ID: 1183318785

View in Genome Browser
Species Human (GRCh38)
Location 22:37151733-37151755
Sequence TTGTATATGAAGAGAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1615
Summary {0: 1, 1: 1, 2: 26, 3: 253, 4: 1334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183318783_1183318785 -6 Left 1183318783 22:37151716-37151738 CCATTTGGATTTGATTTTTGTAT 0: 22
1: 409
2: 1330
3: 8697
4: 18263
Right 1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG 0: 1
1: 1
2: 26
3: 253
4: 1334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183318785 Original CRISPR TTGTATATGAAGAGAGATGA GGG Intronic
900758232 1:4452453-4452475 TTGTATATGGTGAGAGATAGGGG + Intergenic
900904345 1:5541791-5541813 TTGTATATGATGAGAGATAGGGG - Intergenic
901538918 1:9902045-9902067 TGGTCTTTGAAGAGAGCTGAAGG + Intronic
902155684 1:14483935-14483957 TTGTATATGGTGTGAGATAATGG + Intergenic
904072394 1:27811507-27811529 TTGTTTTTTAATAGAGATGAGGG + Intronic
904589980 1:31607807-31607829 TTGTATATGGTGAGAGATAGGGG - Intergenic
905961282 1:42044626-42044648 TTTTACATGAAGAGTGCTGATGG - Intergenic
906100314 1:43256122-43256144 CTGTATGTGGAAAGAGATGAAGG - Intronic
906410187 1:45572384-45572406 TTGTATATGGTGAGAGATAGGGG + Intergenic
906435440 1:45792079-45792101 TTGTATATTGTGAGAGATAAAGG + Intronic
906576257 1:46893061-46893083 TTGTATATAGAGTGAGATAAAGG - Intergenic
906592662 1:47041951-47041973 TTGTATATGGAGTGAGATAAAGG + Intronic
906595664 1:47074525-47074547 TTGTATATAGAGTGAGATAAAGG + Intronic
906735856 1:48126821-48126843 TTGTACATGATGAGAGATAAAGG - Intergenic
906903441 1:49863254-49863276 TTGTATATGGTGAGAGATAGGGG - Intronic
907025070 1:51109585-51109607 TTGTATATGGTGAGAGATAAGGG + Intronic
907058952 1:51401445-51401467 TTGTATATGATGTGAGATAGAGG - Intronic
907152075 1:52298319-52298341 TTGTATATGGGGAGAGGTGGGGG + Intronic
907583848 1:55597024-55597046 TTGTATATGGTGAAAGATGGGGG + Intergenic
907605303 1:55811081-55811103 TTGTATATGGTGAGAGATAGGGG - Intergenic
907677538 1:56532457-56532479 TTGTAGATAAAGGGAGATGGAGG + Intronic
907961339 1:59284737-59284759 TTGTATATGTTGAGAGATAGGGG + Intergenic
908171991 1:61514321-61514343 TTGTATAAGATGTGAGATAAAGG - Intergenic
908362702 1:63384661-63384683 TTGTATCTGATGAGAGATAGGGG + Intronic
908505957 1:64800460-64800482 TTATATATGGTGAGAGATAAGGG + Intronic
908628248 1:66072054-66072076 GGGTAGATTAAGAGAGATGAAGG - Intronic
908787993 1:67754127-67754149 TTGGAGGTGAGGAGAGATGAAGG - Intronic
908868483 1:68579658-68579680 TTGTATATGATGAGAGGGTAGGG - Intergenic
909520280 1:76560154-76560176 TTGTATATGGTGAGAGATAGGGG - Intronic
909587399 1:77305508-77305530 TTGTATATGGTGAGAGATAAGGG + Intronic
909804969 1:79863113-79863135 TTGTCTAAGATGAGAGAGGATGG + Intergenic
910546878 1:88428295-88428317 TTGTATATGATGAGAGATAAGGG - Intergenic
910561122 1:88592385-88592407 TTATATATGATGAGAGATAGAGG - Intergenic
910589404 1:88913446-88913468 TTGTATATGCTGAGAGATAGGGG + Intergenic
910665613 1:89723109-89723131 GTGAATTTGAACAGAGATGATGG - Intronic
910966421 1:92812438-92812460 TTGCATATGGTGAGAGATAAGGG - Intergenic
911028314 1:93458448-93458470 TTGTATATGGTGTGACATGAAGG - Intronic
911210102 1:95129998-95130020 TTGTATGTGAAGAGACATATAGG - Intronic
911239031 1:95444956-95444978 TTTTATATGGTGAGAGATAAGGG + Intergenic
911515554 1:98864411-98864433 TTGTATATGGTGAGAGATAGGGG + Intergenic
911989792 1:104680029-104680051 TTATATATTATGTGAGATGAGGG - Intergenic
912005746 1:104898401-104898423 TTGCATAAGATGAGAGATGCAGG + Intergenic
912009526 1:104941514-104941536 TTGTATATGTATATATATGAAGG + Intergenic
912018031 1:105066665-105066687 TTGTATATGGCGAGAGATAGGGG + Intergenic
912231688 1:107800385-107800407 TTGTAACTGGAGTGAGATGATGG + Intronic
912231725 1:107800989-107801011 TTGTATATGATGAGAGATAGGGG + Intronic
912301793 1:108525314-108525336 TTGTATATAGTGAGAGATAAGGG + Intergenic
912639077 1:111327259-111327281 TTTTATATGATGAGAGATAGAGG + Intergenic
912871994 1:113316026-113316048 TTGTATATGGTGAGAGATAGAGG - Intergenic
912907672 1:113723594-113723616 TTGCATATGGTGAGAGATAAGGG - Intronic
913132433 1:115853428-115853450 TTGTATATGGTGAGAGACAAGGG + Intergenic
913166243 1:116188795-116188817 TTATATATGATGAGAGATAGAGG + Intergenic
913702484 1:121386119-121386141 TGGTGTATGAAGGGGGATGAGGG + Intronic
914043047 1:144066614-144066636 TGGTGTATGAAGGGGGATGAGGG + Intergenic
914135039 1:144893874-144893896 TGGTGTATGAAGGGGGATGAGGG - Intronic
914977998 1:152384074-152384096 TTGCATATGATGAGAAATGGTGG + Intergenic
915000383 1:152584145-152584167 TTGTATATGGGGTGAGATAAGGG + Intronic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
915641091 1:157227124-157227146 TTTTATATGTAGACATATGATGG + Intergenic
915658079 1:157377947-157377969 TTGCACATGGAGTGAGATGAAGG - Intergenic
915687078 1:157644456-157644478 TTGTGTGTGGAGAGAGGTGATGG + Intergenic
915846004 1:159265737-159265759 TTGTATATGATGTAAGATAAGGG + Intergenic
916352626 1:163869040-163869062 TTGTATATGGTAAGAGATAAAGG - Intergenic
916379569 1:164194933-164194955 TTGTATATGATGATAGATAGGGG - Intergenic
916644909 1:166774654-166774676 TTGTATATGGTGAGAGATAGGGG - Intergenic
916807590 1:168273918-168273940 TTGTATATGGGGAGAGATAGGGG + Intergenic
916837575 1:168563758-168563780 TTGTATAAGGTGAGAGATGAGGG - Intergenic
917061253 1:171043159-171043181 TTGTATATGACAAGAGATGGGGG + Intronic
917066051 1:171094613-171094635 TTGTATATGGTGAGAGATAGGGG + Intronic
917149111 1:171925878-171925900 TTGTATATGGTGAGAGATAGGGG + Intronic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917389955 1:174524815-174524837 TTGTATGTGATGAGAGATAATGG + Intronic
917459129 1:175213561-175213583 TTGTATATGGTGAGAGATAGGGG + Intergenic
917465129 1:175269554-175269576 TTGTATATAAAGACAAATCATGG - Intergenic
917578837 1:176352717-176352739 TTGTATACGGTGTGAGATGAGGG + Intergenic
917607932 1:176654227-176654249 TTGTATATGATGATAGATAGGGG + Intronic
917698278 1:177552518-177552540 TTGCATATGGTGAGAGATGGAGG + Intergenic
917838142 1:178956995-178957017 CTGTGTATGAAGAGAGGTCATGG + Intergenic
918200987 1:182266678-182266700 CCGTATAAGAAGAGACATGAGGG + Intergenic
918228989 1:182511107-182511129 TTGTATATGATGAGAGATAGAGG + Intronic
918256109 1:182749263-182749285 TTGTATATGGCAAGAGAGGAAGG + Intergenic
918457916 1:184743904-184743926 TTGTATATGATGTGAGGTAAAGG - Intronic
918473235 1:184896715-184896737 TTGTATATAATGAGAGATAGGGG + Intronic
918838790 1:189506011-189506033 TTGTATATGGTGAGAGATAGGGG + Intergenic
918862831 1:189854948-189854970 TTGTATATGCTGAGAGATAGGGG + Intergenic
918867218 1:189917717-189917739 TTGTATATGCTGAGAGATAAGGG + Intergenic
918938825 1:190962697-190962719 TTTTATATGGTGAGAGATAAGGG - Intergenic
919034297 1:192286041-192286063 TTGTATATGGTGAGAGATAGGGG - Intergenic
919226134 1:194705398-194705420 AAAAATATGAAGAGAGATGAGGG + Intergenic
919269531 1:195321387-195321409 TTGTATATGGTGAGAGATAAAGG + Intergenic
919288946 1:195603318-195603340 TTGTATAAGGTGAGAGATAAAGG + Intergenic
919303288 1:195797813-195797835 TTTCATATGGAGAGAGATAATGG - Intergenic
919477742 1:198050174-198050196 TTGTATATGGTGATAGATAAGGG + Intergenic
919675647 1:200380078-200380100 TTTTATATGTAGAGAGAGAAAGG + Intergenic
920259407 1:204678725-204678747 TGATATCTGAGGAGAGATGAGGG - Intronic
920489913 1:206404862-206404884 TGGTGTATGAAGGGGGATGAGGG + Intronic
920745374 1:208622806-208622828 TTGTATATGGTGAGAGATGGGGG - Intergenic
920810287 1:209278932-209278954 TTGTATTTTAATAGAGATGGGGG - Intergenic
920936065 1:210436132-210436154 TTGTATATGGTGAGAGATAGAGG + Intronic
920946854 1:210537417-210537439 GTGTCTATGAAGTGAGAAGAGGG - Intronic
921024633 1:211265983-211266005 GTATTTGTGAAGAGAGATGATGG + Intronic
921295718 1:213700222-213700244 TTGTATATGGTGAGAGATAGGGG + Intergenic
921416391 1:214892695-214892717 TTGTATATGGTGAGAAATAAGGG - Intergenic
921457139 1:215385680-215385702 TTGTATATGATGAGAGTTAGGGG - Intergenic
921529596 1:216264884-216264906 TTGTATATGGTGAGAGACGGGGG - Intronic
922276696 1:224085940-224085962 ATATATATATAGAGAGATGAGGG - Intergenic
922373240 1:224932602-224932624 TTGTATATGGTGAGAGATAGTGG + Intronic
922549911 1:226486861-226486883 TTGTATATGGTGAGAGATAGGGG + Intergenic
922771700 1:228188242-228188264 TTGTATATGGTGAGAGATAGGGG + Intergenic
923398797 1:233595405-233595427 TTGTATATGGTGAGAGATAGAGG + Intergenic
923417677 1:233780029-233780051 TTGTATATGGTGAGAGATAGAGG + Intergenic
923440550 1:234015628-234015650 TTGTATAAGGTGTGAGATGAGGG - Intronic
923469149 1:234274951-234274973 TGGTATATGAAGAAAGAAGTAGG - Intronic
923937562 1:238780271-238780293 TTGTATATGGTGAGAGATAGGGG - Intergenic
924068297 1:240249270-240249292 TTGTATATGGTGAGAGATAAGGG + Intronic
924503436 1:244658103-244658125 TATTATATGAATAGAGATGAGGG - Intronic
924649020 1:245905962-245905984 TTGTATATGGTGAGAGATAGTGG - Intronic
924649380 1:245910718-245910740 TTGTATATGGGGAGAGATAGGGG - Intronic
924832381 1:247611058-247611080 TTGTATATGATGAGAGATGGGGG - Intergenic
924836981 1:247659600-247659622 TTATATATGATGAGAGATAAGGG + Intergenic
1062853482 10:764806-764828 TTGTATATGGTGAGAGATAAAGG - Intergenic
1062933889 10:1371261-1371283 TTGTATATGGTGAGAGATAGGGG - Intronic
1063357638 10:5416065-5416087 TTGTATATAATGTGAGATGACGG + Intronic
1063863728 10:10341443-10341465 GTGTTTATGAGGAGAGATGCAGG + Intergenic
1064157194 10:12912782-12912804 TTGTATATGGCGTGAGATGAGGG + Intronic
1064763391 10:18645423-18645445 ATGTATATAATGAGAGATAAAGG - Intronic
1064943236 10:20758053-20758075 TTGTATGTGGTGAGAGATAAGGG - Intergenic
1064987326 10:21224186-21224208 TTGTATATGGTGAGAGATAGGGG + Intergenic
1065451217 10:25859726-25859748 TTGTATATGATGTTAGATGTGGG - Intergenic
1065758456 10:28957860-28957882 TTGCATATGGTGAGAGATAATGG - Intergenic
1066025210 10:31350090-31350112 TCGTAAATGATGTGAGATGAGGG + Intronic
1066154915 10:32665481-32665503 TTGTATATAGTGTGAGATGAAGG + Intronic
1066485565 10:35839834-35839856 TTGTATATGGTGAGAGATAGGGG + Intergenic
1066589223 10:36975226-36975248 TTGTATATGGTGAGAGATAAGGG - Intergenic
1066679505 10:37923535-37923557 TTGTATATGATGAGAGATAAGGG - Intergenic
1066700501 10:38122648-38122670 TTGTATATGCTAAGAGATGGGGG - Exonic
1066748596 10:38629298-38629320 TTGTATATGGAGTGAGATAAGGG - Intergenic
1066968075 10:42288477-42288499 TTGTATATGGTGTGAGATAAGGG + Intergenic
1066972812 10:42330239-42330261 TTATATATGGTGTGAGATGAAGG - Intergenic
1067356149 10:45529278-45529300 TTGTATATGGTGAGAGATATGGG - Intronic
1067985884 10:51144142-51144164 TTGTTTATGATGAGAGATAAGGG + Intronic
1068000559 10:51329237-51329259 TTGTATATGATGTGAGATAAGGG + Intronic
1068094733 10:52477032-52477054 TTGTATATGGTGTGAGATTAGGG - Intergenic
1068295561 10:55068273-55068295 TTGTATATGATGGGAGATAGGGG + Intronic
1068445020 10:57109479-57109501 TTGTATATGGAGAGAGATAGGGG - Intergenic
1068641975 10:59419174-59419196 TTGTATATGATGAGAGATTGGGG - Intergenic
1068697836 10:59987412-59987434 TTGTATATGGTGAGAGATAGGGG + Intergenic
1068709678 10:60120281-60120303 TTGTATATGGCGAGAGATAGGGG - Intronic
1068843931 10:61649112-61649134 TTGTATACGGTGAGAGATGGGGG + Intergenic
1068906421 10:62329305-62329327 TTGTATATGGTGTGAGATGAGGG + Intergenic
1069077081 10:64049803-64049825 TTGTATATGTTGTGAGATAAGGG - Intergenic
