACTTTAGG - Intergenic
1163837118 19:19581782-19581804 GCCATTGGCTTTGGGAGCTGAGG + Intronic
1165044010 19:33090028-33090050 TCCAAGGGCCCTGTGAGCTGAGG - Intronic
1165158546 19:33802606-33802628 GCCTTGGGGCTTGTGGGGTGGGG + Intronic
1165267928 19:34677374-34677396 GCCATGGCCCTTATAAGTAGAGG + Intergenic
1165433542 19:35785070-35785092 GGCCGGGGCCTTGGGAGTTGTGG - Exonic
1165812171 19:38618142-38618164 GCCCTGGGCCTTGGAGGTTGAGG - Intronic
1168136414 19:54355305-54355327 GCCATGGGCTTTGTGGACTGTGG + Exonic
926859418 2:17292372-17292394 GCCCTGCCCCTTCTGAGTTGGGG - Intergenic
928204661 2:29275349-29275371 GCCATGGGCCATGGGGGTTGGGG + Intronic
929765198 2:44838309-44838331 GCCAGGGGCCTGATGAATTGGGG + Intergenic
932322658 2:70833553-70833575 GCCATTGGGCTGGTGGGTTGGGG - Intronic
937072843 2:119077328-119077350 GCACTTGGCCATGTGAGTTGAGG - Intergenic
937293553 2:120796493-120796515 GCCAGGGGCCTTGTGGGAGGAGG - Intronic
937794372 2:125999472-125999494 GCGAGGGGCATTGTGAGTCGAGG + Intergenic
938730600 2:134144037-134144059 GCCATCAGCCTTGGGAGTAGAGG + Intronic
941846989 2:170143005-170143027 GCAATGGGCTTTGTGAGAGGTGG + Intergenic
941866082 2:170336165-170336187 GCTAGGGGCCTGGTGAATTGAGG + Intronic
943023562 2:182602262-182602284 GCCCTGCCCCTTCTGAGTTGGGG - Intergenic
945370689 2:209013251-209013273 GCCATGCACCTTGTGAGTTTTGG + Intergenic
946402262 2:219474467-219474489 TACATCAGCCTTGTGAGTTGGGG + Intronic
1169249387 20:4048568-4048590 GCCCTGGGCAATGTGAGTTGGGG + Intergenic
1170121443 20:12916837-12916859 GCCCTGGGCCCTGTGAACTGTGG + Intergenic
1172114348 20:32564834-32564856 GCCAGGAGCCCTGTGAGATGAGG + Intronic
1172881164 20:38200870-38200892 GCCAGGGGCCCTGGGAGTTCTGG - Intergenic
1174198748 20:48792139-48792161 GCCCTGGGCCTTGGATGTTGGGG - Intronic
1179223072 21:39426831-39426853 GCCCTGGGCCTTGCCAGTGGAGG + Intronic
1180008425 21:45034053-45034075 GCCATGGGCCTCGTGGGTGCTGG - Intergenic
1181313467 22:21957793-21957815 GCGAGGGGCCTTGAAAGTTGAGG - Intronic
1181346573 22:22223865-22223887 GCGAGGGGCCTTGAAAGTTGAGG - Intergenic
1181674204 22:24441334-24441356 GCCCTGGGGCTGGTGAGTGGAGG + Exonic
1182538017 22:31020439-31020461 GCCTGGGGCCCTTTGAGTTGGGG + Intergenic
1183213833 22:36466699-36466721 GCCAGGAGCCCTGTCAGTTGGGG + Intergenic
1183315742 22:37136020-37136042 GCCATGGGCCTTGTGAGTTGGGG - Intronic
1183369572 22:37424945-37424967 ACCATGGGCCTTGTGGGGGGCGG - Intronic
1183597920 22:38823298-38823320 GCCATGGGCCTTGGGCCTTGGGG - Intronic
954132347 3:48567095-48567117 GCCATGGTCATGGTGAATTGAGG - Intronic
954923852 3:54215116-54215138 GCCTAGGGCCTTTTGGGTTGTGG + Intronic
955075392 3:55608573-55608595 GCCTTGGCCCTGGTGATTTGGGG - Intronic
955349576 3:58183794-58183816 GCCCTCGGCCCTGTGGGTTGGGG + Intergenic
962105407 3:132383682-132383704 GCCCTGCCCCTTCTGAGTTGGGG - Intergenic
966769711 3:183492819-183492841 CCCATGGGCCTTGTGACTATAGG - Intronic
968623061 4:1612905-1612927 GCCATGTGCCTTGTGTGTGTTGG - Intergenic
969575172 4:8032502-8032524 GCCACGGCCCTTGTGACATGGGG - Intronic
978964691 4:114726045-114726067 GCCCTGTCCCTTCTGAGTTGGGG - Intergenic
984377049 4:178945269-178945291 CCCATTGGCCTAGTGAGTTTGGG + Intergenic
985641072 5:1063751-1063773 GCTGTGGGCCTCGTGAGGTGGGG - Intronic
991536769 5:67677728-67677750 GCCATTGGTGTTGTGTGTTGCGG + Intergenic
993652425 5:90537964-90537986 GCCTTGGGCATAGTGAGTTTGGG + Intronic
994375062 5:99009668-99009690 GCTTTGGGACTTTTGAGTTGGGG - Intergenic
1001485379 5:172115961-172115983 GGCATGGGGGTTGGGAGTTGGGG + Intronic
1003172043 6:3727486-3727508 GCCATTTGCCTTGTGGGATGGGG - Intronic
1003860462 6:10318015-10318037 GCCATGTGCCCTGTGAGAGGAGG + Intergenic
1007652555 6:43432467-43432489 GCCATGGGCCCTGGGAGAAGTGG - Exonic
