ID: 1183316888

View in Genome Browser
Species Human (GRCh38)
Location 22:37141837-37141859
Sequence CAGCCTGGGCAGAAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 963
Summary {0: 1, 1: 0, 2: 9, 3: 98, 4: 855}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183316879_1183316888 -9 Left 1183316879 22:37141823-37141845 CCCCTTGGCCCGAGCAGCCTGGG 0: 1
1: 2
2: 20
3: 142
4: 421
Right 1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG 0: 1
1: 0
2: 9
3: 98
4: 855
1183316881_1183316888 -10 Left 1183316881 22:37141824-37141846 CCCTTGGCCCGAGCAGCCTGGGC 0: 1
1: 0
2: 14
3: 114
4: 351
Right 1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG 0: 1
1: 0
2: 9
3: 98
4: 855
1183316877_1183316888 1 Left 1183316877 22:37141813-37141835 CCTGCAGGTGCCCCTTGGCCCGA 0: 2
1: 6
2: 38
3: 123
4: 292
Right 1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG 0: 1
1: 0
2: 9
3: 98
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183316888 Original CRISPR CAGCCTGGGCAGAAGGAGGC GGG Intronic
900031826 1:378170-378192 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
900052374 1:606361-606383 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900309700 1:2027792-2027814 AAGCCTGGGCAGGAGGAGAAGGG + Intronic
900412002 1:2516739-2516761 AAGCCAGTGCAGAAGGCGGCAGG + Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900750721 1:4395475-4395497 CAGCCTGAACAGAAGAAGACAGG + Intergenic
900768061 1:4518776-4518798 CAGCCTGGGCTGAACGAGGAAGG + Intergenic
901001958 1:6153317-6153339 CAGGCTGGGCAGACAGGGGCGGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902367083 1:15983037-15983059 CAGCCTGGTCAGATGGAAGGAGG - Intergenic
902786040 1:18733383-18733405 CTGCCTGGGAGGCAGGAGGCTGG - Intronic
902808061 1:18872999-18873021 CAGCCTGGGCAGAAGGGGAAGGG + Intronic
902811857 1:18892539-18892561 CATCCCAGGTAGAAGGAGGCGGG + Intronic
903360572 1:22774405-22774427 CAGCCAGAGCAGGAGGAGTCAGG + Intronic
903541273 1:24097705-24097727 CAGCCTGGGCTGATGGTGGAAGG - Intronic
903769722 1:25756345-25756367 TGGCCTGGGCAGAGGCAGGCAGG - Intronic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
904295940 1:29519776-29519798 CAGCTTGGGCAGCAGGAGCCAGG - Intergenic
904335962 1:29798281-29798303 CAGGCTGGGGAAGAGGAGGCAGG - Intergenic
904391799 1:30190907-30190929 CAGGATGGGCACCAGGAGGCAGG + Intergenic
904446126 1:30574256-30574278 GAGTCTGGGCCAAAGGAGGCAGG - Intergenic
904577451 1:31514202-31514224 AGTCCTGGGCAGAAGGGGGCAGG - Intergenic
904615195 1:31745800-31745822 CGGGCTGGGCAGCAGGGGGCAGG - Intronic
904744614 1:32703036-32703058 CAGCCTGGGAGGGTGGAGGCAGG + Exonic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
905025200 1:34845015-34845037 CTGGCTGGGCAGAAGGCAGCAGG + Intronic
905251026 1:36648433-36648455 GACCCTGTGCAGAATGAGGCTGG - Intergenic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
906270378 1:44473081-44473103 TAGGCAGGGCAGGAGGAGGCAGG + Intronic
906704110 1:47882224-47882246 CAGCATGGGGAGCATGAGGCAGG - Intronic
907045035 1:51295419-51295441 CAGCCTTGGCAGGTGGAGGATGG - Intronic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
908288838 1:62640989-62641011 CAGCCTGGGATGTAGGAAGCTGG - Intronic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
908775709 1:67638145-67638167 CAGCGTGGTCAGAGAGAGGCTGG + Intergenic
909238327 1:73180855-73180877 GCTCCTGGGCAGAAGGGGGCGGG - Intergenic
909907813 1:81221012-81221034 GTGCCTGGGCAGAAAGGGGCGGG + Intergenic
910553833 1:88507597-88507619 CAGCATGGGACAAAGGAGGCAGG - Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
913137633 1:115908264-115908286 CAGCCTTGGGATAAGGAGGATGG - Intergenic
913461447 1:119090318-119090340 CAGCCAGTGCACAAGAAGGCTGG - Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915143261 1:153779657-153779679 GAGCCAGGCCAGAAGAAGGCAGG - Intronic
915163932 1:153937974-153937996 CAGCCTGGGAAGATGGCGTCAGG + Intronic
915346191 1:155198217-155198239 TTGCCTGGGCAGAGTGAGGCTGG + Exonic
915471512 1:156128503-156128525 CAGCCTGAGCTGAAAGAAGCTGG - Intronic
915556165 1:156661952-156661974 CAGCCTGGAAGGAAGGAAGCTGG - Intergenic
915588939 1:156859919-156859941 CACCCAGGGCAGCAGAAGGCTGG - Intronic
915736839 1:158090503-158090525 CCGCCCGGGCAGCAGGCGGCTGG + Intronic
915797410 1:158751889-158751911 ATTCCTGGGCAGAAGGGGGCAGG - Intergenic
915916070 1:159941752-159941774 AGGCCTGGGCAGGCGGAGGCAGG + Intronic
916015968 1:160750209-160750231 CAGGCTGGGAGGAAGGTGGCAGG + Intronic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
918918199 1:190671584-190671606 CAGGCTGGGAAAGAGGAGGCAGG + Intergenic
919239183 1:194889553-194889575 GCTCCTGGGCAGAAGGAGGCAGG + Intergenic
919342293 1:196327693-196327715 CAGCCTGGGCGGCAGGAGTGAGG - Intronic
919925234 1:202188685-202188707 CAGCCTGGGCCCAGGGAGGGAGG - Intergenic
920082226 1:203383172-203383194 CAGCCTGGGCTCAATGAGTCAGG - Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920195847 1:204226565-204226587 CAGTCTGGCCACAAGGAAGCAGG - Intronic
920427432 1:205889320-205889342 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
920522159 1:206635722-206635744 GGGCCTGGGCGGAAGGATGCGGG + Exonic
920693317 1:208163371-208163393 CAGCCTGGGCTGGGGGAGGGAGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
920983485 1:210861710-210861732 CAGACTGGTCAGAAAGAAGCTGG + Intronic
921151742 1:212408324-212408346 CTGCCTGGAAGGAAGGAGGCTGG - Intronic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923445773 1:234069861-234069883 CAGTCTGGGCAGTACGAGACTGG - Intronic
923475198 1:234325302-234325324 CAGCTGGGGCAGCAGGATGCTGG + Intergenic
923541413 1:234890934-234890956 CAGCCTGGGCAGATGTCAGCAGG - Intergenic
923557481 1:235012302-235012324 CAACCTGGCCAGAAAGAGTCTGG + Intergenic
924611979 1:245580856-245580878 CAGCATGGGCAGAACGAGGAAGG - Intronic
1063041335 10:2341062-2341084 CAGCCTGGGTAAAAGGATGCTGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1064824179 10:19376582-19376604 CAGCCTGGGCAATAGGAGCAAGG - Intronic
1066103492 10:32137741-32137763 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1066217325 10:33300462-33300484 CGGCCTGGACAGAATCAGGCAGG + Intronic
1067111971 10:43407555-43407577 CAGCCGGCGCAGCAGGAGCCGGG + Intronic
1067910813 10:50344751-50344773 CAGCCTGGGCAGGAGTAGCTGGG - Intronic
1069070975 10:63990391-63990413 CAGCCAGGTCAGAAGGAGACAGG - Intergenic
1069552875 10:69376675-69376697 CACCATGGGCAGGAGCAGGCAGG - Intronic
1069591277 10:69643886-69643908 CAGCCAGGGCTGCAGGAGGGGGG - Intergenic
1069869997 10:71527262-71527284 CACCCGGGACAGAAGGAGGCAGG - Intronic
1069990586 10:72313297-72313319 CAGCCTGGGCAACAGGAGCCTGG - Intergenic
1069991544 10:72319629-72319651 CAGCCGGGGCAGAAGGCAGCCGG + Intergenic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070324415 10:75378521-75378543 CTGCCTGGGCTGAGGGAGGGAGG - Intergenic
1070600616 10:77864021-77864043 CACCCAGGTCAGAGGGAGGCTGG - Intronic
1070712651 10:78693929-78693951 GAGTCAGGGGAGAAGGAGGCTGG + Intergenic
1070793335 10:79202738-79202760 CAGCCTGGGCAGTGGGAGCTGGG - Intronic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071550887 10:86565326-86565348 CAGCCTGGGGAGAAGGGGAAAGG + Intergenic
1071573659 10:86711312-86711334 CAGCCCGGGAAGGAGGAGGAAGG - Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072679747 10:97498506-97498528 CTGCCTAGGCAGAAGCCGGCAGG - Exonic
1072693058 10:97584190-97584212 CTGCCTTGGCAGGAGGAGCCTGG + Intergenic
1072985241 10:100133919-100133941 CAGCCTGGGCACCAGGGGGATGG - Intergenic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073125341 10:101145837-101145859 CGGCCTGGGCACAGTGAGGCTGG - Intergenic
1073513424 10:104056930-104056952 CAGCCTGTGTGGTAGGAGGCAGG - Intronic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074585163 10:114761413-114761435 GAGCCTGGGCAGTAGCAAGCTGG - Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1075521974 10:123148565-123148587 TGGTCTGGGCAGAAGCAGGCGGG - Exonic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1075579681 10:123607651-123607673 CAGCCGGAGCAGAAGGGGCCAGG - Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1076562452 10:131376048-131376070 CAGCCTGAGGAGAAGAAGGTGGG - Intergenic