1069249423 10:66249119-66249141 TTGTATATGGTGAGAGATAGGGG - Intronic
1069576381 10:69532498-69532520 TTGTATAAGGTGAGAGATGAAGG - Intergenic
1069727949 10:70593253-70593275 GTGTATATGGAGGGAGATGATGG + Intergenic
1070238127 10:74652013-74652035 TTGGCTATGAAGGGATATGAAGG + Intronic
1070269920 10:74943618-74943640 TTGTGTATGAGGTGAGATAAGGG - Intronic
1070663242 10:78323470-78323492 TTGTATATGGTGAGAGATATGGG + Intergenic
1071004932 10:80872876-80872898 TTGTATAGGATGAGACATGGGGG - Intergenic
1071267922 10:83980804-83980826 GTGTGTATGGAGAGAGATGGGGG - Intergenic
1071406210 10:85335191-85335213 TTGTATATGGCAAGAGATAAGGG - Intergenic
1071440943 10:85693753-85693775 TTGTATATGGTGAAAGATAAGGG - Intronic
1071667257 10:87571546-87571568 TTGTATATGGTGAGAGACAAGGG - Intergenic
1071872734 10:89813304-89813326 TTGTATATGGTGTGAGATAAGGG + Intergenic
1071924099 10:90385605-90385627 TTGTCAATGAACAGAGATAATGG - Intergenic
1071998816 10:91174155-91174177 TTGGATATGAAGTGGCATGAAGG + Intronic
1072059306 10:91794066-91794088 TTGTATATGGTGAGAGATAGGGG - Intergenic
1072223971 10:93350871-93350893 GTGTATATGCTGAGAGATGGGGG - Intronic
1072369457 10:94749712-94749734 TTGTATATGTTGAGAGATAGGGG + Intronic
1072381863 10:94880661-94880683 TTGTATATGTTGAGAGATAAGGG + Intergenic
1072385258 10:94918837-94918859 TTGTATATGATGAGCGATACGGG + Intergenic
1072432162 10:95382496-95382518 TTGTATATGGTGAGAGATGGGGG + Intronic
1072491802 10:95914134-95914156 TTGTATATGGTGAGAGATAGGGG + Intronic
1072879517 10:99211678-99211700 TTGTATAAGATGTGAGATAAAGG - Intronic
1073198405 10:101714537-101714559 TTGTATAGGGTGTGAGATGAGGG + Intergenic
1073689187 10:105788411-105788433 TTGTATATAGTGAGAGATGGGGG - Intergenic
1074331312 10:112512716-112512738 TTGTATATGGTGAGAGATAGGGG + Intronic
1074619497 10:115104717-115104739 TTGTATATGGTGAGAGATAGGGG + Intronic
1074623126 10:115147641-115147663 TTGTATATGGTGAGAGATAAGGG + Intronic
1074626777 10:115198678-115198700 TTATATATGATGTGAAATGAGGG + Intronic
1074663295 10:115688971-115688993 TTGTGTATGATGAGAGATAGGGG + Intronic
1074664073 10:115697869-115697891 TTGTAAATTAAAATAGATGAAGG + Intronic
1074804538 10:117035303-117035325 TTGTGTCTGGAGAGAGATAAGGG - Intronic
1074933603 10:118155687-118155709 TTGTATATGGTGAGAGGTAAGGG - Intergenic
1075012122 10:118882452-118882474 TTGTGTATGGTGAGAGATAAGGG - Intergenic
1076378375 10:130008164-130008186 TTTAATATCAAGATAGATGAGGG + Intergenic
1076537769 10:131193517-131193539 TTGTATATTGTGAGAGATAAGGG + Intronic
1077597048 11:3542313-3542335 TTGTAAGTGATGAGAGATAAGGG - Intergenic
1077839465 11:5959840-5959862 TTGTAGATGGTGAGAGATAAGGG + Intergenic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078277739 11:9866546-9866568 TTGTATATGGTGAGAGATGGAGG - Intronic
1079342708 11:19626206-19626228 TAGTATAGGATGAGAGATGGAGG + Intronic
1079416402 11:20240716-20240738 TTGTATATGGTGAGAGCTGGTGG + Intergenic
1079513754 11:21242028-21242050 TTGTCTGTGAATAGATATGATGG + Intronic
1079707711 11:23641301-23641323 TTGTATATGGAAAGAGATAGGGG - Intergenic
1079823118 11:25156788-25156810 TTGTATATGGTGAGAGATAGGGG + Intergenic
1079848844 11:25503607-25503629 TTGTGTATGATGAGAGATAGGGG + Intergenic
1079866293 11:25739443-25739465 CTGTATATGATGAGAGATAGGGG - Intergenic
1079972285 11:27050027-27050049 TTATGTATGATGTGAGATGAGGG + Intronic
1080085502 11:28276884-28276906 TTATATATGAAGAGAGATAGAGG - Intronic
1080998515 11:37636782-37636804 TTGTATATGGTGAGAGATAGGGG + Intergenic
1081053419 11:38375618-38375640 TTGTATATGGTAAGAGATAAAGG + Intergenic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081310977 11:41571852-41571874 TTGTATATGGTGAGAGATAGTGG + Intergenic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1081729763 11:45362180-45362202 TTGTATTCTAAGAGTGATGAGGG - Intergenic
1081985398 11:47298850-47298872 TTGTATATGGTGAGAGCTAAGGG + Intronic
1082129310 11:48469276-48469298 TTGTATATGGTGTGAGATAAGGG + Intergenic
1082247770 11:49944411-49944433 TTGTATATGGTGTGAGATAAGGG - Intergenic
1082668903 11:56009514-56009536 TTGTATATGGTGAAAGATAAAGG - Intergenic
1083127244 11:60582812-60582834 TTGAATAAGGTGAGAGATGAGGG - Intergenic
1084252973 11:67916289-67916311 TTGTAAGTGATGAGAGATAAGGG - Intergenic
1084819897 11:71679703-71679725 TTGTAAGTGATGAGAGATAAGGG + Intergenic
1084995776 11:72976852-72976874 TTGTATATGGTGAGAGATAGGGG - Intronic
1085682435 11:78589870-78589892 TTGTATATGGGGTGAGATAAGGG - Intergenic
1085887771 11:80540624-80540646 TTGTATATGGTGAGAGATAGGGG - Intergenic
1085891936 11:80590270-80590292 TTGTATATGGTGAGAGATAGAGG - Intergenic
1085898850 11:80672725-80672747 TTGTATATGGTGAGAGAGAAGGG + Intergenic
1086013854 11:82139930-82139952 TTGTATATGGTGAGAGGTGGCGG - Intergenic
1086015653 11:82163794-82163816 TTGTATATGGTGAGAGATAAGGG + Intergenic
1086029131 11:82332505-82332527 TTGTATAGGAAGGTAGATTAGGG + Intergenic
1086114379 11:83231725-83231747 TTGTATATGGTGAGAGATAGGGG + Intronic
1086397074 11:86426750-86426772 TTGTATATGGTGTGAGATAAGGG + Intergenic
1086546786 11:88005772-88005794 CTGTATATGGTGAGAGATAAGGG + Intergenic
1086565910 11:88225800-88225822 TTGTATATGGTGAGAGATATGGG + Intergenic
1086667572 11:89502136-89502158 GTATTTATGAAGAAAGATGAGGG + Intergenic
1086743366 11:90395593-90395615 TTGTAAATTCAGAGAGATCATGG + Intergenic
1086771399 11:90771922-90771944 TTGCATATGAGGAGAGATCAGGG - Intergenic
1086861328 11:91927883-91927905 TTGTGTTTGAAGAAAGATGGCGG + Intergenic
1086986711 11:93258589-93258611 TTTTATAGGAAGAGAGTTCATGG - Intergenic
1087342385 11:96923352-96923374 TTGTATATGGTGAGAGACAAGGG + Intergenic
1087497780 11:98911616-98911638 TTGTATATGACGAGAGATAGGGG + Intergenic
1087693005 11:101343806-101343828 TTGTATATGGTGAGAGATACAGG + Intergenic
1087864960 11:103214002-103214024 TTGTATATGATGACAGAAGGAGG + Intronic
1088138464 11:106585880-106585902 TTGTATATGGTGAGACATAAGGG + Intergenic
1088145063 11:106666769-106666791 TTGTATGTGATGAGAGATAGGGG + Intergenic
1088314558 11:108494810-108494832 TTGTAGATGAAAAGAAATAAGGG - Intronic
1088323527 11:108578208-108578230 TTGTATATGGTGAGAGATAGGGG + Intronic
1088331141 11:108653384-108653406 TTGTATATGGCAAGAGATCAGGG - Intergenic
1088375574 11:109137302-109137324 TTGTATATGGAGAGAGAGAGAGG + Intergenic
1088583916 11:111342835-111342857 TTGTATATTAATAGAGATTTGGG + Intergenic
1088628361 11:111749698-111749720 TTAGATATGAAGAGAAATTAAGG + Intronic
1088953389 11:114592994-114593016 TTGTATATGGTGAGAGAAAATGG - Intronic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089570130 11:119402136-119402158 TTGTATATGGTGAGAGGTGGGGG - Intergenic
1089595160 11:119574005-119574027 ATGTATTTGAAGAGAGATGGGGG - Intergenic
1089686584 11:120152578-120152600 TTGTTTATGATGTGAGATAAGGG + Intronic
1089945426 11:122466835-122466857 TTGTATATGATGAGAGATAGAGG - Intergenic
1090130736 11:124138947-124138969 TTCTATGTGATGAGAGATAAGGG + Intronic
1090142655 11:124281223-124281245 TTGTGTAAGGTGAGAGATGAGGG - Intergenic
1090157204 11:124452546-124452568 TTGTATAGAGTGAGAGATGAGGG - Intergenic
1090434866 11:126678212-126678234 TTGTATAGCAAGGGAGAAGATGG - Intronic
1090685253 11:129110114-129110136 TTTTATATGATGAGAGATAGGGG + Intronic
1090696052 11:129243135-129243157 TAGTATATGTGGACAGATGATGG - Intronic
1090729970 11:129562661-129562683 TTGCATATGATGAGAGCTAAGGG - Intergenic
1090853441 11:130591040-130591062 TTGTATATGGTGAGAGATACAGG + Intergenic
1091313262 11:134590684-134590706 TTGCATATGACGTGAGATAAAGG + Intergenic
1091381212 12:62105-62127 TTGTATAAGGTGAGAGATGAGGG - Intergenic
1092129967 12:6103731-6103753 TTGTATATGGTGAGAGATAGGGG - Intronic
1092324860 12:7519798-7519820 TTGTATATGGTGAGAGATGGGGG + Intergenic
1092476750 12:8825769-8825791 TTCTATATGGAGAGAGATGAGGG + Intronic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1092631605 12:10384567-10384589 TTGTATATGGTGTGAGATGAGGG - Intronic
1093092845 12:14940517-14940539 TTTTATATGGTGAAAGATGAGGG - Intergenic
1093142274 12:15522951-15522973 TTGTATATGACGAAATATGTTGG + Intronic
1093336197 12:17907258-17907280 TTGTATATGATGAGAGATACAGG + Intergenic
1093476121 12:19556421-19556443 TTGTATATGGAGAAAGATAGGGG + Intronic
1093937488 12:25016989-25017011 ATGTTTATGATGACAGATGAGGG + Intergenic
1094085819 12:26590589-26590611 TTGTATATCATGAGAGATAGGGG - Intronic
1094111241 12:26864993-26865015 ATATATATAGAGAGAGATGATGG - Intergenic
1094165980 12:27444314-27444336 TTGTATATGTTGAGAGATAAGGG - Intergenic
1094228292 12:28072390-28072412 TTTTATATGATGAAAGATAAAGG - Intergenic
1094330670 12:29289508-29289530 TTGTATATGGAGAGAGATAGAGG - Intronic
1094628077 12:32144877-32144899 TTGTATTTGAATAGAAAAGAGGG - Intronic
1094706402 12:32918548-32918570 TTATAAATTAAGAGAGATGTAGG + Intergenic
1095259034 12:40077324-40077346 TTGTATATGAAGAAAGGAAAGGG + Intronic
1095301049 12:40584290-40584312 TTGTGTATTAAGTGATATGAAGG + Intergenic
1095422216 12:42036879-42036901 TTGTATATGATGAAAGATAGGGG - Intergenic
1095546937 12:43383446-43383468 TTGAATATGAGGGCAGATGATGG - Intronic
1095620232 12:44244865-44244887 TTGTATATGAGGTGAGATAAGGG + Intronic
1095853601 12:46836920-46836942 TTGTGTATGATGAGAGATTGGGG + Intergenic
1096026621 12:48369998-48370020 TTGTATATGGAGTGAGATAATGG - Intergenic
1096043074 12:48537581-48537603 TTGTATATGGTGAGAGATATAGG - Intergenic
1096107037 12:49002360-49002382 GTGCATATGAAGGGAGATGGGGG - Exonic
1096194379 12:49640303-49640325 TTGAAAATCAGGAGAGATGAAGG + Exonic
1096219186 12:49817791-49817813 TTATATATGGTGTGAGATGAGGG - Intronic
1096224498 12:49857231-49857253 TTGTATATGTTGAGAGATGGAGG + Intergenic
1096930784 12:55207158-55207180 TTGTATATATTGAGAGATAAGGG - Intergenic
1097631387 12:62067487-62067509 TTGTGTATGAAGAGAGATAGAGG + Intronic
1097781977 12:63717387-63717409 ATGTATATGAAGAGAGATACAGG + Intergenic
1098060801 12:66560137-66560159 TTGTATATGGCAAGAGATGGGGG - Intronic
1098582540 12:72117249-72117271 TTTTATATGGTGAGAGATAAAGG + Intronic
1098752635 12:74315127-74315149 TTGTATATGGTGAGAGATAGGGG - Intergenic
1099242773 12:80157598-80157620 TTGTATATGGTGAGAGATAGGGG + Intergenic
1099271680 12:80518649-80518671 TTGTATATGGTGAAAGATGGAGG + Intronic
1099371547 12:81836842-81836864 TTGTATATAATGTGAGATTAGGG - Intergenic
1099416439 12:82392807-82392829 TTGTATATGGTGAGAGATAGGGG + Intronic
1099495835 12:83344730-83344752 TTGTATATGGTGAGAGATAGAGG - Intergenic
1099530535 12:83774585-83774607 TTGTATATGGTGAGAGATAGGGG - Intergenic
1099547456 12:84002707-84002729 TTGTATATGGTGAGAGATAGGGG + Intergenic
1099713699 12:86264346-86264368 TTGTATATGGTGAGAGATAGGGG + Intronic
1099732927 12:86527180-86527202 TTGTACATAATGAGAGATAAGGG + Intronic
1099749909 12:86760237-86760259 TTGCATATGGTGAGAGATAAGGG - Intronic
1099899288 12:88687724-88687746 TTGTGTATGATGTGAGATAAGGG - Intergenic
1099917270 12:88910239-88910261 TTGTATATGTTGAGAGATGGGGG + Intergenic
1099972650 12:89515859-89515881 TTGAATAAGGAGAGAAATGAAGG - Intronic
1100026666 12:90137392-90137414 TTATATATGAGGAGAGATAGGGG + Intergenic
1100128984 12:91466632-91466654 TTGTAGATGATTAGAGATAAAGG - Intergenic
1100576363 12:95895298-95895320 GTGAATATGAAATGAGATGAAGG + Intronic
1100684737 12:96974896-96974918 TTGTATATGATGTGAGGTAAGGG - Intergenic
1100917868 12:99447284-99447306 TTGTATATAGTGTGAGATGAAGG - Intronic
