ID: 1183317258

View in Genome Browser
Species Human (GRCh38)
Location 22:37143514-37143536
Sequence GACTCACCGTCTGTCCGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183317252_1183317258 7 Left 1183317252 22:37143484-37143506 CCATCCTAAGATTCTGCAGTGTG 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
1183317254_1183317258 3 Left 1183317254 22:37143488-37143510 CCTAAGATTCTGCAGTGTGGCCA 0: 1
1: 0
2: 2
3: 25
4: 210
Right 1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
1183317249_1183317258 25 Left 1183317249 22:37143466-37143488 CCAGAATATGAGATCCCACCATC 0: 1
1: 0
2: 1
3: 2
4: 89
Right 1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
1183317251_1183317258 10 Left 1183317251 22:37143481-37143503 CCACCATCCTAAGATTCTGCAGT 0: 1
1: 0
2: 1
3: 11
4: 174
Right 1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
1183317250_1183317258 11 Left 1183317250 22:37143480-37143502 CCCACCATCCTAAGATTCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183317258 Original CRISPR GACTCACCGTCTGTCCGGCC AGG Exonic
903155587 1:21440363-21440385 GATTCACCGCCCGTCCAGCCTGG - Intronic
905181172 1:36167812-36167834 GACTCACTGACTGTCTTGCCTGG + Intronic
906119846 1:43382160-43382182 GACTCAGCCTCCGTCCTGCCTGG + Intergenic
908808759 1:67957916-67957938 GACTCTCAGCCTGTCCAGCCTGG - Intergenic
914086813 1:144461374-144461396 GACTCACCGCCCGCCCGGCCTGG + Intronic
914192714 1:145425316-145425338 GACTCACCGCCCGCCCGGCCTGG + Intergenic
914361402 1:146938997-146939019 GACTCACCTGCCGCCCGGCCTGG - Intronic
914491206 1:148151713-148151735 GACTCACCTCCCGCCCGGCCTGG + Exonic
914590620 1:149103264-149103286 GACTCACCGCCCGCCCGGCCTGG + Intronic
920543009 1:206793438-206793460 GATTCCCCGACTGTGCGGCCTGG + Intergenic
922934207 1:229411264-229411286 GACTCACCGTGTGGCAGGCGTGG + Intergenic
1063988400 10:11533351-11533373 GACTGACCTTCTGCCCTGCCAGG + Intronic
1075816783 10:125270966-125270988 CACTCACCGTCTCTCAGGCCTGG - Intergenic
1076253563 10:129001893-129001915 GGCTCAGTGTCTGTCCTGCCAGG - Intergenic
1076706464 10:132304777-132304799 GCCTCACTGCCTGCCCGGCCCGG + Intronic
1079128952 11:17736477-17736499 GACTCCCCGGATGGCCGGCCTGG + Exonic
1083899870 11:65638405-65638427 CACTCACCGGCTGGCTGGCCAGG - Intronic
1092232479 12:6783950-6783972 GACCCATTGTGTGTCCGGCCTGG + Intergenic
1094332054 12:29304380-29304402 GACTCACTGTCTGTCCAGTGGGG + Intronic
1097768342 12:63551502-63551524 GACTCACAGTCTTACCTGCCTGG + Intergenic
1097784705 12:63746565-63746587 GACTCACAGTCTCACCTGCCTGG + Intergenic
1106756814 13:32829954-32829976 GACTCACTGTGTGTCCTGCAGGG - Intergenic
1106956278 13:34942482-34942504 CTCTCCCGGTCTGTCCGGCCCGG - Exonic
1113905994 13:113819484-113819506 GACGCACAGCCTGTCCTGCCCGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121795390 14:96730557-96730579 GCCTCCTCGTCTGTCCAGCCAGG - Intergenic
1129171779 15:73812351-73812373 GACCCAGGGTCTATCCGGCCTGG + Intergenic