1076649084 10:131975214-131975236 CAGCCAGCGCAGAGTGAGGCGGG - Intronic
1076859390 10:133133509-133133531 TACCTTGGGCAGATGGAGGCCGG + Intergenic
1076933998 10:133555435-133555457 CAGCCTGGACAGGAAGAGGTAGG + Exonic
1077181933 11:1220691-1220713 CAGCCTGGCCTGGAGCAGGCAGG + Intergenic
1077341198 11:2027150-2027172 GACCCTGGGCAGAGGGAGACAGG + Intergenic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077912665 11:6586903-6586925 GAGCCGAGGCAGCAGGAGGCTGG - Intronic
1078228309 11:9414333-9414355 CAGACTGGTCAGAAAGAAGCTGG - Exonic
1078340547 11:10495456-10495478 CAGCCTGGGAGCAAGGTGGCTGG + Intronic
1078719637 11:13872518-13872540 CAGCCTGGGCTTTAGGAGGTTGG - Intergenic
1079230424 11:18644661-18644683 CAGCCTGGGGAGAAGGAGAGAGG - Intergenic
1079330706 11:19530318-19530340 CACCCTGGGCATCACGAGGCAGG + Intronic
1080796159 11:35565558-35565580 CCAGCTGGGCAGAATGAGGCAGG + Intergenic
1080802098 11:35618633-35618655 GAGCATGGGCAGGAGGATGCGGG + Exonic
1081001657 11:37680802-37680824 AACTCTGGGCAGAAGAAGGCAGG + Intergenic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1082767438 11:57180645-57180667 TCGCCTGTGCAGAAGGAAGCTGG + Intergenic
1082997110 11:59263277-59263299 CACCCTGGGAGGCAGGAGGCCGG + Intergenic
1083234052 11:61340764-61340786 TAGCCAGGCCAAAAGGAGGCTGG - Intronic
1083239671 11:61378205-61378227 CAGCCTGGGCAACAGCAGGAAGG - Intergenic
1083299476 11:61732801-61732823 CAGCCTGGCCAGAGGGAGAAGGG + Intronic
1083609930 11:63999832-63999854 CGGCCTGGGCAGAAGGGGGCAGG + Intronic
1083614593 11:64019959-64019981 CTGCCTGGGCCCTAGGAGGCTGG - Intronic
1083747005 11:64742359-64742381 CAGCTGGGGCGGAAGGAGCCTGG + Intronic
1083946452 11:65925787-65925809 CTGCCTGGGCAGAAGGCAACAGG + Intergenic
1084153203 11:67300783-67300805 CAGCCTGGGCCCAGGGAGGAGGG + Intronic
1084506704 11:69572936-69572958 CAGCCCAGGCAGCAGGAGGTTGG - Intergenic
1084582096 11:70030344-70030366 CAGTCTGGGCTCAAGGAGTCCGG - Intergenic
1084749922 11:71197914-71197936 CAGCCAGGGAAGAAGGAGTCGGG + Intronic
1084966446 11:72747079-72747101 TGGCCTGGCCAGAAGGAGGCAGG + Intronic
1085043333 11:73339667-73339689 CAGATTGGGCAGAAGTAGGGAGG + Intronic
1085100552 11:73796588-73796610 CTTCCTGGGCAGAAGGGGGCAGG + Intronic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085296823 11:75436089-75436111 TGGCCAGGGCAGAAGGAAGCAGG - Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085456658 11:76669279-76669301 TGGCCTGGGCAAGAGGAGGCAGG + Intronic
1085640330 11:78189090-78189112 CAGGCCGGGCAGGACGAGGCTGG - Exonic
1086571956 11:88295406-88295428 CAGCCTGGGCAAACGGAGTGAGG - Intronic
1089177795 11:116561011-116561033 CAGCCCGGCCTGAGGGAGGCAGG + Intergenic
1089472173 11:118730202-118730224 CAGCCTGGGGAGGAGCAGCCTGG + Intergenic
1089491731 11:118888150-118888172 TGCCCTGGGAAGAAGGAGGCTGG - Intronic
1089498669 11:118920436-118920458 CAGCCTGAGCAGAAGACGGAGGG - Intronic
1089526839 11:119102510-119102532 CAGCTGGGGCAGAAGGTGGGTGG - Intronic
1089529265 11:119116086-119116108 AGGCCTAGGCAGAAGGAAGCTGG + Exonic
1089693338 11:120200048-120200070 GAGCCAGGGCAGAGGGAGGGAGG + Intergenic
1090137057 11:124209812-124209834 GCTCCTGGGCAGAAGGTGGCGGG - Intergenic
1090210957 11:124920971-124920993 GAGCATGCGCAGACGGAGGCGGG - Exonic
1090260431 11:125315103-125315125 AAGCCTGCTCAGAGGGAGGCAGG + Intronic
1090273065 11:125401356-125401378 CAGCCAGGGTACGAGGAGGCGGG + Intronic
1090880302 11:130826860-130826882 TAGCCTGGAGAGAAGCAGGCTGG + Intergenic
1091295010 11:134467571-134467593 CAGACTGGGAAGCAGCAGGCTGG - Intergenic
1202824183 11_KI270721v1_random:82339-82361 GACCCTGGGCAGAGGGAGACAGG + Intergenic
1091445701 12:543280-543302 GAGGCTGGGCAGAAAGGGGCCGG - Intronic
1091454947 12:599948-599970 GCAGCTGGGCAGAAGGAGGCGGG - Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092269325 12:7010443-7010465 CAGCCTGGGCAACAGGAGTGAGG - Intronic
1092508083 12:9124799-9124821 ACTCCTGGGCAGAAGGGGGCAGG + Intergenic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1093137119 12:15465729-15465751 CAGCCGGGGCATATGGAGACTGG + Intronic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1094575872 12:31685055-31685077 CAGCCTGGGCAAGAGTGGGCAGG - Intronic
1095243233 12:39885839-39885861 AATCCTGGGTAGGAGGAGGCTGG - Intronic
1095946867 12:47758706-47758728 CTGCCAGGGCAGCAGGATGCAGG + Intronic
1096193517 12:49634605-49634627 AGGCCTGGGCAGAGGGAGCCAGG + Intronic
1097592294 12:61588518-61588540 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098951574 12:76645308-76645330 GCTCCTGGGCAGAAGGGGGCGGG + Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1100672869 12:96835500-96835522 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1100842771 12:98630352-98630374 CAGCCTGGGCAACAAGAGCCTGG + Intronic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG + Intergenic
1101650404 12:106672352-106672374 CAGCCTGGGCAGACAGAGCTGGG - Intronic
1101838760 12:108312974-108312996 CAGCCTAGGCAGGAGGACCCTGG - Intronic
1101940957 12:109098453-109098475 CCGGCTGGGCAGGAGGAGCCTGG + Exonic
1102317873 12:111904668-111904690 CAGCCTGGGGTGAAGGGGGAGGG - Intergenic
1102675588 12:114656265-114656287 CAGTCAGGGCAGCAGGGGGCTGG - Intergenic
1102890201 12:116552799-116552821 CCGCCTGGGGAGAAGGAGAAGGG + Intergenic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103591026 12:121992604-121992626 CAGCCTGGGCAACAGGAGTGAGG - Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1104015733 12:124960485-124960507 CAGCCTGGGCAGACAGAAACCGG + Intronic
1104049477 12:125186236-125186258 CAGCCCGGCCAGTAGGCGGCGGG - Intergenic
1104097188 12:125568506-125568528 CAGCCTCGTCAGATGGAGACTGG + Intronic
1104391045 12:128390762-128390784 CAGCCTGGGAAGAGCGAAGCCGG + Intronic
1104756435 12:131272525-131272547 GAGCCTGGGCGCAGGGAGGCAGG + Intergenic
1104958955 12:132479118-132479140 CAGAGTGGGCCGCAGGAGGCCGG + Intergenic
1105247864 13:18668573-18668595 CAGCCCGGGCAGACGGGAGCAGG + Intergenic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1106161772 13:27207620-27207642 AAGCCTGGGAAAAAAGAGGCTGG + Intergenic
1106253535 13:28001894-28001916 GCTCCTGGGCAGAAGGAGTCAGG - Intergenic
1106558997 13:30832945-30832967 TAGCCAGGGCAGGAGGAGGCTGG - Intergenic
1107178855 13:37432631-37432653 CAGCCTGGGCAAAATGGGGAAGG - Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1108286498 13:48914484-48914506 CAGCAAGGGCAGAAGGAAGCAGG - Intergenic
1109716831 13:66230413-66230435 CAGCCTGGCCAGGAGCAGCCTGG + Intergenic
1113565742 13:111318661-111318683 CAACCTGGGCAGCAGTCGGCTGG - Intronic
1113789242 13:113018843-113018865 CCGCCTGGGCAGTGGGAGGGGGG - Intronic
1113891456 13:113737723-113737745 GAGCCAGGACAGGAGGAGGCCGG - Exonic
1113901879 13:113802220-113802242 TGGCCTGGGCAGGAGGAGGGAGG + Intronic
1114602845 14:23970074-23970096 CAGCCTCGGCAGTAGGGGTCAGG + Intronic
1116448558 14:45039411-45039433 GATCCTGGGCAGAAAGGGGCAGG - Intronic
1117733960 14:58751092-58751114 CAGCCAAGGCAGCAGGGGGCTGG - Intergenic
1117804108 14:59472471-59472493 CAGCCTGGGAAGGATGGGGCTGG - Intronic
1118011702 14:61616409-61616431 CAGCCTGGGCTCCAGGAGCCTGG + Intronic
1118607445 14:67514537-67514559 CACCCTGGGGAGAAGGCGGCGGG + Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119036156 14:71231725-71231747 ACTCCTGGGCAGAAGGGGGCTGG + Intergenic
1119046442 14:71321544-71321566 CAGCCTGAGCTGGAGTAGGCAGG + Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119248496 14:73132722-73132744 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1119322201 14:73738891-73738913 CAGCCTGGGCAGGAGGCCACTGG - Exonic