1101057210 12:100930354-100930376 TTGTATATGGTGAGAGATAGGGG + Intronic
1101070526 12:101070483-101070505 TTGTATATGCGGAAAGATAAGGG - Intronic
1101162130 12:101988712-101988734 TTGTATGTGGTGAGAGATAAGGG + Intronic
1101187695 12:102296841-102296863 TTGTATATGGTGAGAGATAGAGG + Intergenic
1101536333 12:105620498-105620520 TTGTATATGATGAGATAATAGGG + Intergenic
1102159836 12:110759731-110759753 TCTTATAAGAAGAGAGATTAGGG + Intergenic
1102209487 12:111114832-111114854 TTGTGTATGATGTGAGATAAGGG + Intronic
1105063719 12:133178558-133178580 TTGTATATGGCGAGAGATAAGGG - Intronic
1105228457 13:18462284-18462306 TTATATATGGTGTGAGATGAAGG - Intergenic
1105460061 13:20576541-20576563 TTGCATATGGTGAGAGATAAGGG + Intronic
1106031064 13:26003692-26003714 TTGTATATGGTGTGAGATAAGGG + Intronic
1106362185 13:29041129-29041151 TTGTATAATGTGAGAGATGAAGG + Intronic
1106626938 13:31430337-31430359 TTGTATATGGTGTGAAATGATGG + Intergenic
1106963662 13:35033177-35033199 TTGTATATCATGAGAGATAGGGG + Intronic
1107153181 13:37135836-37135858 TTGAATATGATGAGAGAAAAGGG + Intergenic
1107686693 13:42908061-42908083 TTGTATGTGATGAGAGAAAAGGG - Intronic
1108138413 13:47391275-47391297 TTGTATATGGTGAGAGATAGAGG - Intergenic
1108405176 13:50093672-50093694 TCGTAAATTAAGAGACATGAGGG + Intronic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1109050249 13:57471291-57471313 TGGTATAAGAAAAGAAATGATGG + Intergenic
1109199438 13:59414033-59414055 ATGGATATGAAGAAAGATCACGG + Intergenic
1109283639 13:60386338-60386360 TTGTATGTGGTGAGAGATAAGGG - Intergenic
1109420151 13:62101159-62101181 TTCTATATAATGAGAGATGTGGG + Intergenic
1109433171 13:62263318-62263340 TTGCATATGATGAGAGATAGGGG - Intergenic
1109950525 13:69497314-69497336 TTCCATATTAAGAAAGATGATGG - Intergenic
1110012779 13:70359022-70359044 TTGTATTTCATGAGAGATAAGGG - Intergenic
1110062345 13:71057815-71057837 TTGTGTATGATGTTAGATGAGGG + Intergenic
1110129245 13:71986548-71986570 TTGTATATGATGAGAGGTAGGGG - Intergenic
1110336667 13:74340412-74340434 TTGTATATGGTAAGAGATAAAGG + Intergenic
1110418916 13:75282778-75282800 TTGTAAAAGTTGAGAGATGAGGG + Intergenic
1110491643 13:76116963-76116985 TTGTATATGGCAAGAGATAAGGG - Intergenic
1110735076 13:78926992-78927014 TTATATATGGGGTGAGATGAGGG - Intergenic
1110875626 13:80506222-80506244 TTGTATATGATGATAGGTAAGGG + Intergenic
1111021258 13:82455359-82455381 TTATATGTGATGAGAGATAAGGG - Intergenic
1111053331 13:82914880-82914902 TTGTATATGGTGAAAGATAAGGG - Intergenic
1111356115 13:87104849-87104871 TTGTATATAATGAGAGATAGGGG - Intergenic
1111366614 13:87254923-87254945 TTATATATGGTGTGAGATGAAGG - Intergenic
1111426644 13:88093466-88093488 TTGCATATGGTGAGAGATAAGGG + Intergenic
1111486157 13:88902824-88902846 TTGTATATGGTGAGAGATAGGGG + Intergenic
1111512935 13:89289137-89289159 TTGTATATGACAAGAGATAGGGG + Intergenic
1112081675 13:95978698-95978720 TCGTATATGGTGAGAGATGGGGG + Intronic
1112083946 13:96008004-96008026 TTGTATATGGTGAGAGATAGTGG - Intronic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112532007 13:100213903-100213925 TTGTATATGGCAAGAGATAAGGG + Intronic
1112559343 13:100498580-100498602 TTGGAACTGGAGAGAGATGATGG - Intronic
1112618407 13:101029157-101029179 TTGTATATGACCAGAGATAGGGG + Intergenic
1112658493 13:101479276-101479298 TTGTATGTGGTGAGAGATAAGGG - Intronic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1112823349 13:103361686-103361708 TTGTATATGATGTGAGATAAAGG + Intergenic
1112930260 13:104726586-104726608 TTGTATATAATGTGAGATAAGGG + Intergenic
1112944227 13:104906569-104906591 TTGTATATGGTGAGAGATAAGGG + Intergenic
1114012744 14:18389165-18389187 TTATATATGGTGTGAGATGAAGG - Intergenic
1114205357 14:20566270-20566292 TTGTATATGGTGAGAGATAAGGG - Intergenic
1114654738 14:24309470-24309492 TTGGAAATGAAGAGATTTGAGGG - Intronic
1114687324 14:24545978-24546000 TTGTATATGGTGAGAGATAGGGG + Intergenic
1114747442 14:25164913-25164935 TTGTATATGATGAGAGGTAGGGG + Intergenic
1115053844 14:29098118-29098140 ATGTATATGCTGAGAGTTGATGG - Intergenic
1115382240 14:32753694-32753716 TTGTATATGGTGTGAGATAAAGG + Intronic
1115476083 14:33814155-33814177 TTGGATATGGAGAGAGATGATGG + Intergenic
1115492389 14:33970239-33970261 TTGTATATGGTGAGAGATGGGGG - Intronic
1115778628 14:36744506-36744528 TTGTATATGGTGAGAGATAGGGG - Intronic
1115949209 14:38700717-38700739 TTGTATATGGCAAGAGATAAAGG - Intergenic
1116391687 14:44399262-44399284 TTGTAAATGATGAGAGATAGGGG - Intergenic
1116431562 14:44851690-44851712 TTGTATATGATGTGAGATAAGGG + Intergenic
1116482621 14:45410024-45410046 TTGTATATGATGAAAGGTAAGGG + Intergenic
1116489486 14:45489421-45489443 TTGTATATGGTGAGAGATGAGGG + Intergenic
1116531997 14:45983020-45983042 TTGTATATGGTGTGAGATAAGGG + Intergenic
1116733856 14:48662960-48662982 TTGTATATGATGTGAAATAAGGG - Intergenic
1116877335 14:50125575-50125597 ATGTATATGGAGACAGATGGAGG + Intronic
1117110831 14:52452648-52452670 TTGTATATGATGAGAGATAGGGG - Intronic
1117114793 14:52499140-52499162 TTGTATATGCTGTGAGATAAGGG - Intronic
1117482638 14:56163249-56163271 TTGTATATGGTGAGAGATAGTGG + Intronic
1117504020 14:56383014-56383036 TTGTATATGACAAGAGATAGGGG + Intergenic
1117691336 14:58310588-58310610 TTGTATATCGAGTGAGATGAGGG - Intronic
1117855456 14:60026670-60026692 TTGTATATGATGAGAGATAGGGG + Intronic
1117994396 14:61465396-61465418 TTTTATGTGACGTGAGATGAGGG + Intronic
1118133346 14:62992984-62993006 TTGTATATGACAAGAGATAGGGG + Intronic
1118240936 14:64058288-64058310 TTGTATATGATGAGAGATAGGGG + Intronic
1118482057 14:66177105-66177127 ATTCATATCAAGAGAGATGAAGG + Intergenic
1118497282 14:66320542-66320564 TTGTACATGGTGAGAGATGGGGG - Intergenic
1118888218 14:69884606-69884628 TTGTATATGGTGAGAGATGAGGG + Intronic
1119026987 14:71161209-71161231 TTGTAAATGGTGAGAGATGGGGG - Intergenic
1119121300 14:72080691-72080713 TTGTATATGGTATGAGATGAGGG + Intronic
1119177702 14:72581313-72581335 TTGGATATGGAGGCAGATGAGGG - Intergenic
1119506151 14:75174865-75174887 TTGTATTTTAGTAGAGATGACGG - Intronic
1119605885 14:76016228-76016250 TTGTATATGGTGAGAGATGGGGG + Intronic
1119627221 14:76188876-76188898 TTGTATATGGTGAGAGATAGGGG + Intronic
1119778681 14:77264103-77264125 TTGTATAGGAGGGGAGATGTGGG + Intergenic
1120029040 14:79619376-79619398 TTGTATATGGTGAGAGGTGTAGG + Intronic
1120131614 14:80814575-80814597 TTGTATATGGTGAGAGGTAATGG - Intronic
1120181628 14:81349059-81349081 TTGTATATGGATAGAGATAGGGG - Intronic
1120182684 14:81361467-81361489 TTGTATATGGTGTGAGATAAGGG - Intronic
1120227865 14:81810943-81810965 CTGTGTATGGAGAGAGATGGAGG - Intergenic
1120267498 14:82269834-82269856 TTGTTTAGGAGAAGAGATGAAGG + Intergenic
1120279943 14:82426587-82426609 TTTTATAAGAAAATAGATGATGG - Intergenic
1120329774 14:83077037-83077059 TTGTGTATGATGAGAGATGAGGG + Intergenic
1120619260 14:86742973-86742995 TTATATATGGTGAGAGATAAGGG + Intergenic
1120748289 14:88173279-88173301 TTGTATATAATGAGAGATATGGG - Intergenic
1121159258 14:91721046-91721068 TTGTATTTGATGTGAGATAAGGG - Intronic
1121239295 14:92416538-92416560 GTGTTTTTGAAGAGAGGTGATGG + Intronic
1121259616 14:92556521-92556543 TTGCATGGGAAGATAGATGATGG + Intronic
1121892730 14:97611081-97611103 CTGTATATGATGAGAGATAGGGG + Intergenic
1122335396 14:100973808-100973830 TTATAAATTAATAGAGATGAAGG + Intergenic
1122349653 14:101080882-101080904 TTGTATATGGTGAGAGATAGGGG - Intergenic
1122350425 14:101086762-101086784 TTGTATATGGTGTGAGATGAGGG + Intergenic
1122586872 14:102814079-102814101 TTGTATAGGATGAGAGGTGGAGG + Intronic
1122802068 14:104236130-104236152 TAGTAGCTGAAGAGAGATGTGGG + Intergenic
1124024545 15:25953214-25953236 TTGTATATGGTGAGAGATAGGGG + Intergenic
1124050573 15:26193728-26193750 TTGTATATCAAGAGTTATGAAGG - Intergenic
1124178598 15:27451507-27451529 TTGTATATGGTGTGAGATAAGGG - Intronic
1125060994 15:35423746-35423768 TTGTATATGGTGTGAGATAAGGG + Intronic
1125124498 15:36203972-36203994 TTGTATATGATGTGAGACAAAGG - Intergenic
1125316248 15:38434959-38434981 TTGTATATGGTGAAAGATAAAGG + Intergenic
1125422126 15:39514604-39514626 TTGTATATGAAGAGAGTTAGGGG - Intergenic
1125565058 15:40670884-40670906 TTGTATATGGTGAGAGATAGGGG + Intergenic
1125573521 15:40739178-40739200 TTGTTTCTGAAGACAGATGATGG - Intronic
1125905489 15:43388021-43388043 TTGTATTTTAATAGAGATGGGGG + Intronic
1126052555 15:44699672-44699694 TTGTATATGGTGAGAGATAGTGG + Intronic
1126236981 15:46397372-46397394 TTATATATGATGAGACATAAGGG - Intergenic
1126250318 15:46559894-46559916 TTGTATATGATGAGAGACAGGGG + Intergenic
1126279530 15:46928376-46928398 TTGTACATGGTGAGAAATGAGGG + Intergenic
1126285387 15:47004548-47004570 TTGTATATGATGAGAGGTAGGGG + Intergenic
1126294616 15:47124759-47124781 TTGTATATGGTGAGAGATAGGGG + Intergenic
1126296718 15:47146566-47146588 TTGTATATGGTGTGAGATAAGGG - Intergenic
1126337010 15:47596748-47596770 TTGTATGTGGAGAGAGATATGGG - Intronic
1126429680 15:48568810-48568832 TTGTATATGGTGTGAGGTGAGGG - Intronic
1126508342 15:49435091-49435113 TTGTGTATGAAGTGAGAGGGGGG + Intronic
1126521713 15:49602818-49602840 TTGTATATGGAAAGAGATAGGGG + Intronic
1126708946 15:51435332-51435354 TTGTATATGGCGAGAGATAGGGG + Intergenic
1126715648 15:51514277-51514299 TTGTAGATGAAGAGGGCTGTGGG - Intronic
1126778842 15:52120951-52120973 GTTTATTTGAAGTGAGATGATGG + Exonic
1126876564 15:53048432-53048454 TTGTATATGGTGTAAGATGAAGG + Intergenic
1126881009 15:53097586-53097608 TTGTATATGATGTGAGATGAGGG + Intergenic
1126995691 15:54441341-54441363 TTGTATATGATGAGTGATAGGGG + Intronic
1127044309 15:55010069-55010091 TTGAAGAAGAAGAGAAATGATGG - Intergenic
1127140932 15:55976098-55976120 TTGTATATGACAAGAGATAGGGG - Intronic
1127142974 15:55995341-55995363 ATGTGTATCATGAGAGATGAGGG - Intergenic
1127369744 15:58327962-58327984 TTGTATACGATGAGAAATAAGGG + Intronic
1127707459 15:61561447-61561469 TTGAAATTGAAGAGAGAGGAGGG - Intergenic
1127730170 15:61793461-61793483 TTGTATATGAAGTGAAATAAGGG + Intergenic
1127765321 15:62180301-62180323 TTGTATATGGTGAAAGATGGGGG - Intergenic
1127960042 15:63884058-63884080 TTGGAGAACAAGAGAGATGAAGG + Intergenic
1128191041 15:65697561-65697583 TCTTATATTAATAGAGATGATGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128966481 15:72063216-72063238 TTGTATATGGTGAGAGATAGGGG - Intronic
1129075058 15:72987432-72987454 TTGTATATGGTGTGAGATCAGGG - Intergenic
1129501628 15:76044415-76044437 TTGTATATGGTGAGAGATAGGGG - Intronic
1129559319 15:76549780-76549802 TTGTATATGATGAGAGATAGGGG - Intronic
1129635000 15:77306203-77306225 AAGTATATTAAGAAAGATGATGG + Intronic
1130430765 15:83844757-83844779 CTGTGCATGAAGAGAGATAATGG + Intronic
1130712988 15:86302395-86302417 TTCTATATGCAGAGAAATGGGGG + Intronic
1131306691 15:91251269-91251291 TTGTATATGGTGTGAGATAAGGG - Intronic
1131365267 15:91833678-91833700 ATATATATAGAGAGAGATGAAGG - Intergenic
1131981694 15:98000515-98000537 TTGTATTTGAATAAAGATAATGG - Intergenic
1133136919 16:3718492-3718514 TTGTATCTTAGTAGAGATGATGG - Intergenic
1133375064 16:5278761-5278783 TTGTAAGTGATGAGAGATAAGGG + Intergenic
1133597452 16:7306443-7306465 TTCCATATGAAGATAGATGGAGG + Intronic
1133833320 16:9344160-9344182 TTATATATGAACAGAAATGCAGG + Intergenic
1134420385 16:14082212-14082234 TTGTATATGGCGTGAGATAAAGG + Intronic
