ID: 1183318089

View in Genome Browser
Species Human (GRCh38)
Location 22:37147939-37147961
Sequence GGTCCCCTTGCCCCAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183318089_1183318095 7 Left 1183318089 22:37147939-37147961 CCTGGCCCTGGGGCAAGGGGACC No data
Right 1183318095 22:37147969-37147991 TTTTGTGTGGGTGTCACCCCAGG No data
1183318089_1183318100 24 Left 1183318089 22:37147939-37147961 CCTGGCCCTGGGGCAAGGGGACC No data
Right 1183318100 22:37147986-37148008 CCCAGGTCGGGCCCAGCCTCAGG No data
1183318089_1183318096 11 Left 1183318089 22:37147939-37147961 CCTGGCCCTGGGGCAAGGGGACC No data
Right 1183318096 22:37147973-37147995 GTGTGGGTGTCACCCCAGGTCGG No data
1183318089_1183318097 12 Left 1183318089 22:37147939-37147961 CCTGGCCCTGGGGCAAGGGGACC No data
Right 1183318097 22:37147974-37147996 TGTGGGTGTCACCCCAGGTCGGG No data
1183318089_1183318092 -6 Left 1183318089 22:37147939-37147961 CCTGGCCCTGGGGCAAGGGGACC No data
Right 1183318092 22:37147956-37147978 GGGACCATCAATGTTTTGTGTGG No data
1183318089_1183318093 -5 Left 1183318089 22:37147939-37147961 CCTGGCCCTGGGGCAAGGGGACC No data
Right 1183318093 22:37147957-37147979 GGACCATCAATGTTTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183318089 Original CRISPR GGTCCCCTTGCCCCAGGGCC AGG (reversed) Intronic