1132145339 15:99426006-99426028 GGCTCTCCGTCTGTACAGCCGGG + Intergenic
1133600582 16:7336411-7336433 GACTCATCATCTGTCAGACCTGG - Intronic
1137457490 16:48629221-48629243 GACTCACAGTCTGTCCAGTCAGG - Intergenic
1142094245 16:88231088-88231110 GAGCCACCGTCTCTCCAGCCCGG - Intergenic
1146967691 17:37046838-37046860 GTCTCACCTTCTGTGCGGCTGGG + Intronic
1147552503 17:41454057-41454079 GGCTCACAGTCAGTCCAGCCTGG - Intergenic
1147647195 17:42040816-42040838 GGCTCAGGATCTGTCCGGCCAGG + Intronic
1147845672 17:43402469-43402491 AACTGACCCTCTGTCCTGCCAGG + Intergenic
1148079539 17:44960116-44960138 GAGTCATCGTCTGCCCCGCCCGG + Exonic
1152531878 17:80923563-80923585 GACTTGCCTTCTGGCCGGCCGGG + Exonic
1154067786 18:11125186-11125208 CACACACCGTCTATCCTGCCAGG + Intronic
1167853488 19:52219849-52219871 CACTCACCAGCTGTCCAGCCAGG - Exonic
1168363757 19:55766812-55766834 GCCCCACCGTCAGTCCAGCCGGG - Intergenic
925335701 2:3097882-3097904 TGCTCTCCGTCTGTCCGTCCTGG - Intergenic
926616837 2:15004529-15004551 GTCTCACCCTCTGTCCAGACTGG + Intergenic
926700154 2:15798118-15798140 CACTCACCCTCTGCCTGGCCTGG - Intergenic
927587237 2:24318851-24318873 CGCTCACCTTCTGTGCGGCCAGG - Intronic
930177391 2:48314799-48314821 GACTCACCGTCAGCTCGGCCGGG - Exonic
938831378 2:135053015-135053037 GAGTCTCAGTCTGTCCGCCCAGG + Intronic
939017185 2:136916395-136916417 CACTAACCGTCTGCCTGGCCTGG - Intronic
947612027 2:231530467-231530489 GACGCCCCGCCTGTCCGGCCGGG + Exonic
1169195050 20:3678393-3678415 GCCTCCCTGTCTGTCTGGCCTGG - Intronic
1172871122 20:38136139-38136161 GGCACACCCACTGTCCGGCCCGG - Intronic
1176056994 20:63154323-63154345 GACTCACCCTCCCTCCTGCCTGG - Intergenic
1176408011 21:6432129-6432151 GACTCACTGTCTGACAGGCAGGG + Intergenic
1179683502 21:43040455-43040477 GACTCACTGTCTGACAGGCAGGG + Intergenic
1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG + Exonic
1184696653 22:46143158-46143180 GACTGGCCATCTGCCCGGCCTGG - Intergenic
969636071 4:8370201-8370223 GCCTCCCCGTCTGTCGCGCCAGG - Intronic
970195538 4:13547427-13547449 GCCTCACCGGCCGCCCGGCCGGG - Intergenic
997791527 5:136766623-136766645 GACTCACCGTCAGCCAGGCTGGG - Intergenic
1000836644 5:166163313-166163335 GACTCACCAGCTGTCAGGCACGG + Intergenic
1003871779 6:10410017-10410039 GCCTCACCAGCTGTCGGGCCTGG - Exonic
1004429797 6:15533187-15533209 GACTCACCGGCTGTGCGGGGTGG - Intronic
1015937117 6:138415310-138415332 GACTCACTGTCTGGCTGGCTCGG + Exonic
1035790428 8:2298874-2298896 GCCTCACCGTCAGGCCTGCCAGG - Intergenic
1035802377 8:2422831-2422853 GCCTCACCGTCAGGCCTGCCAGG + Intergenic
1037589861 8:20303640-20303662 GACGCACGGACGGTCCGGCCCGG + Intronic
1052898112 9:33767261-33767283 GAGTCTCCCTCTGTCGGGCCAGG - Intronic
1192173542 X:68871920-68871942 GAATCAGCCTCTGACCGGCCAGG + Intergenic
1196962022 X:121014061-121014083 GACCCACAGTCTGTACTGCCTGG + Intergenic
1198959938 X:142173587-142173609 AACTCACTGTCTGGCAGGCCAGG + Intergenic