1134480546 16:14615119-14615141 TTGAAAATGGAGAGAGATGAGGG + Intronic
1134899152 16:17919350-17919372 TTGTATCTGATGTGAGATCAAGG - Intergenic
1135578226 16:23602686-23602708 TTGTATTTTAATAGAGATGGGGG - Intergenic
1135677296 16:24427096-24427118 TTGTATATGGTGAGAGATAGGGG + Intergenic
1135783311 16:25325466-25325488 TTCTTTATGAAAACAGATGATGG + Intergenic
1137226870 16:46521489-46521511 TTGTATATGGTGAGAGATAGGGG + Intergenic
1137492782 16:48946706-48946728 TTGTTTATTGAGAGAGATGCAGG + Intergenic
1137527002 16:49245057-49245079 TTGTATAAGAAGTGTGATGCTGG - Intergenic
1137528372 16:49258790-49258812 TTGTATATGCTGTGAGATAAGGG - Intergenic
1137635440 16:49982326-49982348 CTGTATATGGATGGAGATGATGG + Intergenic
1138708639 16:58943586-58943608 TTGTATATGGTGTGAGATAAGGG + Intergenic
1138893305 16:61171940-61171962 TTGTATATGGAGAGAGATAGGGG - Intergenic
1139063146 16:63280093-63280115 TTTTATAAGGTGAGAGATGAGGG - Intergenic
1139073777 16:63417976-63417998 TTCTCTATTAGGAGAGATGAGGG + Intergenic
1141083519 16:81075116-81075138 TTGTATAGGGAGTAAGATGAAGG - Intronic
1143891943 17:10108801-10108823 TTGTATATGGTGAGAGATAGGGG - Intronic
1146075909 17:29728865-29728887 TTGTATATGGCGAGAGATGGAGG - Intronic
1146454821 17:33001208-33001230 TTGTATATGATGAGAGACAGGGG + Intergenic
1146755304 17:35426468-35426490 TTGTATTTGGTGTGAGATGAGGG + Intronic
1148284813 17:46378897-46378919 TTGTATATGGTGAGAGATAGGGG + Intergenic
1148307034 17:46596819-46596841 TTGTATATGGTGAGAGATAGGGG + Intronic
1148401968 17:47371398-47371420 TTGTATATGATGAGAGATAGGGG + Intronic
1149108945 17:53003031-53003053 TTGTATATGATGAGAGATAGGGG - Intergenic
1149112629 17:53051251-53051273 TTGTATATGATGAAAGGTAATGG - Intergenic
1149147248 17:53509612-53509634 TTGTATATGGAGAGAGGTAGGGG - Intergenic
1149231652 17:54541598-54541620 TTGTATATGATGAGAGGTAGGGG - Intergenic
1149231814 17:54543915-54543937 TTGTATATGGTGAGAGATAGGGG - Intergenic
1149411791 17:56416032-56416054 TTGTATATGGTGAGAGATAGAGG - Intronic
1149931240 17:60757933-60757955 TTGTATATGGGGAGAGATAGGGG + Intronic
1149943230 17:60893409-60893431 TTGTATATGGTGAGAGATAGGGG + Intronic
1150540614 17:66094473-66094495 TTGTATATGGTGTGAGATAAGGG - Intronic
1150859767 17:68789523-68789545 TTTTATATGGTGAGAGATGGGGG + Intergenic
1150863863 17:68828890-68828912 TTGTATATGGTGAGAGATGGGGG + Intergenic
1150873066 17:68936351-68936373 TTGTATATGGTGAGAGATATGGG + Intronic
1150934601 17:69621955-69621977 TTGTATATGGTGAGAGATAGGGG + Intergenic
1151167137 17:72214104-72214126 TTGTATATGGTGAGAGATAGGGG + Intergenic
1151531320 17:74706956-74706978 TTGTATATGTTGTGAGATAAAGG - Intronic
1152438516 17:80290611-80290633 TGGGAAATGAAGAGAGATGATGG - Exonic
1153137889 18:1938398-1938420 TTGTGTATGTAGTTAGATGAGGG - Intergenic
1153149640 18:2077068-2077090 TTGTATAGGGGGTGAGATGAGGG - Intergenic
1153369817 18:4302316-4302338 TTGTATATGCTGTGAGATAAGGG + Intronic
1153443556 18:5147882-5147904 TTCTATATGAAGAGTCACGAAGG + Intronic
1153648505 18:7217446-7217468 TTTTATATGGTGAGAGATGGGGG + Intergenic
1154372861 18:13780515-13780537 TTGTATATGATGAGAGATAAGGG - Intergenic
1154524998 18:15278012-15278034 TTATATATGGTGTGAGATGAAGG + Intergenic
1155004617 18:21717213-21717235 TTGTATAAGGTGAGAGATGAGGG - Intronic
1155355769 18:24952229-24952251 TTGTATATGGTATGAGATGAGGG + Intergenic
1155462635 18:26100822-26100844 TTGTATATGGTGAGAGATTGGGG - Intergenic
1155494748 18:26431786-26431808 TTGTATATGGTGAGAGATAGGGG + Intergenic
1155543541 18:26890043-26890065 TTGTGTATGTTGTGAGATGAGGG - Intergenic
1155706377 18:28819772-28819794 TTTTATATGTTGAGAGATAAGGG + Intergenic
1155727673 18:29109190-29109212 TTGTATATGGTGAGAGATGGGGG + Intergenic
1155739016 18:29262770-29262792 TTGTATATGGTGAGAGATATGGG + Intergenic
1155787882 18:29924880-29924902 TTGTATATGGTGAGAGAAAAGGG + Intergenic
1155788875 18:29937745-29937767 TTGTATAGGATGAGAGGTGATGG + Intergenic
1155799123 18:30078658-30078680 TTGTATATGTTGAGAGATAGGGG + Intergenic
1155885396 18:31201689-31201711 TTGTATATGGTGCGAGATGAGGG + Intergenic
1156003797 18:32416691-32416713 TTGTATATGGCAAGAGATAAGGG - Intronic
1156213518 18:34973715-34973737 TTGTATATGTTGAGAGATAGGGG - Intergenic
1156369849 18:36463211-36463233 TTCTAAATGAACAGAGATAATGG - Intronic
1156419804 18:36938755-36938777 TTGTATATGGTGAGAGATAGTGG + Intronic
1156777689 18:40813123-40813145 TTGTACATGAAGTGACATCATGG - Intergenic
1156962682 18:43051583-43051605 TAGTATATGAAAAGATTTGAGGG - Intronic
1157879784 18:51310237-51310259 TTGTATATGGTGAGAGATAGAGG - Intergenic
1158431827 18:57395704-57395726 TTGTATATGGCAAGAGATAAAGG - Intergenic
1159169342 18:64744140-64744162 TTGTATATGATAAGAGATAAGGG + Intergenic
1159288200 18:66380234-66380256 TTGTATATGATAAGAGTTAAGGG + Intergenic
1159329685 18:66975341-66975363 TTGCATATGATGAGAGATAGGGG + Intergenic
1159730972 18:72027226-72027248 CTGTATATGGTGAGAGATAAGGG + Intergenic
1159774912 18:72592665-72592687 TTGTATATGGTGAGAGATAGGGG + Intronic
1159895823 18:73995227-73995249 TTATATATGGTGAGAGATAAGGG + Intergenic
1159980588 18:74774691-74774713 TTGTAGATGAAAGGAGATGAAGG + Intronic
1162614793 19:11789956-11789978 TTGTATATGATGAGAGATAGGGG - Intergenic
1162615168 19:11793901-11793923 TTGTATATGGAGAGAGATCAGGG + Intergenic
1163069169 19:14823803-14823825 TTGTATATGGTGTGAAATGAGGG + Intronic
1163887610 19:19981544-19981566 TTGTACATGGAGAGAGATAGAGG - Intergenic
1164059911 19:21662238-21662260 TTATATATGGTGTGAGATGAGGG + Intergenic
1164265501 19:23612478-23612500 TTATATATGAAGTAAGATGAGGG + Intronic
1164272802 19:23687989-23688011 TTGGAATTGAAGAGAGATGTTGG - Intergenic
1165280152 19:34790023-34790045 TTGTATATGTTGTGAGATAAGGG + Intergenic
1167279745 19:48559945-48559967 TTTTTTTTAAAGAGAGATGAGGG - Intronic
1167519290 19:49943516-49943538 TTGTATATGGTGAGAGATGGGGG - Intronic
1167841147 19:52121776-52121798 TTGTATATGATGAGAGATAGGGG - Intronic
1168698950 19:58423871-58423893 TTGTATACGGTGAGAGATGGGGG - Intergenic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925614001 2:5728066-5728088 TTCTAGATGAAAAGAGATGAAGG - Intergenic
925796287 2:7546937-7546959 TTGTATGTGAAGGGAGGAGAGGG + Intergenic
926614127 2:14978121-14978143 TTTTATAAGAAGAGAAAAGAAGG - Intergenic
926708270 2:15852915-15852937 TTGTATATGCTGAGAGATGGGGG + Intergenic
926940219 2:18127837-18127859 TTTTATATGATGAGAGATAGGGG - Intronic
927331382 2:21867825-21867847 TTGTATATGGTGAGAGATAGGGG - Intergenic
927614874 2:24582917-24582939 TTGTATACGATGAGAGATGAGGG - Intronic
927791525 2:26013777-26013799 TTGTATACGGAAAGAGATGAAGG + Intergenic
927955679 2:27205846-27205868 TGGTATATGAAGGTAGAGGATGG - Intronic
928037282 2:27836464-27836486 TTGTATATGGTGAAAGATAAGGG - Intronic
928046430 2:27937978-27938000 TTGTATATGATGAAAGGTAAGGG + Intronic
928282254 2:29958465-29958487 TTGTATATGGTGAAAGATAAAGG - Intergenic
928338070 2:30415852-30415874 TCGTATACAAAGTGAGATGAGGG + Intergenic
928448191 2:31351568-31351590 TTCAATATGGAGAGAGGTGAAGG - Intronic
928459846 2:31461313-31461335 TTGTATATGGTGAGAGATAGGGG - Intergenic
928665030 2:33542371-33542393 TTTTAAATGAAGAGTAATGAGGG - Intronic
928781599 2:34828842-34828864 TTGTATATGGTGAGAGGTAAGGG + Intergenic
928784029 2:34860172-34860194 TTGTATATGGTGAGAGATAAGGG - Intergenic
929210183 2:39347923-39347945 TTGTAAATGAAGGGAGAAGTTGG - Intronic
929649819 2:43667138-43667160 TTGTATATGATGCAAGATAATGG + Intronic
930225488 2:48788228-48788250 TTATATATGTAGAGAAAGGAAGG - Intergenic
930270485 2:49250799-49250821 CGGTTTATGAAGAGAGAAGAAGG + Intergenic
930288307 2:49462370-49462392 TTGTATATGATGAGAGATAGGGG + Intergenic
930429541 2:51256509-51256531 TTGTATATGGTGAGAGATAGCGG - Intergenic
930567845 2:53045503-53045525 TTGGATATGATGTGAGATAAGGG + Intergenic
930638748 2:53833978-53834000 TTTTATATGGAGTGAGATAAAGG - Intergenic
930838539 2:55821044-55821066 TTGTATATGATATGAGATAAGGG - Intergenic
930962654 2:57279451-57279473 TTGTATATGGTGAGAGATAGGGG - Intergenic
931025175 2:58105028-58105050 TTGTATATGGTGAGAGATAGGGG - Intronic
931136112 2:59403018-59403040 TTGTATATGCTGTGAGATAAGGG - Intergenic
931353427 2:61513020-61513042 TTGTATATGAGGTGAGGTAAGGG - Intronic
931453965 2:62392483-62392505 TTGTATATGATGAGAGATACGGG + Intergenic
931710341 2:64984626-64984648 TCGTATATGGTGTGAGATGAGGG + Intergenic
931932316 2:67153153-67153175 TTGTATATGGTGAGAGATAAGGG - Intergenic
932015500 2:68022873-68022895 TTGTATATGGTGAGAGATAGCGG + Intergenic
932037979 2:68267649-68267671 TTGTATATGGTGAGAGATAGGGG - Intergenic
932065545 2:68555128-68555150 TTGTATAAGGTGAGAGATGAGGG - Intronic
932076266 2:68666280-68666302 TTGTATATGGTGAGAGATAAGGG - Intergenic
932932538 2:76059086-76059108 TTTTATATGATGAGAGATAGGGG + Intergenic
933068247 2:77825973-77825995 TTGCATATGACAAGAGATAAGGG + Intergenic
933302447 2:80557441-80557463 TTGTACAAGAATAGAGCTGATGG - Intronic
933460084 2:82571792-82571814 TTGTATATGATGTGAAATGAGGG + Intergenic
933502566 2:83133702-83133724 TTGTATTTGAACACATATGAGGG + Intergenic
933601894 2:84340770-84340792 TTGTATATGATGTGAGATAAGGG - Intergenic
933617736 2:84500204-84500226 TTGTATATGGTGAGAGATGGGGG + Intergenic
933785320 2:85836101-85836123 TTGTATATGGTGAGAGATAGAGG - Intergenic
933807079 2:86006916-86006938 TTGTATATGGTGGGAGATAAGGG - Intergenic
933852178 2:86377265-86377287 TTGTATATGGTGAGAGATAGTGG + Intergenic
934311576 2:91871427-91871449 TTGTATATGGTGTGAGATAAGGG - Intergenic
935433322 2:103001651-103001673 TTGTATATGGTGAGAGATAGGGG - Intergenic
935680232 2:105629539-105629561 TTTTATTTGAAAAGTGATGATGG - Intergenic
935752280 2:106246613-106246635 TTGTATATGGTGAGAGATAGGGG - Intergenic
935802969 2:106716979-106717001 TTGTACATGGTGAGAGATAAGGG - Intergenic
935912691 2:107914156-107914178 TTGTATATGGTGAGAGATAGGGG - Intergenic
935932946 2:108149260-108149282 TTGCATATGAAAAGAGAAGGTGG - Intergenic
936005877 2:108887053-108887075 TTGTATATGATGAGAGATAGGGG + Intergenic
936120443 2:109738245-109738267 TTGTATATGGTGAGAGATAGGGG + Intergenic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936224251 2:110633201-110633223 TTGTATATGGTGAGAGATAGGGG - Intergenic
936580012 2:113691275-113691297 TTGTGTATGATGTGAGATAAAGG - Intergenic
936735395 2:115435864-115435886 TTGTATATGGTGAGAGATAGGGG + Intronic
936785581 2:116090249-116090271 TTGTTTATGAAAAGAGATGGGGG + Intergenic
936933780 2:117818237-117818259 TTGTATAAGCAGAGATATCAAGG + Intronic
937116691 2:119410588-119410610 TTATATATGGAGAGAGATAGGGG + Intergenic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937557965 2:123182939-123182961 TTGTATATGGTGAGAGATAGTGG - Intergenic
937699149 2:124844183-124844205 TTGTATAAGATGAGAGATGGAGG + Intronic
937739890 2:125338823-125338845 TTGTATATGGTGAGAGATATGGG - Intergenic
938524188 2:132110133-132110155 TTGTATATGGTGTGAGATGAAGG + Intergenic
938999966 2:136723149-136723171 TTGTATATCATGATAGATAAGGG + Intergenic
939240589 2:139554197-139554219 TTGTATATGGTGTAAGATGAAGG + Intergenic
939511824 2:143116518-143116540 TTGTAAATGGTGTGAGATGAGGG - Intronic
939707480 2:145473001-145473023 TTGTATATGGCAAGAGATAAGGG + Intergenic
939926051 2:148174272-148174294 TTGTATATGGAGTGAAATAAGGG - Intronic