1010874152 6:81080607-81080629 GCCATAGACAGTGTGAGTTGGGG + Intergenic
1011664719 6:89622984-89623006 GCCATGAGTGTTGTGGGTTGGGG + Intronic
1013974258 6:116059114-116059136 GTAGTGGGCCTGGTGAGTTGGGG - Intronic
1015663565 6:135603009-135603031 GCCCTGCCCCTTCTGAGTTGGGG + Intergenic
1018621288 6:165731690-165731712 GCCATGAGGCCTATGAGTTGAGG + Intronic
1019011984 6:168849943-168849965 GGCATGGGCCTTGTGGGCAGAGG + Intergenic
1019011991 6:168849967-168849989 GGCATGGGCCTTGTGGGCAGAGG + Intergenic
1019012041 6:168850159-168850181 GGCATGGGCCTTGTGGGAAGAGG + Intergenic
1019012048 6:168850183-168850205 GGCATGGGCCTTGTGGGCAGAGG + Intergenic
1019012132 6:168850495-168850517 GGCATGGGCCTTGTGGGCAGAGG + Intergenic
1019300582 7:301580-301602 GCCTAGGGCCGTGTGATTTGAGG + Intergenic
1022795359 7:33727478-33727500 GCCTCGGGCCTTGTGGCTTGTGG - Intronic
1026292223 7:69018072-69018094 GACTTGGGACTTTTGAGTTGGGG - Intergenic
1027996103 7:85427122-85427144 GCCATGGGCCTTGTGCTCTAAGG + Intergenic
1029103141 7:98151107-98151129 GCCATTGGCCTGGTGATTGGTGG + Intronic
1029232358 7:99081031-99081053 CCCATGTTCATTGTGAGTTGGGG - Intronic
1031430220 7:121658791-121658813 GCCAGGGGCTTTGTTAATTGAGG + Intergenic
1032519641 7:132534290-132534312 GCCCTGGGGCTGGTGACTTGGGG - Intronic
1032709547 7:134450072-134450094 GCCTTGGGCCCTGTGAGTCCTGG - Intronic
1033527743 7:142232899-142232921 GCCATGGGTCTTCAGACTTGAGG + Intergenic
1034197141 7:149256660-149256682 GCCTTGGGCCTTGTGTTGTGGGG + Intergenic
1034908755 7:154974339-154974361 GCCACTGGGCTTTTGAGTTGGGG - Intronic
1036581585 8:10080466-10080488 CACATGGGCCTTGTGCTTTGTGG + Intronic
1040139539 8:43894324-43894346 GTCCTGGGCTGTGTGAGTTGTGG - Intergenic
1040279177 8:46029363-46029385 GGCTTGGGCTTTGGGAGTTGCGG + Intergenic
1044238298 8:89856999-89857021 GCCAAGGACCTTGGGAGTTGTGG - Intergenic
1045008381 8:97936108-97936130 GCCAGGTGCCCTGTGAATTGAGG + Intronic
1046290826 8:112158222-112158244 GACATGGGCCTTGTGTGGTTTGG - Intergenic
1047295118 8:123563934-123563956 GCCTTAGCCCTTGAGAGTTGTGG + Intergenic
1047507104 8:125488576-125488598 GCCATGGGCATTGTTGGGTGAGG + Intergenic
1049016596 8:139924439-139924461 TCCATGGGCCCAGGGAGTTGGGG - Intronic
1049197678 8:141324574-141324596 GCCCTGGGGCTTCTGAGCTGAGG - Intergenic
1049233135 8:141494551-141494573 GCCAAGGGGCTCGTAAGTTGGGG - Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1050206151 9:3198554-3198576 CACATTGGCCTTGGGAGTTGAGG + Intergenic
1051137538 9:13939606-13939628 GCCTTGGTCCTTTTGAGTTGTGG - Intergenic
1053196713 9:36125524-36125546 GCCATGGGAGGTGTGAGTTGGGG + Intergenic
1053282107 9:36827087-36827109 TGCATGTGCCTTGTGAGCTGTGG - Intergenic
1056935818 9:90914184-90914206 TCCATGGGGCTTGTGTGGTGGGG - Intergenic
1059103421 9:111491155-111491177 GCAATTGGCATTGTAAGTTGTGG - Intergenic
1059566224 9:115385539-115385561 GCCTTGCTCCTTTTGAGTTGGGG + Intronic
1059839129 9:118192231-118192253 ACCATGGGCCTGGGGAGTGGTGG + Intergenic
1059937074 9:119322102-119322124 GGCATGGGGCTTGGGAGATGTGG - Intronic
1060673126 9:125488194-125488216 GACATGCCCCTTGTCAGTTGGGG - Intronic
1061533592 9:131233620-131233642 ATCATGCGCCTTGTGAGTTTTGG - Exonic
1061680703 9:132241292-132241314 GGCAGGGGCCTGGTGAGATGGGG + Intronic
1062420371 9:136477952-136477974 GCAATGGGCCCTGTGAGTAGAGG - Intronic
1188580398 X:31705027-31705049 CCCAGTGGCCTTGTGAGTTATGG + Intronic
1194380137 X:93181211-93181233 GCCCTGCCCCTTCTGAGTTGAGG + Intergenic
1196188593 X:112771560-112771582 GCCATGGGCACAGTGAGCTGAGG + Intergenic
1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG + Intronic
1199360168 X:146907795-146907817 GCCCTGTCCCTTCTGAGTTGGGG - Intergenic
1199804809 X:151287979-151288001 GCCATGGGCATTCTGAGGAGGGG - Intergenic