1120017312 14:79488535-79488557 AAGCTGGGGCAGAAGAAGGCAGG + Intronic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1120978951 14:90274209-90274231 CAGCATGGGCAGGGTGAGGCTGG + Exonic
1121063264 14:90937254-90937276 CAGCCTCAGCAGATGGTGGCGGG + Intronic
1121791442 14:96702540-96702562 CAGCCTGGGCAGAATGTGGCAGG + Intergenic
1121846387 14:97175892-97175914 AAACCTGGGCAGAAGGGTGCTGG + Intergenic
1122009851 14:98737079-98737101 CAGCCTGGGAGGAGGCAGGCAGG + Intergenic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122209465 14:100165690-100165712 CAGCCAGCCCGGAAGGAGGCAGG - Intergenic
1122287627 14:100661090-100661112 CGGCCTGGGAAGCAGGCGGCCGG - Intergenic
1122634287 14:103122999-103123021 CACCGTGGCCACAAGGAGGCAGG - Intergenic
1122634581 14:103123969-103123991 GAGGCCGGGCAGCAGGAGGCTGG + Intronic
1122635028 14:103125806-103125828 GGGTCTGGGCAGGAGGAGGCTGG + Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1122814937 14:104307653-104307675 CAGCCTGGGCAGGAGAGGGCCGG + Intergenic
1122860531 14:104580454-104580476 CAGCCTGGGCAGTGGGAGAAGGG + Intronic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1122915488 14:104856426-104856448 AAGCCTAGGCAGAAGAAGGCAGG + Intergenic
1123119714 14:105911037-105911059 CAGCCAGTGCAGACAGAGGCTGG - Intergenic
1123814761 15:23965423-23965445 GAGCTTGCGCAGGAGGAGGCAGG - Intergenic
1124109357 15:26772608-26772630 CGGCCTGGGCGGAGGGAGGCGGG - Intronic
1124239337 15:28017051-28017073 CAGCCTGGGGAGCGGGGGGCGGG + Intronic
1125524830 15:40368286-40368308 CAGCGTGGGCAGCCGCAGGCGGG - Exonic
1125632872 15:41162322-41162344 TACCCAGGGCAGAATGAGGCAGG + Intergenic
1125848994 15:42886175-42886197 CAGCCTGGGGAGAAGGGGAGAGG - Intronic
1127017776 15:54708237-54708259 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1127225086 15:56919263-56919285 GAGCCTGGGGAGGAGGACGCCGG + Intronic
1127475408 15:59328011-59328033 CAGCCTGGGCAGAAGTGTGGAGG + Intronic
1128082457 15:64864760-64864782 AAGCCAGGACAGAGGGAGGCTGG + Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128090348 15:64914971-64914993 CAGCGTGGGCAGGTGGAAGCTGG + Intronic
1128302433 15:66575008-66575030 ACCCCTGGGCAGAAGCAGGCTGG + Intergenic
1128313765 15:66647432-66647454 CAGCCTGGGGAGCTGGCGGCAGG - Intronic
1128370544 15:67036035-67036057 CAGCCTGGGGAGACTGTGGCTGG - Intergenic
1128461360 15:67870180-67870202 CAGCCTAGGCAGACAGGGGCAGG - Intergenic
1128724802 15:69980466-69980488 CAACCAGGGCAGAGGGAGGAAGG - Intergenic
1128757282 15:70191575-70191597 CAGCATGGCCAGGAGGAGGCGGG + Intergenic
1128847837 15:70917242-70917264 TTGCCTGAGCAGAAGGGGGCAGG + Intronic
1128965254 15:72051857-72051879 GCTCCTGGGCAAAAGGAGGCAGG + Intronic
1128998690 15:72315924-72315946 CAGCCTGAGGAGGAAGAGGCTGG + Exonic
1129155828 15:73717014-73717036 GACCCTGGGCAGCAGGAGCCTGG + Intergenic
1129256696 15:74337861-74337883 CAGGCTGGGCAGAAAGGAGCAGG + Exonic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129739157 15:77981630-77981652 CAGCCTGGGCCACGGGAGGCAGG - Intergenic
1130227839 15:82073305-82073327 GTTCCTGGGCAGAAGGAGGTGGG - Intergenic
1131271472 15:90950042-90950064 AAGCCTGGGGAGAGGGAGGAAGG + Intronic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132507831 16:321159-321181 GAGCGTGGGTAGCAGGAGGCAGG - Intronic
1132670006 16:1098665-1098687 CAGCCTGGGAACACGGAGCCAGG - Intergenic
1132783450 16:1641589-1641611 CATCCAGGGCACAAGAAGGCAGG - Intronic
1132852761 16:2032350-2032372 CAGCATGGGCAGGAAGAGGTGGG + Intronic
1132860673 16:2070172-2070194 CAGACAGGGCAGAATGGGGCGGG - Intronic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1133147275 16:3798123-3798145 CAGCCCAGGCAGAAGGATGCAGG + Intronic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1133221277 16:4320166-4320188 CAGCCTTGGCAGATGGCTGCCGG + Intronic
1133311534 16:4849915-4849937 CAGCCTGGGCAACAGGAGTGAGG + Intronic
1133400437 16:5482393-5482415 CCGCCTGGGCTGCAGGAAGCAGG - Intergenic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134070182 16:11255840-11255862 CAGCCTGGCCAGCAGGCGGCGGG - Intronic
1134082342 16:11333717-11333739 CTGCCTGGGGAAAAGGGGGCCGG - Intronic
1134100899 16:11450665-11450687 CAGCGTGGGCTGCAGGAGTCAGG - Exonic
1134118432 16:11566741-11566763 CAGCCTGGGCAGGGGTAGGGGGG + Intronic
1134222155 16:12363234-12363256 CAGCCAGGGCAGAAGAAAGAAGG + Intronic
1135025507 16:18996201-18996223 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
1135184756 16:20305900-20305922 CAGCCTGGGGTGAAGGGTGCAGG + Intergenic
1135773051 16:25232172-25232194 CAGCCTGGCCAACATGAGGCAGG - Intergenic
1136504321 16:30693214-30693236 CAGCCTGGGCAAAACAAGGCTGG - Intergenic
1136553260 16:30992969-30992991 CAGACAGGGCAGAGGGTGGCAGG + Intronic
1137334345 16:47533397-47533419 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1137597549 16:49734799-49734821 ATGCCTGGGCAAAAGGATGCAGG - Intronic
1138067603 16:53958403-53958425 CAGCCTGGGAAGCTGGCGGCCGG + Intronic
1138199565 16:55078704-55078726 GGGCCTGGGCAGAAGGAAGGAGG + Intergenic
1138201407 16:55091405-55091427 GAGCCAGGGCTGAGGGAGGCGGG + Intergenic
1138976596 16:62214838-62214860 GAGACTGGACAGAAGGAAGCTGG - Intergenic
1138988475 16:62361422-62361444 CAGCCTGGGCAGAAGAAAGAAGG + Intergenic
1139530211 16:67538929-67538951 CACCCTGGGCAGCATGAGGCTGG + Intronic
1139546314 16:67651449-67651471 CAGCTTGGGCAGAAGCTGGAGGG + Exonic
1139574615 16:67833216-67833238 CAGCCTGGGCAGAAGTTGGGAGG - Intronic
1139783273 16:69369338-69369360 CAGCCTGGGCAAAAGAAACCAGG - Intronic
1139956658 16:70696600-70696622 CACACTGGGGAGAAGCAGGCTGG - Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1140299057 16:73738786-73738808 CAGCCTGTAGAGAAGGGGGCAGG - Intergenic
1140805308 16:78527132-78527154 CAGCCTGGGCAAAAAGAGCGGGG + Intronic
1141558685 16:84852817-84852839 CTGCCTCGGCCAAAGGAGGCTGG - Intronic
1141624406 16:85253701-85253723 TAGCCAGGGGAGAAGGAGGGTGG + Intergenic
1141683058 16:85555282-85555304 GCGCCTGGGCAGAAGGAGGCAGG - Intergenic
1141810449 16:86372194-86372216 CAGCTGGTGCAGAAGGAGGTGGG - Intergenic
1142108960 16:88321135-88321157 CAGCCTGGACAGGAGGAGCTTGG - Intergenic
1142180299 16:88665595-88665617 CAGCCGTGGCAGAAGGAAGGAGG - Intergenic
1142263147 16:89051787-89051809 CAGGCTGGGCAGAAAGAGCTGGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142586576 17:978627-978649 CAGCCTGGGGCGGGGGAGGCGGG + Intronic
1142698314 17:1645409-1645431 CAGCCAGGGCAGATGGTGGAAGG - Intronic
1142740826 17:1931004-1931026 CAGCCTGGGAAGGAGGAGACCGG + Intergenic
1142742715 17:1940523-1940545 CTCCTTGGGCAGATGGAGGCAGG - Intronic
1142975703 17:3642750-3642772 CAGCAAGGGCAGAATGAGGTTGG - Intronic
1143149509 17:4798883-4798905 GAGGCTGGGCTGGAGGAGGCTGG - Intergenic
1143186173 17:5011827-5011849 CAGCCTGGACAGAAGCATGGAGG - Intronic
1143414488 17:6736021-6736043 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1143601430 17:7948624-7948646 AAGCCTGGGAGGAAGGAGGAAGG + Exonic
1143948590 17:10615701-10615723 CAGCCTAGGAAGGAGGAGGCAGG + Intergenic
1144702678 17:17349259-17349281 CTCCCTGGGCAGGAGGAGGGAGG - Intergenic
1144789416 17:17849153-17849175 CAGCCTGGGCTGCAGAGGGCGGG + Intronic
1145297430 17:21602282-21602304 CAGCCTGGTCACAAGGTGACGGG + Intergenic
1146307297 17:31740262-31740284 CAGCCTGGGCAAAAAGAGCGGGG + Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146402572 17:32511432-32511454 CAGCCTGGGCAAGACCAGGCTGG - Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147328167 17:39680030-39680052 CAGCCTGGGCAGCAGACGGCAGG - Intronic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147623851 17:41886390-41886412 CAGCCTGGCCAGAAGGGGCTGGG - Intronic
1147652176 17:42068951-42068973 CACCCTGGGTAGAAAGAGGTGGG + Intergenic
1148156601 17:45428222-45428244 CACCCTGGCCACAAGGCGGCGGG + Intronic
1148482618 17:47970083-47970105 AAGACTGGGGACAAGGAGGCTGG - Intronic
1148543925 17:48502503-48502525 CAGTTTGGCCAGAAGGTGGCTGG + Intergenic