940072704 2:149707054-149707076 TTGTGTAAGGAGAGAGATAAGGG - Intergenic
940433017 2:153616106-153616128 TTGTATATGGTGAGAGATAGGGG + Intergenic
940444243 2:153758153-153758175 TTGTATATGGCATGAGATGAGGG + Intergenic
940637707 2:156319076-156319098 TTGTACATGAAGTGAGAGAAAGG - Intergenic
940669128 2:156645891-156645913 TTGTATATGATGAGAGATGGTGG - Intergenic
940785539 2:157977091-157977113 TTGTATATGATGAGAGATAGGGG + Intronic
941138198 2:161743291-161743313 TTGTATATGACAAGAGATAGGGG + Intronic
941277340 2:163506228-163506250 TTGTATATGGAAAGAGATGGGGG + Intergenic
941322187 2:164069758-164069780 TTGTATTTGAAAAGAGTTTATGG + Intergenic
941338757 2:164279036-164279058 TTGTATATGTTGAGAGGTGAAGG + Intergenic
941431087 2:165415285-165415307 TTGTATAACGTGAGAGATGAAGG + Intergenic
941431393 2:165418288-165418310 TTGAATATATAGAAAGATGAGGG + Intergenic
941543810 2:166820136-166820158 ATGAATATAAAAAGAGATGAAGG - Intergenic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
941680053 2:168388056-168388078 TTGTATAAGGTGAGAGATGAGGG - Intergenic
941865849 2:170333557-170333579 TTGGATCTGAAGAGAGAGCAGGG - Intronic
941943720 2:171071752-171071774 TTGTATATGGTGAGAGATAGGGG + Intronic
942287218 2:174431729-174431751 TTTTACATGATGAGATATGAAGG + Intronic
942734774 2:179097197-179097219 TTGCACTTGAAGAGAGAAGATGG - Intergenic
942834122 2:180272310-180272332 TTGTATATGGTGAGAGATAAGGG + Intergenic
942852802 2:180510153-180510175 TTGTACATGATGAGAGATCAGGG + Intergenic
943168251 2:184360986-184361008 TTTTATAGGAAGAAAGATCAAGG + Intergenic
943226604 2:185186269-185186291 TTGTATATGGCAAGAGATAAAGG + Intergenic
943246237 2:185454941-185454963 TTGTATATGATGAGAGACAGGGG - Intergenic
943268462 2:185768433-185768455 TTGTATATGATGTGAGGTAAGGG + Intronic
943424864 2:187718784-187718806 TAGTATATGAAGCTAGATCAAGG - Intergenic
943581437 2:189688134-189688156 TTGTATATGGTGAGAGATAGGGG + Intronic
943638287 2:190330702-190330724 TTGTCTATGGTGAGAGATAAGGG - Intronic
943792384 2:191948042-191948064 TTGGAGATGAAGAGAGTTGCAGG + Intergenic
944020599 2:195098879-195098901 TTGTATATGGTGAGAGATAGGGG - Intergenic
944092597 2:195929691-195929713 TTGTATATGATGAAAGTTGGGGG - Intronic
944305824 2:198178105-198178127 TTCTATATGAAGAAACATGTAGG + Intronic
944377450 2:199063429-199063451 TTGTATATAGTGAGAGATGGGGG - Intergenic
944604333 2:201337309-201337331 TTGTACATGATGAGAGATAGGGG + Intronic
944759534 2:202799786-202799808 TTGTATATGGTGAGAGATAGGGG + Intronic
944902201 2:204226862-204226884 TTCAATAAGCAGAGAGATGAGGG - Intergenic
944974089 2:205027736-205027758 TTGTATATGAGGTAAGATAAGGG + Intronic
944979174 2:205094271-205094293 TTGTGTAGGAAGATATATGAAGG + Intronic
945000106 2:205340566-205340588 TTGTATATGGTGAGAGATTTGGG - Intronic
945111010 2:206359755-206359777 TTCTATATGATGAGAGATAGAGG - Intergenic
945323544 2:208455891-208455913 TTGTATATCAATAGAGTTTAAGG - Intronic
945957916 2:216103514-216103536 TTGGATGTGAAGTGAAATGAAGG - Intergenic
946429838 2:219619609-219619631 TGGTATAGGAAAAGAGATGGTGG + Intergenic
946518524 2:220440206-220440228 TTGTATATGACGACAGATAGGGG + Intergenic
946857647 2:223968630-223968652 TTTTTTATAAAGAAAGATGAAGG + Intergenic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
947130555 2:226919494-226919516 TTGTATATGGTGAGAGATAGGGG + Intronic
947218811 2:227773243-227773265 TTGGGTATGATGAGAGAGGAGGG - Intergenic
947266295 2:228285801-228285823 TTGTATATGATGATAGTTGGGGG + Intergenic
947333986 2:229061277-229061299 TTGTATATGATGTGAGATAAGGG + Intronic
947491799 2:230602091-230602113 TTGTATTTTAGGAGAGATGGAGG + Intergenic
947785782 2:232818447-232818469 TTGTATGTGGTGTGAGATGAGGG + Intronic
948397171 2:237653822-237653844 TTTTATATGGAATGAGATGAGGG - Intronic
948490761 2:238311298-238311320 TTGTATATGGTGCAAGATGAGGG - Intergenic
948739649 2:240035262-240035284 TTGTATGTGGTGAGAGATGGGGG + Intergenic
948812369 2:240488143-240488165 TTATATATGGTGAGAGATAAAGG + Intronic
1168735178 20:129039-129061 TTGTATATGATGATAGATAGGGG + Intergenic
1168958090 20:1848747-1848769 ATGTTTAGGAAGTGAGATGAGGG - Intergenic
1169010082 20:2243236-2243258 ATGTATAGGAAGGGAGAAGAAGG - Intergenic
1169397531 20:5246468-5246490 TTGTACAGGGTGAGAGATGAGGG + Intergenic
1169740342 20:8886769-8886791 TTGTATATGGTGAGAGATAGAGG + Intronic
1169991575 20:11509827-11509849 TTATATATGACAAGAGATGGGGG - Intergenic
1170777108 20:19385322-19385344 TTGTATATGGTGTGAGATAATGG + Intronic
1171276876 20:23864134-23864156 TTGTATATGGTGAGAGACAAGGG + Intergenic
1171336127 20:24387387-24387409 CTGAATATGAAGACAGATTAGGG + Intergenic
1171725254 20:28612339-28612361 TTGTATATTATGAGAGATAAGGG + Intergenic
1171752813 20:29070743-29070765 TTGTATATGATGAGAGATAGGGG - Intergenic
1171789454 20:29506823-29506845 TTGTATATGATGAGAGATAGGGG + Intergenic
1171858086 20:30367618-30367640 TTGTATATGATGAGAGATAGGGG - Intergenic
1171936010 20:31275274-31275296 TTGAATATGGTGTGAGATGAGGG + Intergenic
1172346729 20:34207699-34207721 TTGTATATGGTGAGAAATGGGGG + Intronic
1172419825 20:34806577-34806599 TTGTATATGGTGAGAGATAGGGG + Intronic
1173093976 20:40006468-40006490 TTGGATATGTAGACAGATGATGG + Intergenic
1173230178 20:41189012-41189034 TTGTATATGGTGAGAGATACAGG + Intronic
1173746535 20:45441738-45441760 TTGTATCTGAAGTGAGAGCAGGG + Intergenic
1173768688 20:45638444-45638466 TTGTATATGATGTGAAATTAGGG + Intergenic
1173778645 20:45735133-45735155 TTGTATATGGTGTGAGATAAGGG - Intergenic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1174737872 20:52982955-52982977 TTGTATTTCAAAAGTGATGATGG + Intronic
1175069481 20:56320674-56320696 TTGTATATGATGAGAGATGAGGG - Intergenic
1175232957 20:57486363-57486385 TTGTATAAGGTGGGAGATGAGGG - Intergenic
1176049001 20:63106725-63106747 TTTTATATGTAAAGAGATTATGG - Intergenic
1176206341 20:63890655-63890677 TTTTATATGTATATAGATGAGGG + Exonic
1176264946 20:64204261-64204283 TTATATAGGGAGACAGATGATGG + Intronic
1176654274 21:9575771-9575793 TTGTCTATTACAAGAGATGATGG + Intergenic
1176772436 21:13090470-13090492 TTATATATGGTGTGAGATGAAGG - Intergenic
1177128426 21:17226403-17226425 TTGTGTATGATGAGAGATAGGGG - Intergenic
1177178686 21:17721686-17721708 TTGTTTATGATGAGAGATAGGGG - Intergenic
1177198925 21:17931772-17931794 TTGTATATGGTGAGAGATAGAGG - Intronic
1177214634 21:18112733-18112755 TTGTATATGGTGAGAGATAGGGG - Intronic
1177230285 21:18311052-18311074 TTCTATATGGTGAGAGATAAGGG - Intronic
1177279260 21:18958258-18958280 TTGTATATGGTGAGAGATAGGGG - Intergenic
1177358924 21:20044614-20044636 TTGTATATGGTGAGAGATAGGGG + Intergenic
1177382275 21:20360260-20360282 TTGTATATGATGAGAGATAAGGG - Intergenic
1177552305 21:22640564-22640586 TTGTGTATGACCAGAGATAAGGG - Intergenic
1177578395 21:22988160-22988182 TTGTATATGGTGAGAGATAGGGG - Intergenic
1177624146 21:23637074-23637096 TTGTATATGAAAATAGATAAGGG + Intergenic
1177647665 21:23919874-23919896 TTGTATATGGTGAGAGATAGGGG - Intergenic
1177652134 21:23970554-23970576 TTGTATACGGTGAGAGATGTGGG + Intergenic
1178004319 21:28199331-28199353 TTGTATATGGTGAGAGATAGGGG - Intergenic
1178126663 21:29523336-29523358 CTTTATATGGAGAGAGATGGAGG - Intronic
1178174503 21:30080992-30081014 TTGTGTTTTAATAGAGATGAGGG + Intergenic
1178211871 21:30543915-30543937 TTGTATATGGGGAGAGATAGGGG + Intronic
1178435698 21:32556157-32556179 TTGCATAAGAAGTCAGATGAGGG - Intergenic
1178545988 21:33493420-33493442 TTGTATTTTTAGAGAGATGGGGG - Intergenic
1178825446 21:36012272-36012294 TTGTATATGTTAAGAGATAAGGG - Intergenic
1179339892 21:40496490-40496512 TTGTATATGGTGTGAGATAAGGG - Intronic
1179936216 21:44605770-44605792 TTGCATATGATGTAAGATGAGGG - Intronic
1180112086 21:45663557-45663579 TTGTATATGGTGAGAGATAAGGG + Intronic
1180409607 22:12592806-12592828 TTGTATATGATGAGAGATAGGGG - Intergenic
1180437238 22:15319978-15320000 TTATATATGGTGTGAGATGAAGG - Intergenic
1180520089 22:16190247-16190269 TTATATATGGTGTGAGATGAAGG - Intergenic
1181413412 22:22742035-22742057 TTGTATACGGAGAGAGACAAGGG - Intronic
1181585845 22:23853316-23853338 TTGTATATGAAGTGAGACAGAGG + Intergenic
1181912452 22:26250336-26250358 TTGTATATGATAAGAGATAGGGG + Intronic
1182191365 22:28464124-28464146 TAGTATGTGAAGGAAGATGATGG - Intronic
1183010005 22:34937933-34937955 TTGTATATGGTGATAGATAAGGG - Intergenic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1183485265 22:38084913-38084935 TTGTAAATGATGAGAAATAAAGG - Exonic
1183557576 22:38543022-38543044 TTGTATATGGTGAGAGATAGGGG - Intronic
1184087379 22:42272991-42273013 TTTTAAATAAATAGAGATGAGGG - Intronic
1184316420 22:43695795-43695817 TTGTATATGGTGTGAGATAAGGG - Intronic
1184862890 22:47185717-47185739 TTGTATATGACAAGAGATACAGG - Intergenic
949241507 3:1878026-1878048 TAATATATCAAGAGAAATGAGGG + Intergenic
949477051 3:4457709-4457731 TTGTATATGCTGTGAGATAAGGG - Intronic
949781934 3:7699372-7699394 ATGTGTATGTAGAGAGTTGAAGG - Intronic
949992004 3:9587178-9587200 TTGTATATAATGAGAGATAGGGG + Intergenic
950324010 3:12087899-12087921 TTTTATATGATGTGAGATAAAGG - Intronic
950344862 3:12284439-12284461 TTGTATATGATGTGAGATGGGGG - Intergenic
950458887 3:13109302-13109324 TCTTAAAAGAAGAGAGATGAAGG + Intergenic
950927296 3:16754280-16754302 TTCTATATGATGAGAGATAGGGG + Intergenic
951126289 3:18988156-18988178 TTTTATAGGAAAACAGATGACGG - Intergenic
951322146 3:21258105-21258127 TTGTATATGGAGTGTGATGAGGG + Intergenic
951492423 3:23286322-23286344 TTGTATATGGTGAGAGATAGGGG + Intronic
951547432 3:23841901-23841923 TTCTATTAGGAGAGAGATGAAGG + Intronic
951676962 3:25252029-25252051 TTGTATATGATGTGAGATAGGGG + Intronic
952438409 3:33296548-33296570 TTTTATATGAAGTGAGATAGGGG + Intronic
952442678 3:33348196-33348218 TTGTATATGGTGAGAGATAGGGG + Intronic
952683925 3:36128731-36128753 TTGTATATGTTGAGAGATATGGG - Intergenic
952811192 3:37404811-37404833 TTGTATATGGTGAGAGATAGGGG + Intronic
952941344 3:38446737-38446759 TTGTATATGGTGAGAGATAGGGG - Intergenic
953220251 3:40963893-40963915 TTGTGTATGGTGAGAGATGAGGG + Intergenic
953353776 3:42236629-42236651 CTGTATATGGAGAGAGATAGGGG - Intergenic
953712005 3:45281366-45281388 TTGTATATGGTGAGGGATAAGGG - Intergenic
953723347 3:45375850-45375872 TTGTATAAGGTGAGAGATGAGGG + Intergenic
953813115 3:46131373-46131395 TTAGATATGAAGAGAAGTGAGGG + Intergenic
954281889 3:49586261-49586283 TTGTATATGATGAGAGATAGGGG + Intronic
954477353 3:50760170-50760192 TTGTATATGCTGTGAGATAAGGG + Intronic
955462607 3:59201022-59201044 TTGTATATGGTGAGAGATAGGGG + Intergenic
955592028 3:60547411-60547433 TTGTTTATAAAGAGAGAGTAGGG - Intronic
955838882 3:63090048-63090070 CTGCATATGAAGAGAGATAAAGG - Intergenic
955875697 3:63488355-63488377 TTGTGTATGATGAGACCTGATGG + Intronic
956071631 3:65458975-65458997 TAGTATATGGAGAGAGATATGGG + Intronic
956151640 3:66249812-66249834 TTGTATATAAAGATGAATGAAGG + Intronic
956371440 3:68566952-68566974 TTGTATATGGTAAGAGATAAAGG + Intergenic
957067051 3:75532785-75532807 TTGTAAGTGATGAGAGATAAGGG - Intergenic
957289695 3:78263318-78263340 TTGTATATGGGGAGAGATAAGGG + Intergenic
957554949 3:81754795-81754817 TTGTGTATGATGAGATATTAGGG - Intronic
957562253 3:81837474-81837496 TTCAACATGAAGAAAGATGAAGG - Intergenic
957612409 3:82485353-82485375 TTGTATATAATGAGAGATAGGGG + Intergenic
957681658 3:83443841-83443863 ATGTCTGTGAAGAGTGATGATGG - Intergenic