1149531975 17:57402738-57402760 AAGGCTGGGCTGGAGGAGGCTGG - Intronic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1149594010 17:57852764-57852786 CAGCCTGGGCAAAATTAGCCAGG + Intergenic
1149864873 17:60145772-60145794 AAGCCAGGGCAGATGGAGGCTGG + Intergenic
1149884642 17:60328041-60328063 GCTCCTGGGCAGAAGGGGGCAGG + Intronic
1150124481 17:62627620-62627642 CAGCCCGGGCGGAGGGAGGGCGG - Exonic
1150227308 17:63531038-63531060 CAGGCAGGGCAGGATGAGGCTGG + Intronic
1150298296 17:64027058-64027080 CAGCCCCGGAAGAAGGAGGTGGG + Intergenic
1150388319 17:64777012-64777034 CACCCTGGCCACAAGGCGGCGGG + Intergenic
1150445404 17:65224343-65224365 CAGGCTGGGGAGAAGGAAACAGG - Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1150791140 17:68200951-68200973 CACCCTGGCCACAAGGCGGCGGG - Intergenic
1151207929 17:72521953-72521975 CAGCCTGGGCAGCAAGAGCAAGG + Intergenic
1151355367 17:73555009-73555031 CAGGCTGGGAGGAAGGAGGATGG + Intronic
1151379098 17:73712580-73712602 CAGCCTGTGCACAAGGGGTCTGG + Intergenic
1151698270 17:75729246-75729268 CAGCCTGGGCAGAGGTGGGAGGG - Exonic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1151944870 17:77314138-77314160 CAGCCTGGGCAAAGGGAGTAAGG + Intronic
1151997338 17:77618319-77618341 CAACTGGGGGAGAAGGAGGCAGG - Intergenic
1152181840 17:78827136-78827158 CAGCCTGGGTAGAAAGGTGCCGG + Intronic
1152285852 17:79413004-79413026 GAGACAGGGCAGAAGCAGGCTGG - Intronic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152581583 17:81167709-81167731 CACCTGGGGCAGAAGGAGACAGG + Intergenic
1152947831 17:83207544-83207566 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1153060034 18:985653-985675 CAGCTTGGGTAGTAGAAGGCAGG - Intergenic
1153553314 18:6284872-6284894 CAGCGTGGGCAGTCGGAGCCCGG + Intronic
1153641607 18:7162540-7162562 CAGCCTTGGCAGCAGGAGGAAGG - Intergenic
1153972468 18:10238982-10239004 AGGCCCGGGCAGCAGGAGGCAGG + Intergenic
1153977048 18:10278555-10278577 CAGCTTGGGGAGAGGCAGGCAGG - Intergenic
1154024544 18:10695295-10695317 GAGGCTGGGGAGAAGAAGGCTGG + Intronic
1154028073 18:10725893-10725915 CAGGCTGGGCAGGAGGGTGCAGG + Intronic
1154092423 18:11378195-11378217 CAGCCTCGGCAGGAGGAAGGAGG - Intergenic
1154379763 18:13838433-13838455 GAACCTGGGCAGGAGGAGCCTGG + Intergenic
1154440985 18:14390561-14390583 CAGCCCGGGCAGACGGGAGCAGG - Intergenic
1154485034 18:14866456-14866478 CAGCCTGAGCTGTAGGAGGGTGG + Intergenic
1154982808 18:21517807-21517829 CAGCGAGGGCAGAAGAAAGCAGG - Intronic
1155892789 18:31288315-31288337 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
1155961851 18:32001904-32001926 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1156034840 18:32754687-32754709 CAGCCTGGTTGGCAGGAGGCTGG - Intronic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157280763 18:46345044-46345066 CAGCTTGGCCAGAAGGAGCGAGG - Intronic
1157576376 18:48746549-48746571 CAGGCTGGCCAGGAGGAGTCAGG + Intronic
1158198096 18:54910590-54910612 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1158367032 18:56747724-56747746 CAGCCTGTGCAGATGCAGGTGGG + Intronic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1160144746 18:76354481-76354503 CAGCCTGGGGATCAGCAGGCAGG - Intergenic
1160534459 18:79584787-79584809 CAGCCTGGGCAGAAGGGGCCGGG + Intergenic
1160698160 19:494481-494503 CAGCCTGGGCAGGAGGGGGATGG + Intronic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161064951 19:2233004-2233026 CAGCCAGGACAGGTGGAGGCTGG - Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161299996 19:3537926-3537948 CAGCCAGGGCTGGAGAAGGCAGG + Intronic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1161594370 19:5143750-5143772 GAGGCTGAGCAGCAGGAGGCTGG + Intronic
1161674692 19:5638831-5638853 CAGCTTGGGGAGGATGAGGCAGG - Intronic
1162095037 19:8305177-8305199 AAGCCTGGGAAGCTGGAGGCTGG + Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162109191 19:8390878-8390900 GGGCCTGGGCAAACGGAGGCGGG + Intronic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162478513 19:10915038-10915060 GAGCGTGGGCAGCAGCAGGCTGG + Intronic
1163101526 19:15100141-15100163 AAGCATGGGAGGAAGGAGGCAGG + Intergenic
1163288871 19:16365678-16365700 GAAGCTGGGCAGAAGCAGGCAGG - Intronic
1163519353 19:17782808-17782830 CACCCTGGGCTGAAGGAGGCAGG - Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163650363 19:18514118-18514140 CTGCCAGGTCAGATGGAGGCGGG + Intronic
1163677099 19:18660635-18660657 CAGCCTGGGCGGAGGTGGGCAGG - Intronic
1164201469 19:23022360-23022382 CAGCCTGGGGAAAAAGAGTCAGG + Intergenic
1164444820 19:28308061-28308083 TGGCCTGGGCAGGATGAGGCTGG - Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164788065 19:30952403-30952425 CAGCCTGGGCAAAAGAGGGAGGG - Intergenic
1165022601 19:32936426-32936448 GTTCCTGGGCAGAAGCAGGCAGG + Intronic
1165391272 19:35540333-35540355 CAGCCTGGTGGGCAGGAGGCTGG + Intronic
1165838848 19:38774831-38774853 AGGCCTGGGCAGAGGCAGGCTGG + Intergenic
1165840607 19:38787309-38787331 AGGCCTGGGCAGAGGCAGGCTGG - Intergenic
1166009148 19:39928182-39928204 CAGACTGGAGATAAGGAGGCGGG + Exonic
1166121634 19:40690500-40690522 CAGCCAGGGCCGCGGGAGGCGGG - Exonic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166332996 19:42089495-42089517 CGGCCAGGGCAGATGGAAGCGGG - Intronic
1166700958 19:44881344-44881366 TAGCTGGGGCAGAATGAGGCGGG - Intronic
1166709932 19:44930350-44930372 CAGCCTGGGCATACGCAGGGAGG + Intergenic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167074217 19:47239404-47239426 CAGCCTGGGGAGAGGGAGTTGGG + Intergenic
1167239141 19:48333152-48333174 CAGCCTGTCGTGAAGGAGGCGGG + Exonic
1167346221 19:48947125-48947147 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167959488 19:53094924-53094946 CAGCCTGGGCTGTGGGAAGCGGG - Intronic
1168102442 19:54148354-54148376 CAGCCTGGGCATAGGGAGCAGGG - Exonic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925058818 2:875649-875671 GAGCCTGGGTGGAATGAGGCTGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925617106 2:5754149-5754171 CAGCCTCGCAAGGAGGAGGCTGG + Intergenic
925656520 2:6155922-6155944 AATCCTGGGCAGAAGAAGGGGGG + Intergenic
925768123 2:7257582-7257604 CCCCCTGGGCTGAAGCAGGCAGG - Intergenic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
926356159 2:12042593-12042615 GAGCCTGGGCAAGAGGAGACGGG - Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
928325533 2:30316626-30316648 CACCATGAGCAGAAGTAGGCAGG - Intronic
928660071 2:33492946-33492968 AAGCCTGGGCAGAGCGAGCCAGG - Intronic
928668281 2:33573885-33573907 CAGCCTGGGCAGCAGGCTGGTGG + Intergenic
929684632 2:44023119-44023141 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
930800542 2:55438437-55438459 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
931346214 2:61449126-61449148 CAGCCTGGGCAACAGGAAGGAGG + Intronic
931516986 2:63055786-63055808 GAGCCTGGCGAGATGGAGGCCGG - Exonic
931589878 2:63871312-63871334 CAGCCTGGGCAGTAAGAGCAAGG - Intronic
932134339 2:69215085-69215107 CAGCCTGTGCAGCAGGATGGAGG - Intronic
932251217 2:70245950-70245972 CAGCCTGTGCAACAGGAGGGAGG - Intronic
932322031 2:70829398-70829420 CAGCCAGGGCTGTGGGAGGCAGG + Intergenic
932593900 2:73082604-73082626 CAGCCTTGGCAGACAAAGGCTGG - Intronic
932900647 2:75695850-75695872 CATCCTGGGCAGGATGAAGCAGG + Intronic
933163642 2:79053047-79053069 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934080557 2:88464115-88464137 AAGCCTGGGCAGGGGGTGGCCGG - Intergenic
935175851 2:100648192-100648214 TATTCTGGGCAGAAGCAGGCGGG + Intergenic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
935580590 2:104752837-104752859 CAGCTGTGGCAGAAGGTGGCCGG + Intergenic
936516601 2:113185215-113185237 CAGCCTGGGTGGGAGGAGGATGG + Intronic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
937167733 2:119836834-119836856 GGGCCGAGGCAGAAGGAGGCTGG - Intronic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
937288919 2:120770250-120770272 AGGCCTGGACAGGAGGAGGCTGG - Intronic
938107390 2:128542659-128542681 CAGCCCAGAAAGAAGGAGGCTGG - Intergenic
938180682 2:129179304-129179326 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
938380038 2:130831506-130831528 GAGCAGGGGCACAAGGAGGCAGG + Intergenic
939654393 2:144805393-144805415 CATACTGGGCAAAAGGTGGCAGG - Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
941905508 2:170714390-170714412 TGGCCTGGGGAGAAGGGGGCGGG + Exonic
941952693 2:171173414-171173436 CAGCCTGGGCAACAGGAGTTTGG - Intronic
943788321 2:191902609-191902631 CAGCTTGGGCAGCAGGAGTATGG - Intergenic
944571771 2:201052266-201052288 CAGCCTGGGCAACAGGAGGGGGG + Intronic
945858030 2:215091227-215091249 CAGCCTGGTGAGAAGCAGCCTGG - Intronic
946016245 2:216606547-216606569 CAGCCAGGGAAGCAGGAGGGAGG - Intergenic
946041769 2:216788849-216788871 CAGCCTGGGCAGCAGAGGGAGGG + Intergenic
946074928 2:217065840-217065862 CAGCCTGGAGAAGAGGAGGCTGG - Intergenic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
947732044 2:232436708-232436730 CAGCCTGGGCTGCAGGGGCCTGG + Intergenic
948033784 2:234841437-234841459 CAGCCTGGGCAACGGTAGGCTGG - Intergenic
948399742 2:237674966-237674988 GAGCCTGGGCAGTGGGAGGAGGG + Intronic
948468478 2:238163253-238163275 CAGCCTGCCCTGGAGGAGGCAGG + Intronic
948572698 2:238927470-238927492 CCGCCTAGGCAGCAGGATGCTGG + Intergenic
948635360 2:239331119-239331141 CAGCCTGCCCAGGAGGAAGCGGG + Intronic
948648486 2:239424318-239424340 CAGCCTGTGCAGACTGAGACAGG + Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948712972 2:239836663-239836685 GATCCTGGGCAGAAGGGGGTAGG + Intergenic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
948835527 2:240624349-240624371 CAGCCGGGGAAGCAGGAGGAAGG + Intronic
948903481 2:240967326-240967348 CATCCTGGGCAGAAGGACTGAGG - Intronic
1168953283 20:1817240-1817262 CAGCCTTGGCAGAAGGAGGTGGG + Intergenic
1169225175 20:3851924-3851946 CAGCCTGGGCAACAAGAGTCTGG + Intronic
1169426944 20:5504180-5504202 CAGCCAGCTCCGAAGGAGGCCGG + Intergenic
1170222050 20:13951485-13951507 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170793281 20:19525460-19525482 ACGGCTGGGGAGAAGGAGGCTGG + Intronic
1171462542 20:25307079-25307101 CGGCCAGGGCAGAAGGTGCCAGG - Intronic
1172676664 20:36677286-36677308 AGTCCTGGGCAGAAGGGGGCAGG + Intronic
1172751774 20:37256495-37256517 CATCCTGTGCGGAAGGAGTCAGG + Exonic
1173781586 20:45761076-45761098 CAGCCTGGGGAGGAGGAGAAAGG - Intronic
1173868248 20:46326558-46326580 CACCCAGGGCAAAAGGAGACTGG + Intergenic
1173884585 20:46446012-46446034 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174222990 20:48972200-48972222 CACCCTGGGCAGAAGAAGAGTGG - Intronic
1175149216 20:56919972-56919994 CAGCCTGGGCAACAAGAGGGCGG - Intergenic
1175169953 20:57073226-57073248 CACCCAGGGCAGAAGGAGGTGGG + Intergenic
1175935576 20:62512421-62512443 CAGCCTGGACAGGAGCAGACAGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175991473 20:62791939-62791961 CATCCAGGGCAGGAAGAGGCAGG + Intergenic
1176093612 20:63329676-63329698 CAGCCTTGGCAGATAGATGCAGG - Intronic
1176121118 20:63455023-63455045 CTGCCTGGGCAGGAGGGGGCGGG - Intronic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176305307 21:5120127-5120149 CTGCCTGCGCAGAGGGCGGCAGG - Intronic
1176389115 21:6154591-6154613 GAGCCAGGAAAGAAGGAGGCTGG - Intergenic
1176796294 21:13373019-13373041 CAGCCTGAGCTGTAGGAGGGTGG - Intergenic
1178001102 21:28162825-28162847 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1178035827 21:28581312-28581334 TACCCAGGGCAGAAGGAGTCTGG + Intergenic
1178035836 21:28581368-28581390 TACCCAGGGCAGAAGGAGTCTGG + Intergenic
1178035845 21:28581424-28581446 TACCCAGGGCAGAAGGAGTCTGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1178885267 21:36479914-36479936 GAGCCTGGGCAGGCGTAGGCTGG - Exonic
1178991224 21:37358336-37358358 CAGCAGGGGCAGAAGGGAGCTGG - Intergenic
1179126969 21:38599270-38599292 CAGCCCTGACAGAAAGAGGCTGG + Intronic
1179494584 21:41763792-41763814 CAGCCAGGGCTGAATGTGGCAGG + Intronic
1179657456 21:42853996-42854018 CAGGCAGGGCAGGAGGACGCAGG + Intronic
1179730025 21:43362490-43362512 CTGCCTGGGCGGGAGGAGGTGGG - Intergenic
1179734357 21:43383657-43383679 GAGCCAGGAAAGAAGGAGGCTGG + Intergenic
1179851748 21:44141904-44141926 CTGCCTGCGCAGAGGGCGGCAGG + Intronic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1180021272 21:45129115-45129137 CAGCCTCGGGAGACTGAGGCAGG + Intronic
1180052215 21:45336333-45336355 CAGCCTGGGCAGAGCGTGGTGGG + Intergenic
1180094985 21:45552292-45552314 CAGCCTGAGCAGCAGGGGTCAGG + Intergenic
1180247097 21:46555388-46555410 CAGCCTGGGCTGGATGGGGCTGG + Intronic
1180304931 22:11066525-11066547 CAGCCTGAGCGGTAGGAGGGTGG + Intergenic
1180703342 22:17793740-17793762 CAGCAAGGGCAGAAGGAGAGAGG + Intronic
1180831447 22:18908962-18908984 CTGCCTGGGCAGAAGGGGCCTGG - Intronic
1180856477 22:19049057-19049079 TAGCCAGGGCAAATGGAGGCCGG + Intronic
1180978759 22:19868785-19868807 TAGCCAGGGCAGAAAGAGGAAGG + Intergenic
1181068406 22:20317405-20317427 CTGCCTGGGCAGAAGGGGCCTGG + Intronic
1181458635 22:23073376-23073398 CGGCCTGGGCAGAATGAAGAGGG + Intronic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1181945677 22:26515605-26515627 CTCCTTGGGCAGAAGGAGTCTGG + Intergenic
1182056259 22:27357650-27357672 CAGCCTGAGCAGAATAAGACAGG + Intergenic
1182113862 22:27743661-27743683 CAGCCTGGCGAGGAGCAGGCTGG - Intergenic
1182426046 22:30273368-30273390 CCGCCAGGGCAGACGAAGGCAGG + Intergenic
1182434502 22:30321684-30321706 CAGACTGGGCGGACTGAGGCTGG + Intronic
1182522451 22:30892100-30892122 AAGCCTGGGGAGATGGAGGTGGG + Intronic
1183231492 22:36584929-36584951 GAGCTTAGGCTGAAGGAGGCGGG - Intronic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183322828 22:37175685-37175707 CTGCCTGGGAAGGAGGAGACAGG - Intergenic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1184301457 22:43563159-43563181 CAGCCTAGGCTGGAAGAGGCGGG + Intronic
1184324772 22:43774774-43774796 CAGCCTGGGCAAAAGGGGGATGG + Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184606663 22:45578371-45578393 CAGCTAGCGCAGGAGGAGGCTGG - Intronic
1184715618 22:46280200-46280222 GAGCCAGGGCAGGAGCAGGCAGG + Intronic
1184779491 22:46639867-46639889 CAGCTTGGGCAGAGAGGGGCTGG + Intronic
1185058191 22:48592035-48592057 CTGCCTGGACGGCAGGAGGCGGG + Intronic
1185068643 22:48644441-48644463 CACCATGGGCAGAAGGAGCTGGG + Intronic
1185294324 22:50045897-50045919 CAGCGTGGGAAGAAGGAGTCGGG + Exonic
1203281531 22_KI270734v1_random:134233-134255 CTGCCTGGGCAGAAGGGGCCTGG - Intergenic
949111488 3:266383-266405 CAACCTGGTTAGAAGGGGGCTGG + Intronic
950163073 3:10774456-10774478 AGGGCTGGGGAGAAGGAGGCAGG + Intergenic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950415938 3:12869116-12869138 CAGCCTGGGCAAAGAGAGCCCGG - Intronic
950417386 3:12876231-12876253 CAGCCTGGGCAAAGAGAGCCCGG - Intergenic
950503164 3:13377129-13377151 CAGCTTGGGGAAAAGGGGGCGGG + Intronic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
950701608 3:14754140-14754162 AAGCCTGGGAAGAAAGAGGGTGG - Intronic
950791199 3:15473824-15473846 CACCCTGGGGAGAGGGTGGCAGG - Intronic
950926413 3:16745992-16746014 CAGCCTGGCGAGAAGCAGCCTGG - Intergenic
951508952 3:23480200-23480222 GAGCCTGTGCAGCAGGGGGCTGG + Intronic
951562480 3:23982283-23982305 GTTCCTGGGCAGAAGGAGGCGGG - Intergenic
952509841 3:34042003-34042025 CAGCCTGTGCTGATTGAGGCAGG + Intergenic
952761376 3:36917437-36917459 CAGCAGGGGAAGGAGGAGGCAGG + Intronic
952821812 3:37492353-37492375 CAGCTTGGGAAGGCGGAGGCTGG + Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953040834 3:39253548-39253570 TTTCCTGGGCAGGAGGAGGCAGG + Intergenic
953137696 3:40197314-40197336 CAGCCTGTGCAGCAGGAGGTGGG - Intronic
953151492 3:40329217-40329239 CAGCCTTTGCATAAGGAGACTGG + Intergenic
953193873 3:40713921-40713943 CAGGCTGGGCAGAAAGTGGCTGG - Intergenic
953683733 3:45060025-45060047 CACACCGGGCAGCAGGAGGCTGG + Intergenic
953834560 3:46331489-46331511 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