957779172 3:84796455-84796477 TTGTATATGGTGAGAGATAGAGG - Intergenic
957789716 3:84924377-84924399 TTGTATATGGTGAGAGATGTGGG - Intergenic
957843094 3:85696439-85696461 TTGTATATGATGAGAGATAGGGG + Intronic
957900068 3:86477952-86477974 TTGTATATGGTGAGAAATAAGGG + Intergenic
957932226 3:86895466-86895488 TTGTATATAAAAAGTGATCAAGG - Intergenic
958002906 3:87773756-87773778 TTGTATAAGGTGAGAGAAGAGGG + Intergenic
958084667 3:88790988-88791010 TTGTAAATGGCGAGAGATAAGGG + Intergenic
958137250 3:89510606-89510628 TTGTATATGGTGAGAGACAAGGG + Intergenic
958141584 3:89569926-89569948 TTGTATATGATGAGAGATAGGGG - Intergenic
958263054 3:91404572-91404594 TTGTGTATAAAGAGGGATCATGG - Intergenic
958477204 3:94599984-94600006 TTGTATAAGGTGAGAGATGAGGG - Intergenic
958558401 3:95709260-95709282 TTGTACATGGTGAGAGATAAGGG + Intergenic
958587098 3:96101689-96101711 TTGTATATGATGAGAGATAGAGG + Intergenic
958695230 3:97519168-97519190 TTGTATATGGTGAGAGATAGGGG + Intronic
958699426 3:97569065-97569087 TTCTATAAGAATAGATATGAAGG + Intronic
958744973 3:98123003-98123025 TTGTATGTGGTGTGAGATGAGGG - Intergenic
958764378 3:98347332-98347354 TTGTATATGAGGAGAGACAGGGG - Intergenic
958827250 3:99045979-99046001 TTGTATATGGTGAGAGATATGGG - Intergenic
958839469 3:99186330-99186352 TTCTATTTGAAGAGAGGAGAAGG + Intergenic
959011883 3:101087148-101087170 TTGTATATGGTGAGAGATGAGGG - Intergenic
959042277 3:101436240-101436262 ATGTATATGATGAGAGATAGGGG - Intronic
959090580 3:101898554-101898576 TTGTGTATGATGTGAGATAAGGG + Intergenic
959182271 3:102996707-102996729 TTGTATATGGTGAGAGATAGGGG - Intergenic
959189329 3:103090318-103090340 TTGTATATGATGAGAAATAGGGG + Intergenic
959523787 3:107352338-107352360 TTGTATTTGAAATGAGATTAAGG + Intergenic
959645812 3:108699444-108699466 TTATATATGGTGAGAGATAATGG + Intergenic
959654637 3:108788507-108788529 TTGTATATGGTGAGAGATAGGGG - Intergenic
959680038 3:109084965-109084987 TTGTATATGATGAGAGATAGGGG - Intronic
959717737 3:109451874-109451896 TTGTATATGACAAGAGATGGGGG - Intergenic
959719026 3:109466509-109466531 TTGTATATGGTGAGAGATAGGGG - Intergenic
959729813 3:109589118-109589140 TTGTATATGGTGAGAGATATGGG - Intergenic
959868150 3:111294864-111294886 TTGTATATGGTGAGAGATAGGGG + Intronic
959971250 3:112412777-112412799 TTGTGTATGATGAAAGATAAGGG + Intergenic
960206949 3:114913754-114913776 TTGTATATAATGAGAGAGAAGGG + Intronic
960352909 3:116615342-116615364 TTCTGAATGAAGAGAGATGTAGG + Intronic
960499273 3:118417136-118417158 TTGTATATGGTGAGAGATGGGGG - Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960787829 3:121393604-121393626 TTGTATATGTTGAGAGATATGGG + Intronic
960792085 3:121443764-121443786 TTGTATATATAGAGAGATAGGGG + Intronic
960907812 3:122619122-122619144 TTGTACATTAAAAGAGATAATGG - Intronic
961221411 3:125203557-125203579 TTGTATAGGTTGAGAGATGGGGG - Intronic
961286103 3:125805214-125805236 TTGTAAGTGATGAGAGATAAGGG + Intergenic
961610997 3:128139012-128139034 TTGTATATGGAGAGAGATAGGGG - Intronic
961900644 3:130207662-130207684 TTGTAAGTGATGAGAGATAAGGG - Intergenic
961912678 3:130336730-130336752 TTGTATATGATGAGAGATAGGGG - Intergenic
961952815 3:130768362-130768384 TTGTATATGGTGAGAGATAGAGG - Intergenic
961954014 3:130782022-130782044 TTGTATATGTAGAGAGTAGAAGG + Intergenic
961983998 3:131113259-131113281 TAGAATATGGAGAGAGAAGAAGG + Intronic
962037937 3:131673011-131673033 TTGTATATGGTAAGAGATGGGGG + Intronic
962289290 3:134118681-134118703 TTGTATATGATGAGAGGTATTGG + Intronic
962442413 3:135434219-135434241 TTGTATATGATGGGACATAAGGG - Intergenic
962472565 3:135725133-135725155 TTGTATACGATGAGACATAAGGG + Intergenic
962760181 3:138504904-138504926 TTATATCTGAAGAGGGATAAGGG + Intronic
962768140 3:138585850-138585872 TTGTATATGGTGAGAGATAGGGG - Intronic
962821199 3:139048825-139048847 TTGTATATGGTGAGAGATAGGGG + Intronic
963089426 3:141468813-141468835 TTGTATGTGATGAGAGATAGAGG + Intergenic
963154691 3:142083822-142083844 TTGTATATGGTGAGAGATAGGGG - Intronic
963179824 3:142342751-142342773 TTGTATATGGCAAGAGATGGAGG - Intronic
963354369 3:144191857-144191879 TTGTATATGGTGAGAGATAGGGG + Intergenic
963365491 3:144329193-144329215 TTGTATATGGTGAGAGATAGGGG - Intergenic
963469580 3:145723444-145723466 TTGTATATGGTGTGAGATAAGGG - Intergenic
963528356 3:146442776-146442798 TTGTATATGGTGTGAAATGAGGG - Intronic
963577075 3:147074514-147074536 TTGTATATGGTGAGATATAAAGG - Intergenic
963701813 3:148636158-148636180 TTGTATATGGTGAGAGATAGGGG - Intergenic
963759279 3:149270232-149270254 TTGTGTATGATGAGAAGTGAGGG + Intergenic
963818465 3:149860588-149860610 TTGTATATGGTCAGAGATGAGGG - Intronic
963848742 3:150185955-150185977 TTGTATATGGTGTGAGATAAGGG - Intergenic
964080596 3:152750860-152750882 TTGTATATGGTGTGAGGTGATGG - Intergenic
964350492 3:155798588-155798610 TTGTATATGATGAGAGAGAGAGG - Intronic
964759220 3:160117801-160117823 TTGTATATGGCAAGAGATAAAGG - Intergenic
964781543 3:160344412-160344434 TTGTATATGGTGAGAGATAGGGG - Intronic
964994529 3:162859695-162859717 TTGTATATGATGAGAAATAAGGG - Intergenic
965042577 3:163529520-163529542 TTGTGTATGGTGAGAGATAAGGG - Intergenic
965174582 3:165315487-165315509 TTGTACATGATGAGAGATAAGGG + Intergenic
965237707 3:166147608-166147630 TTGTATGTGGTGAGAGATAATGG - Intergenic
965340683 3:167487347-167487369 TTGTATATGTTGAAAGATAAGGG - Intronic
965380899 3:167986802-167986824 TTGTATATGGTGAGAGATAGGGG - Intergenic
965604917 3:170488665-170488687 TTGTAGATGATGAGAGATAAAGG - Intronic
965728844 3:171748182-171748204 TTGTATTTGAAGAGAAAATATGG + Intronic
965976451 3:174629657-174629679 TTGAATATGAAAAGATATAACGG - Intronic
965989295 3:174797129-174797151 TTGTATATGGTGAGATATAAGGG + Intronic
966173788 3:177113185-177113207 TTGTATATGGTGAAAGATAAGGG - Intronic
966401347 3:179550803-179550825 TTGTATATGGTGAGAGATACGGG - Intergenic
966424182 3:179763387-179763409 TTGTGTATGATGTGAGGTGAGGG + Intronic
966566577 3:181389133-181389155 TTGTATATGGTGTGAGATAAGGG + Intergenic
966694248 3:182773344-182773366 TTGTATATGGTGAGAGATAGGGG + Intergenic
966973067 3:185062866-185062888 TTGTATGTGGTGTGAGATGAAGG - Intergenic
967236467 3:187389343-187389365 TTCTATTTGAAGAATGATGATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967647721 3:191946905-191946927 TTATATGTGAACAGAGATAAAGG - Intergenic
969011639 4:4069380-4069402 TTGTAAGTGATGAGAGATAAGGG - Intergenic
969067824 4:4502782-4502804 CTGCATAGGAAGACAGATGAAGG - Intronic
969473490 4:7405027-7405049 TTGTATATGGTGAGAGATAGGGG + Intronic
969801822 4:9573219-9573241 TTGTAAGTGATGAGAGATAAGGG + Intergenic
969983008 4:11178438-11178460 TTATACATCAAGAGAGTTGATGG - Intergenic
970185818 4:13451761-13451783 TTGTATAGGGTGAGAGGTGAAGG + Intronic
970186957 4:13466038-13466060 TTGTATATGTTGTGAGATAAGGG - Intronic
970388699 4:15584469-15584491 TTGTATATGGTGAGTGATGGGGG - Intronic
970528607 4:16958726-16958748 TGGTAGATGAAGAAAGATGTTGG + Intergenic
970667209 4:18351272-18351294 TTGTATATGGCAAGAGATGGTGG + Intergenic
970759825 4:19470878-19470900 TTGTATATGGTGAGAGATAGGGG + Intergenic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
970946646 4:21700769-21700791 TTGTATATGATGTGAGATAAAGG + Intronic
971421241 4:26475919-26475941 TTGTACATAATGAGGGATGACGG - Intergenic
971624696 4:28903827-28903849 TAGTATATGGAAAGAGAGGAAGG + Intergenic
971645904 4:29202462-29202484 TTTCCTATGAAGAGAAATGAAGG - Intergenic
971749662 4:30631163-30631185 TTGTATATGGTGAGAGATAGGGG - Intergenic
971978145 4:33717815-33717837 TTGTGTGTGATGTGAGATGAGGG + Intergenic
972049560 4:34712018-34712040 TTGTATATGACCAGAGATAGGGG - Intergenic
972251095 4:37303119-37303141 TTGTATATAGTGAGAGATGTGGG + Intronic
972384017 4:38546273-38546295 TTTTATATGGTGAGAGATAAGGG + Intergenic
972415636 4:38837566-38837588 TTGTATATGGTGAGAGATAGGGG - Intronic
972807074 4:42539764-42539786 TTGTATATGGCAAGAGATAAGGG - Intronic
972841742 4:42938675-42938697 TTGTATATGGTGAGAGATATGGG + Intronic
973116054 4:46460858-46460880 TTGTATATGGTGAGGGATGTAGG - Intronic
973275444 4:48302089-48302111 TTGTATATGACGACAGATAGGGG - Intergenic
973701625 4:53543031-53543053 TTGTTTTTAAATAGAGATGAGGG + Intronic
973943608 4:55935138-55935160 TTGTATATGAGGAGAGATAGTGG + Intergenic
974554667 4:63429379-63429401 GTGTATTTTCAGAGAGATGAGGG + Intergenic
974639024 4:64605732-64605754 TTGTATATGATGAGAGGTAGGGG - Intergenic
974826400 4:67136347-67136369 TTGTATATGGTGAGAGATGGGGG - Intergenic
975070083 4:70124074-70124096 TTGAATATGATGAGAGATAAGGG - Intergenic
975081262 4:70283262-70283284 TTGTATATGGTGAGAGATAGGGG - Intergenic
975179565 4:71328990-71329012 TTGTATATAGTGAGAGATAAGGG + Intronic
975193931 4:71500642-71500664 TTGTATATGGTATGAGATGAGGG + Intronic
975335998 4:73175774-73175796 TTGTATATGGTGAGAGATCGGGG - Intronic
975410820 4:74047139-74047161 TTGTATATGGTGAGAGATAGGGG + Intergenic
975674758 4:76815276-76815298 TTGTATATGGTGAGAGATAGGGG + Intergenic
975705382 4:77107087-77107109 TTGTATATGATAGGAGATAAGGG - Intergenic
975793174 4:77977356-77977378 TTGTATATGGTGTGAGATGAGGG + Intergenic
975988921 4:80236529-80236551 TTGAATATTAAGAGTCATGATGG + Intergenic
976017367 4:80573635-80573657 TTGTATATGGTGAGAGATAGGGG + Intronic
976086759 4:81414737-81414759 TTTTATAAGGTGAGAGATGAGGG - Intergenic
976109535 4:81656412-81656434 TAGTATATGATGAGAGATAGGGG + Intronic
976122333 4:81796857-81796879 TTGTATATGATGAGAAATGAGGG - Intronic
976166364 4:82259283-82259305 TTGTATATGGTGAGAGATAGGGG - Intergenic
976440675 4:85070238-85070260 TTGTATATGGTGAGAGATAAGGG + Intergenic
976861259 4:89669864-89669886 TTGTATATGGTGAGAGATAGGGG + Intergenic
976909590 4:90284805-90284827 TTGTATATGGAGAGAGATATGGG + Intronic
976943325 4:90733697-90733719 TTGTATATGATCAGAGATAGGGG + Intronic
976997844 4:91458169-91458191 TTGTATATATAGAGAGATAGGGG + Intronic
977185951 4:93936663-93936685 TTGTATATGGTGAGAGATAGTGG - Intergenic
977223510 4:94366998-94367020 TTGTATATGGTGAGAGATAGAGG + Intergenic
977227953 4:94415740-94415762 TTGCATATGGTGAGAGATAAGGG + Intergenic
977228611 4:94425085-94425107 TTGTATATGATGAAAGATAGGGG - Intergenic
977253930 4:94719408-94719430 TTGTATATGATGGGAGATAGGGG - Intergenic
977342532 4:95776849-95776871 TTGTATATGGTGAGAGATACAGG - Intergenic
977402289 4:96547656-96547678 GTGGATATGAAGAGATATGTGGG + Intergenic
977582223 4:98737843-98737865 TTGTATATGGTGTGAGATAAGGG - Intergenic
977630927 4:99242006-99242028 TTGTATATGATGAGAGACAGAGG + Intergenic
977641773 4:99365398-99365420 TTGTATATGGTGAGAGATAGGGG + Intergenic
977689961 4:99894781-99894803 TTGTAGATGAAGAAATTTGAGGG + Intergenic
977841951 4:101717990-101718012 TTGTATATGGTGAGACATGGGGG - Intronic
977845841 4:101765732-101765754 TTGTATATGGTGAAAGATAAGGG + Intronic
977872666 4:102111617-102111639 TTTTATATGATGAGAGATAGGGG - Intergenic
977888515 4:102279729-102279751 TTTTATATGAAGAGTGTTGCTGG + Intronic
978047278 4:104145830-104145852 TTGTATATGGTGAGAGATAGGGG + Intergenic
978059032 4:104313023-104313045 TTGTAAATGGTGAGAGATAAAGG - Intergenic
978117267 4:105035054-105035076 TTGTATATGGGGAGAGATTGAGG - Intergenic
978262868 4:106783032-106783054 TTGTATATGATGAGAGATAGGGG - Intergenic
978339140 4:107703530-107703552 TTTTATATGAGGTGAGATAAGGG + Intronic