953913958 3:46906304-46906326 CAGCCTGGGCTGAGGGAGACAGG - Intergenic
954144703 3:48628817-48628839 CAGCCTGGGGAGCAGAGGGCTGG - Intronic
954414823 3:50388154-50388176 CAGGCGGGGCAGACGCAGGCGGG - Intronic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
954649939 3:52154815-52154837 CAGCCTGGGCAACAAGAGGGCGG + Intergenic
954681417 3:52348000-52348022 CAGCCAGGGCAGCAGGTGCCTGG - Intronic
954748551 3:52800803-52800825 GAGCCCTGGCAGAGGGAGGCAGG - Intronic
954760521 3:52870576-52870598 CACCCTGGGCAGAGGATGGCAGG - Intronic
954781654 3:53066372-53066394 CAGCCTTGGCAGGTGGAGGCAGG + Intronic
954806542 3:53224122-53224144 GAGCCTGGGCAGCAGGCGCCGGG - Intergenic
955596121 3:60592588-60592610 CTGCCTGGGCAGCAGGATGGAGG + Intronic
955797874 3:62656587-62656609 CATCCTGGTCAGCAGAAGGCTGG + Intronic
955943351 3:64167646-64167668 CTGCCTGGGCAGAAAGATGGAGG + Intronic
956176966 3:66482090-66482112 CAGCCTGGGCACAGGCAGGCTGG + Intronic
956436465 3:69238862-69238884 CAGCCTGGGCAGAGAGTGGTAGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956624322 3:71251949-71251971 CAGCTTGGGGAGTAGGAGGTGGG - Intronic
956663222 3:71619291-71619313 CACCATGGCCAGAAGGATGCCGG - Intergenic
957426996 3:80051677-80051699 GCTCCTGGGCAGAAGGAGGCTGG + Intergenic
958119787 3:89270348-89270370 AAGTCCTGGCAGAAGGAGGCTGG - Intronic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
959573621 3:107910964-107910986 CAACCTGGGAGGAAGGGGGCGGG - Intergenic
959972347 3:112421597-112421619 CAGCCTGGCGAGGAGCAGGCTGG + Intergenic
960050774 3:113237408-113237430 GAGGCTGGGTAGAAGAAGGCAGG - Intronic
960634257 3:119768189-119768211 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
960947289 3:122975313-122975335 CAGCCTTGGCAGAGGAAGGAAGG + Intronic
961018247 3:123483378-123483400 CAGCCTGGGCTCCAGGAGGTGGG + Intergenic
961317912 3:126052943-126052965 AAGCCTGGGCGGAAGACGGCGGG + Intronic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961389893 3:126546191-126546213 TGGCCTGGGCACAAGAAGGCTGG + Intronic
961635574 3:128330700-128330722 CAGCCTGGGCACAAGGGGGCAGG + Intronic
961685834 3:128630116-128630138 CATCCTGGGCAGCAGCAGGAAGG + Exonic
962044544 3:131741767-131741789 CAGCCTCTGCAGTAGGAGGCTGG - Intronic
962368003 3:134798324-134798346 CTGCCTGGGTGGAAGGAGGGAGG + Intronic
962394299 3:135001393-135001415 CAGCCCTGGGAGATGGAGGCAGG - Intronic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963468520 3:145712024-145712046 CAGCCTGGGGAGGAGGGGGGAGG - Intergenic
963894128 3:150667250-150667272 CAGCCTGGGATGAAGGAGTCTGG + Intronic
964006801 3:151839578-151839600 CAGCCTGGGCTGAGAGAGGGAGG + Intergenic
964634910 3:158847968-158847990 GGGCCTGGCCAGAAGGAGACAGG - Intergenic
965542033 3:169880222-169880244 ATTCCTGGGCAGAAGGGGGCAGG + Intergenic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
966764403 3:183447365-183447387 CACCCAGGGCCTAAGGAGGCTGG + Intergenic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
967005465 3:185378605-185378627 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968413415 4:407930-407952 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
968446666 4:655568-655590 CAGCCTGGGGAGGAGGAAGAAGG + Intronic
968464146 4:742117-742139 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464167 4:742181-742203 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464187 4:742241-742263 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968547506 4:1206401-1206423 CTGCCAGGGCAGGGGGAGGCCGG + Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968588923 4:1448217-1448239 CTGCCAGGACAGAAGGAGGGTGG + Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969106698 4:4811856-4811878 GAGCTGGGGCAGGAGGAGGCTGG - Intergenic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
970512289 4:16793307-16793329 TAACCAGGGCAGAATGAGGCTGG + Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971444191 4:26724850-26724872 AAGCCTGGGAAGAAAGAGGCTGG - Intronic
971834664 4:31748130-31748152 GTTCCTGGGCAGAAAGAGGCAGG - Intergenic
972671132 4:41214695-41214717 GGGGCCGGGCAGAAGGAGGCGGG + Intronic
973216058 4:47670667-47670689 CAGCATGGGCACAGGGAGGCAGG + Intronic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
974628879 4:64457752-64457774 GATCCTGGGCAGAAAGAGTCAGG + Intergenic
975151972 4:71032846-71032868 CAGCCTGGGTAGAAGGGGAGAGG - Intergenic
975152028 4:71033160-71033182 CAGCCTGGGTAGAAGGGGAGAGG - Intergenic
975307200 4:72864029-72864051 CATCCTAGACAGAAAGAGGCAGG + Intergenic
975317509 4:72971713-72971735 CATCCTGGGCAGGATGAAGCAGG - Intergenic
975695416 4:77008074-77008096 CAGGCTAGCTAGAAGGAGGCAGG + Intronic
976547844 4:86358458-86358480 CAACATGGCCAGAAGCAGGCAGG + Intronic
976700770 4:87966595-87966617 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
976759529 4:88533244-88533266 CAGCGTGGGCAGAATAAAGCAGG - Intronic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
977639118 4:99335061-99335083 TAGCCTGGGAGGAAGGAGGGTGG + Intergenic
979721168 4:123902118-123902140 CAGCCTGGGGAGGATGAAGCTGG - Intergenic
980405856 4:132353524-132353546 CAGGCTGGGCAACAGTAGGCAGG + Intergenic
981559577 4:146032682-146032704 TGGCCGGGGCAGCAGGAGGCGGG - Intergenic
983583343 4:169330449-169330471 AATCCTGGGCAGAGAGAGGCAGG - Intergenic
984364200 4:178777245-178777267 CACCATGGGCAGAGTGAGGCAGG + Intergenic
984456958 4:179981972-179981994 CAGCCTGGGGTGAAGGAGAGAGG + Intergenic
984644620 4:182206228-182206250 TAGCCTGGGCATGAGGAGCCAGG - Intronic
984749886 4:183262054-183262076 TAACCTGGCCAGAAGGTGGCAGG - Intronic
985127966 4:186714139-186714161 CAGCCAGGGCAGAAGCTGGAGGG + Intronic
985279034 4:188269045-188269067 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279050 4:188269095-188269117 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279066 4:188269145-188269167 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279082 4:188269195-188269217 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279098 4:188269245-188269267 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279114 4:188269295-188269317 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279130 4:188269345-188269367 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279146 4:188269395-188269417 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279162 4:188269445-188269467 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279178 4:188269495-188269517 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279194 4:188269545-188269567 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279210 4:188269595-188269617 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279226 4:188269645-188269667 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279242 4:188269695-188269717 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279258 4:188269745-188269767 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985280312 4:188280014-188280036 AAGTCTGGGCAGGAGGAAGCGGG + Intergenic
985285753 4:188335131-188335153 CAGCCTGGAGAGCAGGAGGGAGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985631981 5:1018597-1018619 CACCCTGGGGACAAGGGGGCTGG - Intronic
985802157 5:2011704-2011726 CAGCCAGGGCTGCAGGAGGAGGG - Intergenic
985827663 5:2204945-2204967 GGGCCTGGGTAGAAGGAGGGAGG + Intergenic
985884043 5:2662515-2662537 GAGCCTGGTCAGAACCAGGCAGG - Intergenic
985948484 5:3204723-3204745 CCACCAGGGCAGAAAGAGGCTGG + Intergenic
986180006 5:5384458-5384480 TGGCCTGGCCAGAAGGAGGCAGG + Intergenic
986468845 5:8053413-8053435 CATCCAGGGCAGGAGGAGGGCGG - Intergenic
986503886 5:8429808-8429830 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
987065355 5:14284912-14284934 CAGCCTAAGCAGGAAGAGGCAGG - Intronic
987383343 5:17306621-17306643 CAGTCTGGGCAGGAGGCAGCAGG - Intergenic
988079795 5:26401160-26401182 CAGGCTGGGCAAGAGAAGGCAGG + Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
990628046 5:57636328-57636350 TAGGATGGGCAGAAGGACGCAGG + Intergenic
990923504 5:60993979-60994001 TAGCCTGGGCAGAAGGGAGCAGG - Intronic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
991673937 5:69074510-69074532 CTGGCTGGGCAGAAGGATCCCGG - Intergenic
991676607 5:69094461-69094483 CAGCCTGCGCGCAGGGAGGCAGG - Intronic
991946174 5:71900409-71900431 CAGGCTGGGGAAAAGAAGGCAGG - Intergenic
992452152 5:76884812-76884834 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
994449969 5:99929536-99929558 TCTCCTGGGCAGAAGGGGGCAGG - Intergenic
995125299 5:108572874-108572896 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
995562258 5:113395604-113395626 CAGCCTGGGGGGAAAGAGGGAGG - Intronic
996178484 5:120389300-120389322 CAGCCTGGGCAACAGGAGCGAGG + Intergenic
996329395 5:122312180-122312202 CAGCCTCAGCCGAAGTAGGCGGG - Exonic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
997475658 5:134140916-134140938 AAGCCTGGGCAACAGGAAGCAGG - Intronic
997512056 5:134460760-134460782 CACTCTGGGCAGAAGGGGCCTGG - Intergenic
997834482 5:137181211-137181233 CAGCATGGGCAAACAGAGGCAGG + Intronic
998133127 5:139661012-139661034 CAGCCTGGGCCGAGGGGGCCAGG + Intronic
998377777 5:141702527-141702549 CCGCGTGGGCGGAAGGAGTCTGG - Intergenic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
999127754 5:149259014-149259036 AATCCAGGGCAGAAGGAGGAGGG - Exonic
999257049 5:150215594-150215616 CAGCCTGGGGAGAAAGAGGCTGG + Intronic
999907994 5:156164526-156164548 CAGCATGGGCAGGAGCAGACTGG - Intronic
1000091481 5:157933062-157933084 TAGAGTGGGCAGCAGGAGGCTGG + Intergenic
1000195616 5:158954705-158954727 CATCTTGGGCAGAGTGAGGCTGG - Intronic
1000606836 5:163335683-163335705 CGGCCTGGCAAGAAGGAGCCTGG - Intergenic
1001141118 5:169144788-169144810 CAACCTGGGCAGAAAAAGACGGG + Intronic
1001581720 5:172803103-172803125 CAGCCTGGGGACATGGAGGGAGG + Intergenic
1001710218 5:173772417-173772439 CAGCCGGGGCAGAAGGCAGGAGG - Intergenic
1001820401 5:174705644-174705666 CCTCCAGGGAAGAAGGAGGCTGG + Intergenic
1002168650 5:177363092-177363114 CAGCCGGGGGAGGAGGAGCCCGG + Intronic
1002638775 5:180620716-180620738 CTGCGTGGGCAGAAAGGGGCCGG + Intronic
1002741994 5:181440698-181440720 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003869342 6:10389952-10389974 CCGCCAGGGCCGAGGGAGGCGGG + Intergenic
1004178153 6:13358774-13358796 TTGCCTGGGCAGATGTAGGCAGG - Exonic
1005081209 6:21958427-21958449 CAGCCTGGGCAAAATGAGACAGG - Intergenic
1006030013 6:31171513-31171535 CAGGCTGGGCAGATGGTGCCAGG - Intronic
1006225853 6:32535530-32535552 TCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1006397965 6:33799285-33799307 CACCCTGGGCAGATGGAGACAGG - Intronic
1006489975 6:34378939-34378961 CAGACTGGGCAGAAGAGGCCAGG - Intronic
1006500898 6:34458149-34458171 AGGCCTGGGCAGAAGGGGGCAGG + Intergenic
1006613942 6:35312195-35312217 GAGCCTGGGCAGAGGGAAACAGG - Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG + Intergenic
1007387358 6:41528830-41528852 CAGCCTGGTGAGAGGGATGCGGG + Intergenic
1007576031 6:42925649-42925671 CAGCCTGCAGAGGAGGAGGCAGG - Exonic
1007702813 6:43774354-43774376 CACCCATGGCAGAAGGAGGAGGG + Exonic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1009450160 6:63791010-63791032 CAGCCTGGTCAGGAGGAGATAGG + Intronic
1010515549 6:76769233-76769255 CAGCCTGGGCAAACAGGGGCTGG + Intergenic
1012408187 6:98924843-98924865 CTGCCAGTGCAGGAGGAGGCGGG - Intronic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1013353145 6:109323992-109324014 CAGCTGGGGCAGGAGCAGGCTGG + Intergenic
1013355327 6:109341364-109341386 GAGCCTGGGCCGCTGGAGGCTGG + Intergenic
1013768145 6:113597047-113597069 CAGGCAGGCCGGAAGGAGGCTGG + Intergenic
1014115449 6:117663774-117663796 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1015393240 6:132707195-132707217 CAGCCTGGGCAACAAGAGGGAGG + Intronic
1015496582 6:133889559-133889581 CGGCCTGGGCAAGAGGAGGAAGG + Exonic
1015737335 6:136414841-136414863 CAGCCTGGGCAGCAAGAGCAAGG - Intronic
1015947221 6:138515082-138515104 CATCCTGGGCAGGATGGGGCAGG + Intronic
1016238962 6:141905599-141905621 CAGCCTGGGCAGAGAGAGACTGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016984782 6:149887079-149887101 CTGTCTGGGCAGGAGCAGGCAGG - Intronic
1017151018 6:151280673-151280695 CAGCCTGGGCAACAAGAGGAAGG - Intronic
1017563413 6:155658159-155658181 CAGCCTTGATAGAAGGAGGGTGG + Intergenic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1017815353 6:158012246-158012268 CAGCCTGGGAAGGAGGATGTGGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018813475 6:167314449-167314471 CAGCCTGAGGCGAAGTAGGCAGG - Intronic
1018836430 6:167487724-167487746 CAGCAGGGGAAGAAGGAGCCTGG - Intergenic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1018978543 6:168583684-168583706 CAGCATGGCCAGCAGGAGGTTGG - Intronic
1018987655 6:168649830-168649852 CACCCTGGGCATAAGGACACGGG + Intronic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1019127237 6:169848932-169848954 CTTCTTGGGCAGAATGAGGCTGG + Intergenic
1019247131 6:170716436-170716458 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1019284896 7:218521-218543 AAGCCTGGTCAGAGGGAGGGCGG + Intronic
1019522890 7:1468562-1468584 CAGCCTGGCCCTCAGGAGGCTGG + Intergenic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019937842 7:4268014-4268036 CAGCCTAGGAAGATGGAGGTTGG + Exonic
1019993484 7:4708358-4708380 CAGCCCTGGATGAAGGAGGCCGG - Intronic
1020794115 7:12661230-12661252 CAGCCTGGCCAGGAGCAGCCTGG - Intergenic
1020914153 7:14170986-14171008 AAGTCTGGGCAGTAGGAGACAGG + Intronic
1021605193 7:22402962-22402984 AGGCCTGGGGTGAAGGAGGCGGG - Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021897659 7:25252344-25252366 CAGCCTGGGCAAAAGAAACCTGG + Intergenic
1022113635 7:27245661-27245683 CCACCTGGGCAGAAGGAAGGAGG + Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1023626371 7:42119020-42119042 CAGCCAGGGCTGTAGGAGGCAGG + Intronic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1023727902 7:43163444-43163466 AAGACTGGGGAGATGGAGGCAGG + Intronic
1024972711 7:55085384-55085406 CAGCATGGGGAGCAGGATGCTGG + Intronic
1025078735 7:55964677-55964699 GAGCCTGGGCAGGAGGCTGCAGG - Exonic
1025172443 7:56771815-56771837 CAGCTTGGGCAGAAGAAGCCAGG + Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026844923 7:73693437-73693459 CTGCCTGGGCTGCAGGAGGGAGG + Intronic
1026850285 7:73719470-73719492 CAGCCAGGGCTGAAGGGAGCGGG - Intronic
1026850732 7:73721680-73721702 CACACTGGGCAGCAGGGGGCTGG - Intergenic
1026878473 7:73893523-73893545 CAGCCCCCGCAGGAGGAGGCTGG + Intergenic
1026923729 7:74174525-74174547 CAGCCGGGGCGGCGGGAGGCGGG + Intronic
1026944341 7:74306467-74306489 CATCCTGGGGCGAGGGAGGCAGG - Intronic
1028378920 7:90176578-90176600 GAGGCAGGGCAGAAAGAGGCAGG - Intronic
1028382164 7:90211832-90211854 CAGCCAGGGGAGAAGGAAGGAGG - Exonic
1029256394 7:99272540-99272562 CAGCCTGGGCAACAGGAGATAGG + Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032154483 7:129456739-129456761 CAACCTGGGCAGGATGAGCCGGG - Intronic
1032164716 7:129536586-129536608 AAGCCTGGGCAGGATGAGTCAGG + Intergenic
1032535105 7:132656640-132656662 CAGCCTGGCTAGAAGAAAGCAGG + Intronic
1032536265 7:132667152-132667174 GAGCCTGGGGAGAAGGAGACAGG + Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1033084613 7:138330651-138330673 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1033276159 7:139973030-139973052 CTGCGTGGGGAGATGGAGGCAGG + Intronic
1033361358 7:140640778-140640800 GAGCCACGGCAGGAGGAGGCAGG - Intronic
1033460315 7:141541608-141541630 GAGCCCAGGGAGAAGGAGGCAGG - Intergenic
1034509319 7:151520813-151520835 CAGCCTGGGCAGAATAGGGGCGG - Intergenic
1034879709 7:154753762-154753784 CAGCCTAGACGGAAGGCGGCTGG - Intronic
1034940810 7:155229000-155229022 CAGCTTGAGCAGAATGAGACTGG - Intergenic
1034994536 7:155569807-155569829 CTGCCTGGGCAGTTCGAGGCTGG - Intergenic