978667085 4:111196650-111196672 TTGTCTATGATGAGAGATACAGG - Intergenic
978693823 4:111550942-111550964 TGGCATTTGAAGAGAGATGTAGG - Intergenic
979435136 4:120679294-120679316 TTGTATAAGGTGAAAGATGAAGG - Intergenic
979564590 4:122139875-122139897 TTGTATATGGTGAGAGATAAGGG + Intergenic
979584465 4:122399141-122399163 TTGTATAAGGTGAGAGATGAGGG + Intronic
979658427 4:123224090-123224112 TTGTATATGATGTAAGATAAGGG + Intronic
979693718 4:123588013-123588035 TTGTATTTTAATAGAGATGGGGG + Intergenic
979962862 4:127041856-127041878 TTGTATATGATGAAAGATAAGGG - Intergenic
980096693 4:128498896-128498918 TTATATATGATGAGAGATAGGGG + Intergenic
980318670 4:131239327-131239349 TTGTATATGGTGAGAGATAGGGG + Intergenic
980320648 4:131268668-131268690 TTCCATGTGAAGAGATATGAGGG - Intergenic
980407350 4:132370189-132370211 TTGTATATGGTGAGAGATAGGGG + Intergenic
980413371 4:132452519-132452541 TTGTATATAATGAGAGATAGAGG - Intergenic
980523994 4:133965789-133965811 TTGTTTAAGGTGAGAGATGAAGG - Intergenic
980580449 4:134743682-134743704 TTGTATATGGTGAGAGATGAGGG - Intergenic
980587518 4:134836016-134836038 TTGTATATGGTGAGAGATAGGGG + Intergenic
980753168 4:137119313-137119335 TTGTATATGGTGAGAGATATGGG - Intergenic
981119352 4:141031227-141031249 TTGTATATGGTGTGAGATAAGGG - Intronic
981256691 4:142669627-142669649 TTGTTTATGATGAGAGAGAAAGG - Intronic
981291000 4:143074498-143074520 TTTTATATGATAAGAGATGAGGG + Intergenic
981307203 4:143259418-143259440 TTCTATCTGAAGAGGCATGATGG - Intergenic
982425937 4:155260283-155260305 TTGTATATGGTGAGAGATAGTGG + Intergenic
982903630 4:161040350-161040372 TTATATATGGTGAGAGATAAAGG - Intergenic
983018847 4:162649054-162649076 TTTTATATGGTGAGAGATGGGGG + Intergenic
983421513 4:167524427-167524449 TTGTATGTGGTGATAGATGAGGG + Intergenic
983662945 4:170148911-170148933 TTGTATATGGTGAAAGATAAGGG + Intergenic
983776883 4:171619017-171619039 TTGTATATGGTGAGAGATAGTGG + Intergenic
983826255 4:172265211-172265233 TTGGTTATCAACAGAGATGAGGG + Intronic
983917239 4:173305577-173305599 TTATATATGGTGTGAGATGAAGG + Intronic
984002032 4:174259730-174259752 TTGTATATGCAGCTGGATGAAGG - Exonic
984090847 4:175373748-175373770 TTGTCTAGGAAGAGAGATGGAGG + Intergenic
984132828 4:175899689-175899711 TTGTATATGGCGAGAGATAGGGG - Intronic
984429669 4:179632546-179632568 TTGTACATGATGTGAGATAAGGG + Intergenic
984819060 4:183863969-183863991 TGGAAAATGAAGAGAAATGAAGG - Intronic
985188175 4:187340898-187340920 TTGTATATGGTGAGAGATAGTGG - Intergenic
985435336 4:189925427-189925449 TTGGATATGATGAGAGATAGGGG - Intergenic
985815097 5:2121960-2121982 TTATATATGGAGTGAGATAAGGG + Intergenic
986293449 5:6418335-6418357 TTTTACAGGAAGAGAAATGAAGG + Intergenic
986456183 5:7922361-7922383 TTGTATATGGTGAGAGCTAAGGG + Intergenic
986544177 5:8877387-8877409 TTGAATATGACAAGAGATAAGGG + Intergenic
986853932 5:11846411-11846433 TTGTATATGGTGAGAGATAGGGG - Intronic
986877476 5:12129096-12129118 TTTTATATGAAAAGTGAAGAAGG - Intergenic
987006215 5:13712288-13712310 TTGTATAAGGTGAGAGATGAGGG - Intronic
987206854 5:15636269-15636291 CTGTAGATGAGGAGAGTTGAGGG - Intronic
987394633 5:17410882-17410904 TTATATATGGAGAGAGAAAAGGG - Intergenic
987440252 5:17946935-17946957 TTGTATAAGGTGAGAGATGAGGG + Intergenic
987607439 5:20155746-20155768 TTGTATATGGTAAGAGATAAGGG + Intronic
987843342 5:23249683-23249705 TTGTATATGCAGTGATACGATGG + Intergenic
987904368 5:24056764-24056786 TTGTATATGGAGAGAGGTAGAGG - Intronic
987952160 5:24688925-24688947 TTGTATAAGATGAGAGATAGAGG - Intergenic
988163362 5:27550384-27550406 TTGTATATGAACAGACACTAAGG - Intergenic
988303844 5:29468979-29469001 TTGTAAAGGAGGAGTGATGATGG - Intergenic
988376610 5:30443512-30443534 TTCTATATGGTGAGAGATAAGGG - Intergenic
988549595 5:32188059-32188081 TTGTATATGGTGTGAGATAAAGG - Intergenic
988645298 5:33088741-33088763 TTGTATATGATGAGAGACAGGGG + Intergenic
988809796 5:34773228-34773250 TTGTATATAGGGAGAGAGGAGGG - Intronic
988931984 5:36045296-36045318 TTGTATATGATGAGATATAGAGG - Intronic
989041744 5:37236395-37236417 TTGTATATGATGAGAGGTATGGG - Intronic
989111520 5:37911222-37911244 TTGTATATGGTGAGAGATAGGGG - Intergenic
989148890 5:38278362-38278384 TTGTATATCATAAGAGATAAGGG - Intronic
989330234 5:40249737-40249759 TTGTATATGGTGAGAGATAGGGG - Intergenic
989354233 5:40523971-40523993 TTGTATATGGTGAGAGATAGGGG - Intergenic
989690641 5:44139193-44139215 TTGTATATGATAAGAGATAGGGG + Intergenic
990377371 5:55185197-55185219 TTGCAGATGAGGAGAGATGGAGG - Intergenic
990471624 5:56121145-56121167 GTGTATAGGAATAGAGATGGAGG - Intronic
990478952 5:56188491-56188513 TTGTATATGGTGAGAGATAGGGG + Intronic
990618608 5:57534677-57534699 TTATATATGTTGAGAGATAAGGG + Intergenic
990642328 5:57800867-57800889 TTGTATATGTTGAGAGGTAAGGG + Intergenic
990691483 5:58369166-58369188 TTTTATATGGTGAGAGATAAGGG - Intergenic
991238744 5:64431348-64431370 TTGTTTATGATGAGAGATGGAGG - Intergenic
991287937 5:65000498-65000520 TTGTATATGATGAGAGATGGAGG + Intronic
991319749 5:65358844-65358866 TTGTATATGATGTGAGTTAAGGG - Intronic
991353194 5:65740586-65740608 TTGTATATGGGATGAGATGAGGG + Intronic
991519959 5:67485700-67485722 TTGTAAATGATGAGAGATAAAGG - Intergenic
991541569 5:67735379-67735401 TTGTATATGGTGTGAGGTGAGGG - Intergenic
991556938 5:67905871-67905893 TTGTATATGATGTGAGAAAATGG - Intergenic
991692832 5:69242077-69242099 TTGTATATGATGAGAGATATGGG + Intronic
992036246 5:72780825-72780847 TTGTATATGTTGAGAGATAGGGG - Intergenic
992079953 5:73227198-73227220 TTGTATATGGTGAGAGATAGGGG + Intergenic
992681690 5:79159784-79159806 TTGTATATGGTGAGAGATAGGGG - Intronic
992896490 5:81250114-81250136 ATGTAAATTAAGAGATATGATGG - Intronic
993026494 5:82653240-82653262 TTGTATATGGCAAGAGATGGAGG + Intergenic
993214579 5:85003336-85003358 TTGTATATGACATGAAATGAGGG + Intergenic
993331844 5:86610356-86610378 TTGTATATGATAAGAGATATGGG + Intergenic
993373378 5:87119276-87119298 TTGTGAATGCAGAGAAATGAGGG + Intergenic
993931926 5:93951496-93951518 TTGTATATGGTGAGAGATAGGGG + Intronic
993950132 5:94164827-94164849 TTTTATATGGCGAGAGATGGGGG - Intronic
994021752 5:95034542-95034564 TTATATATGATGAGAGATAAGGG - Intronic
994047505 5:95326481-95326503 TTGTATATGGTGAGAGATAGGGG - Intergenic
994141191 5:96342968-96342990 TTGTGTATGAAGAAAGGTGTGGG + Intergenic
994228973 5:97290910-97290932 TTGTATATGGTGAGAGATAGGGG + Intergenic
994436501 5:99741462-99741484 TTGTATATGATGAGATATAAAGG + Intergenic
994654015 5:102566326-102566348 TTGTATATGGTGAGAGATAGGGG + Intergenic
994660388 5:102647029-102647051 TTGTATATGATGAGAGATAGGGG - Intergenic
994687226 5:102970423-102970445 TTGTAAAGGAAGAGAGAAGATGG + Intronic
994701938 5:103144736-103144758 ATGTATATGGAGAGAGATAGGGG - Intronic
994770828 5:103979693-103979715 TTGTATATGGTGTGAGATGAGGG + Intergenic
994815826 5:104586734-104586756 TTTTAGAAGAAGAGACATGAAGG + Intergenic
994854204 5:105096297-105096319 TTGTATATGGTGAGAGATAGAGG - Intergenic
994866283 5:105275972-105275994 TTGTATATGGTGAGAGATAAGGG - Intergenic
995071925 5:107932998-107933020 TTGTATAGGAAGATGGGTGAAGG + Intronic
995099619 5:108283500-108283522 TTGTATATGGTGAGAGATTGGGG - Intronic
995129868 5:108618933-108618955 TTATGTATGATGTGAGATGAGGG - Intergenic
995155792 5:108911636-108911658 TTGTATATGGTGAGAGATAGGGG + Intronic
995558027 5:113350508-113350530 TTGTATATGGTGAGAGATAGGGG - Intronic
995604606 5:113838638-113838660 TGGTATATGAGGTGAGATAAAGG + Intergenic
995617517 5:113982352-113982374 TTCTATATGGTGAGAGACGACGG + Intergenic
995621956 5:114035757-114035779 TTGTATATGATGAGAGATAGGGG + Intergenic
995634326 5:114168812-114168834 TTGTGAATGAGGAGAGATAATGG - Intergenic
995646364 5:114317081-114317103 TTCACTAGGAAGAGAGATGAAGG - Intergenic
995693272 5:114851146-114851168 TTGTATATGGGGACAGATGGGGG - Intergenic
995982165 5:118117522-118117544 TTGTATATGAGTAGAAATTATGG + Intergenic
996027949 5:118670534-118670556 TTGTATATGGTGTGAGATAAGGG + Intergenic
996103005 5:119464360-119464382 TTGTATATGATGAGAGGTAGGGG + Intronic
996132913 5:119803666-119803688 TTGTATATATAGAGAGATAGGGG + Intergenic
996149841 5:120022148-120022170 TTGTATATGATGTGAGATAAGGG + Intergenic
996192239 5:120559318-120559340 TTGTATGTGATGAGAGGTAAGGG + Intronic
996259739 5:121451717-121451739 TTATATATGATGAGAGATAGAGG - Intergenic
996293547 5:121884124-121884146 TTGTATATGGTGAAAGATAACGG - Intergenic
996298756 5:121956167-121956189 TTATATATGGTGAGAGATGGGGG + Intergenic
996326611 5:122281936-122281958 TTGTATAAGGTGAGAGACGAGGG + Intergenic
996462211 5:123759147-123759169 TTGTATATGGTGAGAGATAAAGG + Intergenic
996653237 5:125908079-125908101 TTGTATATGGCAAGAGATAAGGG + Intergenic
996688196 5:126308385-126308407 TTGTATATGACAAGAGATAATGG - Intergenic
996688543 5:126311527-126311549 TTGTATATGACAAGAGATAATGG - Intergenic
996951440 5:129130999-129131021 TTGTATATGATATGAGATAATGG + Intergenic
996998806 5:129733127-129733149 TTGTATATGGTGAGAGATAGGGG - Intronic
997085395 5:130791514-130791536 TTTTATATGATGAGAGATAGGGG - Intergenic
997122081 5:131185060-131185082 TGTTATAACAAGAGAGATGATGG - Intronic
997748725 5:136323508-136323530 TTGTATATGATGTGAGGTGTAGG + Intronic
997761262 5:136450305-136450327 TTGTATAAGACAAGAAATGAGGG - Intergenic
997774395 5:136587425-136587447 TTGTATATGATGAGAGATAGGGG - Intergenic
997785414 5:136707102-136707124 TTGTGTATGGTGAGAGATAAGGG - Intergenic
998058357 5:139098411-139098433 TTGTATATGGTGAGAGATAGGGG - Intronic
998258060 5:140604742-140604764 TTGTATATGGAGAGAGGTAATGG + Intergenic
998289659 5:140901385-140901407 TTGTATATGGTGAGAGATAGGGG + Intronic
998724154 5:144989941-144989963 TTGTATATGGTGAGAGATAGGGG + Intergenic
998778092 5:145625998-145626020 TTGTATATGATGGGAGATAGAGG - Intronic
999066447 5:148691898-148691920 TTGTATGTGATGAGAGATAGGGG - Intergenic
999413607 5:151375231-151375253 TTGTATATGGTGAGAGATAGGGG + Intergenic
999555361 5:152736473-152736495 TTGTATATGGTGTGAGATAAGGG + Intergenic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1000161388 5:158600954-158600976 TTGTGTATGAAGACAGAGGCTGG - Intergenic
1000525199 5:162349024-162349046 TTGTATGAGGTGAGAGATGAGGG + Intergenic
1000533645 5:162454171-162454193 TTTTATATGGTGAGAGATAAGGG - Intergenic
1000582673 5:163053194-163053216 TTGTATATGGGGAGAGATAGGGG - Intergenic
1001552598 5:172614702-172614724 TTGTACATGGCGTGAGATGAGGG - Intergenic
1001770211 5:174290005-174290027 TTGTATATGGTGTGAGATAAGGG + Intergenic
1001793247 5:174479715-174479737 TTGTATGTGATGTGAGATAAGGG - Intergenic
1001850556 5:174960826-174960848 TTGTATATGGTGTGAGAGGAGGG + Intergenic
1002120608 5:177001181-177001203 TTGTATATGGCAAGAGATGGAGG + Intronic
1003471050 6:6433287-6433309 TTGCATATGAAGTGAGAGGGGGG + Intergenic
1003549405 6:7089072-7089094 ACATATAAGAAGAGAGATGAAGG - Intergenic
1003595531 6:7470940-7470962 TTGTTTCAGTAGAGAGATGAGGG - Intergenic
1003596259 6:7476808-7476830 TTGTTTCAGTAGAGAGATGAGGG + Intergenic
1003994749 6:11528612-11528634 TTGTATGTGATGAGAGATAAGGG - Intergenic
1004704674 6:18113318-18113340 TTGTATATGGTGAGAGATAGGGG - Intergenic
1005097205 6:22130345-22130367 TTGTATATGGTGAGAGATATGGG + Intergenic
1005391526 6:25338876-25338898 TTTTATATGCTGAGAGTTGAAGG + Intronic
1005562163 6:27051382-27051404 TTGTATACGGTGTGAGATGAGGG - Intergenic