1035004419 7:155644629-155644651 CACCCTGGGATGATGGAGGCCGG - Intronic
1035049999 7:155993266-155993288 CAGCAGGGGCTGATGGAGGCAGG - Intergenic
1035061100 7:156070297-156070319 CAGCATGGCCAGAACGAAGCAGG - Intergenic
1035319234 7:158017757-158017779 CAGCAGGGACAGAAGGACGCAGG + Intronic
1035501006 8:91498-91520 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
1035715923 8:1754877-1754899 CTGCCTGCCCAGAAGCAGGCCGG + Intergenic
1035762640 8:2080889-2080911 CAGCCCGTGCAGAATGAGGTTGG + Intronic
1036686311 8:10913955-10913977 CAGCCTGGGGTGCAAGAGGCTGG + Intronic
1036749047 8:11431734-11431756 CAGCCTGGACAGTTGGAGGGTGG + Intronic
1038567823 8:28634548-28634570 CAGGATGGGCAGAAAGAGCCAGG - Intronic
1040896057 8:52369512-52369534 CTGTCTGGGCATAAGTAGGCTGG - Intronic
1040954215 8:52963207-52963229 CAGCCTGGGCAGACAAAGACAGG - Intergenic
1041274397 8:56142422-56142444 GCTCCTGGGCGGAAGGAGGCAGG + Intergenic
1041917644 8:63152392-63152414 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1042004906 8:64169382-64169404 TTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1042337070 8:67640223-67640245 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1043735033 8:83731000-83731022 GCCCCTGGGCAGAAGGAGGTGGG - Intergenic
1044286072 8:90413360-90413382 CAGCCTGTGCAGAAGGCAGATGG - Intergenic
1044727886 8:95207964-95207986 AGGCCTGGGCAGGAGGAGACTGG + Intergenic
1044737821 8:95297235-95297257 CAACCATGGCAGAAGGAGGAAGG + Intergenic
1045060871 8:98409821-98409843 CAGCCTGGCCAGAAGGCATCTGG - Intronic
1045521261 8:102905067-102905089 CAGCCATGGCAGAAGATGGCTGG + Intronic
1045649442 8:104328529-104328551 CAGGTTGGGCAGAAAGAGGGAGG + Intergenic
1046395297 8:113632869-113632891 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1047298870 8:123596002-123596024 CAGCCAGTGAAGAAGGAGGAGGG + Intergenic
1047615940 8:126562571-126562593 CATCCCAGGCAGATGGAGGCTGG + Intergenic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1047762295 8:127963181-127963203 CAGCCTGGGCAGGGGCAGGAAGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048498227 8:134953377-134953399 CAGCCTGTGGAGATTGAGGCTGG - Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1048644173 8:136399647-136399669 CAGCATGGCCAGAAGAAAGCAGG + Intergenic
1048888022 8:138924309-138924331 CAGGCTGGGCAGACCCAGGCTGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049164149 8:141116325-141116347 CAGCAGTGGCACAAGGAGGCTGG + Intergenic
1049275540 8:141718355-141718377 CAGGCAGGGCAGGAGGAGCCTGG - Intergenic
1049592184 8:143467771-143467793 CTGCCTGGGCAGAGGGCGGGAGG - Intronic
1049606257 8:143530507-143530529 CAGCCTGGGCACAGGGTGGTGGG + Intronic
1049610743 8:143553638-143553660 CAGCCTGGGAGGAGGGAGGGAGG - Exonic
1049795584 8:144495993-144496015 CAGTCAGGACAGGAGGAGGCGGG + Intronic
1050106355 9:2170342-2170364 CAGCCTAGGAAGAAGGAGCCGGG + Intronic
1050140373 9:2511044-2511066 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1050377041 9:4984722-4984744 CAGCCTGCACTGGAGGAGGCCGG - Intergenic
1050474066 9:6021605-6021627 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1050527446 9:6558285-6558307 AAGATTGGGCAGAAAGAGGCAGG + Intronic
1051596727 9:18831398-18831420 CAGCCTGGTCACAAGCAGGGTGG + Intronic
1052633590 9:31071757-31071779 ATTCCTGGGCAGAAGGAGGCAGG - Intergenic
1052707541 9:32011063-32011085 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1054760902 9:69003133-69003155 TAACGTGGGCAGAGGGAGGCGGG + Intronic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1055766330 9:79667332-79667354 CAGCCTGGCGAGAAGGAGAAGGG - Intronic
1055907841 9:81314567-81314589 CAGCGTGGCTAGAAGGAAGCAGG + Intergenic
1055934714 9:81593948-81593970 CAGGCTGGGCTAAAGGAGACCGG - Intronic
1056262389 9:84862062-84862084 CAGCCTGGCCAGATGGGGCCTGG + Intronic
1056809710 9:89754762-89754784 CGGCCTGGTGAGAAGGAGGTGGG - Intergenic
1056825643 9:89874658-89874680 AGACCTGGGCAGAAGGAAGCAGG - Intergenic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057551522 9:96054106-96054128 CTTCCAGGGCAGAAGGGGGCTGG + Intergenic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1057995834 9:99821355-99821377 CAGCCGGTGCAGAAGGCGTCTGG - Intergenic
1058419414 9:104820066-104820088 CAGCCTGGGGACAGGGAGGCAGG + Exonic
1059347239 9:113637316-113637338 CGGCCAGGGCAGAAGGAAGAGGG - Intergenic
1059393909 9:114018396-114018418 CAGCCTGGGCACCAGGGAGCAGG - Intronic
1059453528 9:114385872-114385894 CAGGCTGGGCATCAGGAGACAGG + Intronic
1059541165 9:115131967-115131989 CAGCCTAGACAGAAGGTGGGTGG - Intergenic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059679467 9:116572195-116572217 CAGCCTGGGGAGGAGAAGGCAGG - Intronic
1060198198 9:121636601-121636623 AAGTCTGGGCAGGAGGTGGCTGG + Intronic
1060297736 9:122354787-122354809 CAGCAGGGCCAGCAGGAGGCTGG + Intergenic
1060524568 9:124313243-124313265 GAGCCTGGGCAGAGGAGGGCCGG + Intronic
1060933688 9:127504179-127504201 CAGCGTCCGCAGAAGCAGGCAGG + Intergenic
1061267336 9:129514424-129514446 CTTCCTGGGCAGAAGGGGGTGGG + Intergenic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061500837 9:131000997-131001019 GAGCCTGGGAGGAAGGATGCTGG + Intergenic
1061623660 9:131827769-131827791 CAGCCTGGGGAGCAGGAGCGGGG + Intergenic
1061702369 9:132425413-132425435 CAGCATGGGGATAAGGAGGGGGG - Intronic
1061730368 9:132609371-132609393 CAGCTGGGGCAGGAGGCGGCAGG + Intronic
1061888204 9:133603730-133603752 CACCCTGGGCTGGAGCAGGCAGG - Intergenic
1062024536 9:134334190-134334212 AAGCCTGGGAAAAAAGAGGCTGG - Intronic
1062046137 9:134425439-134425461 CAGCCTGGGATGAAGGGGGCAGG - Intronic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062368243 9:136222368-136222390 CAGCCTGAGCAGAACCAGACAGG - Intronic
1062400008 9:136368281-136368303 CAGTCTGGGCAGAAGGGGTTAGG - Intronic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062573968 9:137198037-137198059 CAGCCTGGGGAAACTGAGGCTGG + Intronic
1062676925 9:137752163-137752185 CAGCCAGGGCTGGAGCAGGCCGG + Intronic
1203607906 Un_KI270748v1:71914-71936 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1185588102 X:1255501-1255523 CAGCCTGGGCAACAAGAGGGAGG - Intergenic
1185616558 X:1425433-1425455 GAGCCTGGGCAGAGCGAGGAAGG - Intronic
1186417588 X:9397356-9397378 CAGCCTGGGCAGCAGAAGGAGGG - Intergenic
1187110294 X:16291810-16291832 CAACCTTGGGAGAAGGAGGAAGG - Intergenic
1187690032 X:21856970-21856992 CAGCCTGGGCACGAGGAAGTGGG + Exonic
1187766736 X:22650880-22650902 AAGCCTGGGCACTTGGAGGCTGG - Intergenic
1187859092 X:23664732-23664754 CTCCCTCAGCAGAAGGAGGCTGG + Intronic
1189187618 X:39067675-39067697 CAGCCTGGGCTCTAGGAGACTGG - Intergenic
1189446599 X:41086064-41086086 CAACCAGGGCACACGGAGGCGGG - Exonic
1189726351 X:43970888-43970910 CAGCCTGGGTAGAAGAATCCCGG - Intronic
1190339155 X:49282693-49282715 CAGCAGGGGCAGAACGAGGGAGG + Intronic
1190584266 X:51922436-51922458 CAGACTGGTCAGAAAGAAGCTGG + Intergenic
1192535503 X:71923704-71923726 CAGCCTGGGCATCTGGAGGGTGG - Intergenic
1193526587 X:82598265-82598287 CAGCCTGGGTTTAAGGAGGGAGG - Intergenic
1193536957 X:82728174-82728196 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1193655087 X:84188343-84188365 CAGCTTGGGGTGAAGGGGGCGGG + Intergenic
1195060757 X:101191639-101191661 CTGCCCGGGCGGGAGGAGGCGGG + Intergenic
1196210618 X:112991906-112991928 CTGCTTTGGCAGAAGGATGCAGG + Intergenic
1198965823 X:142228168-142228190 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1199040624 X:143111364-143111386 CAGGCTGGGCAAGAGAAGGCAGG - Intergenic
1199861130 X:151801279-151801301 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1200163736 X:154022207-154022229 CACCCTGTGCAGAAGGGAGCTGG - Intronic
1200749447 Y:6931285-6931307 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1201382177 Y:13393032-13393054 CAGCCTGGGCATAGTGAGACTGG - Intronic
1202368493 Y:24182574-24182596 CATACTGGACAGAAGGGGGCAGG + Intergenic