1005992577 6:30912577-30912599 CTGTGTTTGAAGAGAAATGAAGG + Intronic
1006264772 6:32911473-32911495 TGGTATATGAAGAGCAGTGAGGG - Intergenic
1006270457 6:32961944-32961966 TTGTATTTGATGAGAGATGGGGG - Intronic
1006410264 6:33869537-33869559 TTATGTATGAAGAGAAAAGAGGG + Intergenic
1006462095 6:34166026-34166048 TTGTATATGGTGAGAGATAGGGG + Intergenic
1006687528 6:35848819-35848841 TTGTATTCGGAGTGAGATGAGGG - Intronic
1006989609 6:38202723-38202745 TTGTATATGATGAGAGATAGGGG - Intronic
1007333517 6:41134174-41134196 CTGTTTAGGAAGAGAGATAAAGG + Intergenic
1007350007 6:41264974-41264996 TTGTATATGGTGAAAGATGGGGG - Intergenic
1007372777 6:41437592-41437614 TTGGCTATGAAGAAAGATGATGG + Intergenic
1007863345 6:44938247-44938269 TTGTATATGATAAGAGATAGGGG + Intronic
1007971876 6:46059987-46060009 TTGTATATGGTGAGAGATAGGGG + Intronic
1008249897 6:49226851-49226873 TTATACATGACGAGAGATAAGGG + Intergenic
1008260027 6:49354537-49354559 TTGTATATGGTGAGAGATAGGGG - Intergenic
1008313178 6:50003900-50003922 TTGTATAAGGTAAGAGATGAGGG - Intergenic
1008360987 6:50619101-50619123 TTGTATAAGGTGAGAGATGAGGG - Intergenic
1008410186 6:51168743-51168765 TTGTATATGGTGAGAGATACTGG - Intergenic
1008424119 6:51336980-51337002 TTGTATATGGTGAGAGATAGGGG - Intergenic
1008699759 6:54084894-54084916 TTGTATATGTCGAGACTTGAAGG + Intronic
1008727148 6:54435695-54435717 TTGTATATGGTGAGAGATAAGGG + Intergenic
1008734420 6:54525443-54525465 TTGTATATGATGAAAGATAGGGG - Intergenic
1008736690 6:54553172-54553194 TTTTATATGATGAAAGATGGGGG - Intergenic
1008791849 6:55244833-55244855 TTGTATATGGTGAGAGATATGGG + Intronic
1008905663 6:56675225-56675247 TTGTATATGGTGTGAGATAAGGG - Intronic
1008949989 6:57146438-57146460 TTGTATATGATGAAAGATATGGG + Intronic
1008973162 6:57393834-57393856 TTGCATAAGGCGAGAGATGAGGG + Intronic
1008992353 6:57618316-57618338 TTGTGTATAAAGAGGGATCATGG + Intronic
1009162068 6:60295373-60295395 TTGCATAAGGCGAGAGATGAGGG + Intergenic
1009180976 6:60517428-60517450 TTGTGTATAAAGAGGGATCATGG + Intergenic
1009190705 6:60626207-60626229 TTGAATATGGAGAGAGGTCATGG + Intergenic
1009266961 6:61568011-61568033 TTGTATATATAGAGAGATACAGG + Intergenic
1009387647 6:63105346-63105368 TTGTATATGGTGAGAGATAGGGG + Intergenic
1009568600 6:65348886-65348908 TTGTATATGGTGAGAGATAGGGG + Intronic
1009620973 6:66076880-66076902 GTTTATATGATGAGAGATAAAGG + Intergenic
1009661885 6:66623368-66623390 TTGTATATTGTGAGAGATAAGGG + Intergenic
1009693014 6:67060605-67060627 TTGTATATGCTGAGAGATAGGGG + Intergenic
1009704517 6:67229485-67229507 TTGTATATGGTGAAAGATGGGGG - Intergenic
1009960777 6:70517881-70517903 AAGTAGAGGAAGAGAGATGAAGG - Intronic
1010012353 6:71063207-71063229 TTGTATATGGTGAAAGATAAGGG + Intergenic
1010061755 6:71630598-71630620 TTGTAGATGATGAGAGATAGGGG + Intergenic
1010088209 6:71946600-71946622 TTGTATATGGTGTGAAATGAGGG - Intronic
1010268068 6:73890212-73890234 TTGTATATGGTGAGAGATAGGGG + Intergenic
1010316944 6:74462598-74462620 TTCTATATGGTGAGAGATAAGGG + Intergenic
1010321041 6:74510643-74510665 TTGTATATGGTGAGAGATAGGGG - Intergenic
1010346862 6:74821192-74821214 TTGTATATGGTGAGAGAGAAGGG - Intergenic
1010363248 6:75019248-75019270 TTGTATATGGTGAGAGATACGGG + Intergenic
1010449196 6:75983544-75983566 TTGTATATGGTGTGAGATGAGGG - Intronic
1010582754 6:77619742-77619764 TGGTACATGAAGGGAGATGGGGG - Intergenic
1010678251 6:78768927-78768949 TTGTATATGGAGAGAGATAGTGG - Intergenic
1011007229 6:82659876-82659898 TTGTATAAAAAGATAAATGAGGG + Intergenic
1011045834 6:83081518-83081540 TTGTATATGGTGAGAGATAAGGG - Intronic
1011138273 6:84123545-84123567 TTGTATATGATGAGAGGTAAGGG - Intergenic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1011225074 6:85096406-85096428 TTGTATATGGTGAGAGATTAGGG + Intergenic
1011231069 6:85162824-85162846 TATTATATGAAGAAAGATAATGG + Intergenic
1011309135 6:85962414-85962436 TTGTATGTGGCGAGAGATAAGGG + Intergenic
1011465948 6:87657152-87657174 GTGTATATGTAGAGTAATGATGG - Intronic
1011586827 6:88935102-88935124 TTGTATATGGTGAGAGATAAAGG + Intronic
1011595975 6:89016508-89016530 TTGTAAATGATGAGAGATAGGGG - Intergenic
1011867024 6:91841958-91841980 TTGTATACGGTGAGAGATAAGGG + Intergenic
1011970458 6:93216069-93216091 TTGTATATGGTGAGAGATAGAGG + Intergenic
1012225340 6:96697237-96697259 TTGTATATGGTGAGAGATAAAGG - Intergenic
1012256107 6:97034190-97034212 TTGCATATGATGTGAGATAAGGG + Intronic
1012256402 6:97037989-97038011 TTGTGTATGGTGAGAGATAAGGG - Intronic
1012297465 6:97542614-97542636 TTGTATATGGTGAGAGATAATGG + Intergenic
1012320374 6:97837493-97837515 TTGTATAAGGTGAGAGATGGTGG - Intergenic
1012712498 6:102625468-102625490 TTGTATATGTTGAGAGATAGGGG + Intergenic
1013541661 6:111116695-111116717 TTGCATGTGAGGAGAGATCAAGG + Intronic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014081755 6:117295306-117295328 TTGTATATGTAGAGAGATAGGGG - Intronic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014093141 6:117428194-117428216 TTGTATATGGAGAGAGATAGGGG + Intronic
1014396816 6:120933759-120933781 TTATATATGATGAGAGATACAGG - Intergenic
1014407714 6:121071157-121071179 TTGTATATGGTGAGAGATAGGGG - Intergenic
1014463289 6:121725054-121725076 TTGTATATGAAAGCAGAAGATGG - Intergenic
1014498774 6:122160470-122160492 TTGTATATGCTGAGAGGTGGGGG + Intergenic
1014608565 6:123511153-123511175 TTGTATATGGTGAGAGATAGAGG + Intronic
1014626763 6:123735681-123735703 TTGTATATGGTGAGAGATAGGGG - Intergenic
1014865443 6:126523459-126523481 TTGTATATGGTGTGAGATAAGGG + Intergenic
1014872756 6:126615859-126615881 TTGTATATGATGAAAGGTAAGGG - Intergenic
1014901784 6:126974586-126974608 TTCTATGAGAAGAGAAATGACGG + Intergenic
1015030722 6:128592006-128592028 TTGTATATGGTGAGAGATAGAGG - Intergenic
1015073616 6:129128170-129128192 TTGTATATGATGTGAAATAAGGG + Intronic
1015104728 6:129522412-129522434 GTGAAGGTGAAGAGAGATGACGG + Intergenic
1015175843 6:130307795-130307817 TTGTATAAGCAGATAGATGCTGG + Intronic
1015393155 6:132706474-132706496 TTGTATATGGTGAGAGATAGGGG - Intronic
1015675968 6:135749232-135749254 TTGTATATGGTGAGAGATAGGGG + Intergenic
1015711844 6:136150381-136150403 TTGTATATGGTGAGAGATGAGGG + Intronic
1016136482 6:140550214-140550236 TTGTATATGGTGAGAGATAAGGG + Intergenic
1016263984 6:142210235-142210257 TTGTGTAGGATGAGAGATGGGGG - Intronic
1016541966 6:145176548-145176570 TTGTATATGGTGAGAGATAGGGG - Intergenic
1016567144 6:145468600-145468622 TTGTATATGATGAGAGATAGAGG - Intergenic
1016571032 6:145512884-145512906 TTGTATATGGTGAGAGATAGTGG - Intronic
1016604134 6:145899509-145899531 TTGTATATGCGGTGAGATAAGGG - Intronic
1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG + Intronic
1017059957 6:150473670-150473692 TTGTATATCATGAGATATGTGGG + Intergenic
1017287472 6:152692693-152692715 TTGTATATGGTGTGAGATAAAGG + Intergenic
1017397767 6:154022722-154022744 TTGTATATGGTGAGAGATAAGGG + Intronic
1017612917 6:156210514-156210536 TTGTATATGATGAGAGACAGAGG + Intergenic
1017614075 6:156226297-156226319 TTGTATATGGCGAGAGATAGGGG - Intergenic
1017655941 6:156630126-156630148 TTGTACATGACCAGAGATCATGG - Intergenic
1017998022 6:159550619-159550641 TTGAATATGGTGAGAGATAAGGG + Intergenic
1018053837 6:160035103-160035125 TTGTAGCTGTAGAGAGATGATGG + Intronic
1018273046 6:162101250-162101272 TTGTATATGAGGTCAGATAAGGG + Intronic
1018361364 6:163073400-163073422 TTGTATATGGTGAGAGATGGGGG - Intronic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018634753 6:165851015-165851037 GTGTATAGGAAGAGAAAGGAAGG + Intronic
1019090231 6:169524749-169524771 TTGTATATGAGGAGGGATAGGGG - Intronic
1019098305 6:169605925-169605947 TTGTGTATGGGGAGAGATAAGGG - Intronic
1020423614 7:8038573-8038595 TTGTATATGATAAGAGATATAGG - Intronic
1020518866 7:9160900-9160922 TTGTATATGGCAAGAGATAAGGG + Intergenic
1020527996 7:9288684-9288706 TTGTATATGTTGAGAGATAGGGG + Intergenic
1020574411 7:9907470-9907492 TTGTATATGATGAGAGAGAGGGG + Intergenic
1020604302 7:10316837-10316859 TTGTATATGGTGTGAGATAAGGG - Intergenic
1020716854 7:11685192-11685214 TTGTATATGATGAGAGGTATAGG - Intronic
1020744244 7:12061572-12061594 TTGTATATGGTGTGAGATAATGG - Intergenic
1020775475 7:12449207-12449229 TTGTATATCACGAGAGATAGAGG - Intergenic
1020934157 7:14439478-14439500 TTATCTATGAGGAGAGAGGATGG - Intronic
1020970312 7:14929894-14929916 TTGTATATGTTGAGAGATAGGGG + Intronic
1020988324 7:15164212-15164234 TTGTATATGGTGAGAGATAGGGG - Intergenic
1021070134 7:16227914-16227936 TTGTATATGGTGTGAGATAAGGG + Intronic
1021354181 7:19633737-19633759 TTGTATATGGTGAGAGATAGGGG - Intergenic
1021381108 7:19967509-19967531 GTGAAAATGAAGAGGGATGACGG - Intergenic
1021437375 7:20635075-20635097 TTGTATATGGTGAGAGATAAGGG + Intronic
1021471668 7:21009581-21009603 TTTTATATGATGACAGATAAGGG - Intergenic
1021527448 7:21604736-21604758 TTGTGTTTGAAGAGGGATAAGGG + Intronic
1021610220 7:22450347-22450369 TTGTATATGGTGAGAGATAGGGG + Intronic
1021752862 7:23821825-23821847 TTATATATGGTGAGAGGTGAGGG + Intronic
1021956262 7:25827702-25827724 TTGTATATGATGAGAAATAAGGG - Intergenic
1022061682 7:26802937-26802959 TTGTATATGGTGAGAGATAGGGG - Intronic
1022236965 7:28471245-28471267 TTACATATGATGAGAGATGGGGG + Intronic
1022549285 7:31222426-31222448 TTGTATATGATGAGAGATAGGGG + Intergenic
1022756858 7:33302450-33302472 TTGTATATGGTGAGAGATAGGGG + Intronic
1022784208 7:33621042-33621064 TTGTATATGATGTGAGATAAGGG - Intergenic
1022940578 7:35233482-35233504 ATATATATGAAGAGAGATACAGG + Intronic
1023347141 7:39282455-39282477 TTGTATGTGATGAGAGATGGGGG + Intronic
1023640890 7:42256454-42256476 CTGCATATGATGTGAGATGAGGG + Intergenic
1023696080 7:42848561-42848583 TTGTATATGGTGTGAGATAAGGG - Intergenic
1023720307 7:43086413-43086435 TTGTATATGAGGAGAGATATGGG - Intergenic
1024199588 7:47092015-47092037 TTGTATATGGAGAGAGGTGGGGG - Intergenic
1024663866 7:51526321-51526343 TTGTATATGGTGAGAGATGTGGG - Intergenic
1024681242 7:51691203-51691225 TTATATATGTTGAGAGATGGGGG + Intergenic
1024708682 7:51990407-51990429 TTGTATATTATGATAGATAAGGG + Intergenic
1024713383 7:52044302-52044324 TTGTTTATAAAGAGATCTGAGGG - Intergenic
1024882604 7:54106185-54106207 TTGTATATTAGTAGAGATGGGGG + Intergenic
1024898467 7:54288753-54288775 TTGTATATGGTGAGAGATAGGGG - Intergenic
1025603347 7:63020410-63020432 TTGTATATGAAAAGAGATAGGGG + Intergenic
1025776373 7:64564225-64564247 TTGGAACTGAAGAGAGATGTTGG - Intergenic
1025848250 7:65219210-65219232 TTGGAACTGAAGAGAGATGTTGG - Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1027776199 7:82467613-82467635 TGGGAAATGAAGGGAGATGATGG - Intergenic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1027921546 7:84401829-84401851 TTTTATATGATGACAGATAAAGG - Intronic
1027949465 7:84795925-84795947 TTGTATATGGTGAAAGATGGGGG + Intergenic
1028040884 7:86053039-86053061 TTGTATATGATGAAAGATAGGGG + Intergenic
1028183875 7:87757972-87757994 TTGTATATGGTGAGAGATTGAGG - Intronic
1028186699 7:87794940-87794962 TTGTATATGGTGAGAGATACAGG - Intronic
1028284277 7:88975948-88975970 TTGTATATGGTGAGAGATAGGGG + Intronic
1028379041 7:90177378-90177400 TTGTATATGGTGAGAGATAGGGG - Intronic
1028521548 7:91736816-91736838 TTGTATATGGCGAGAGATAGTGG + Intronic
1028524278 7:91765903-91765925 TTGTATTTGGTGAGAGATGGGGG - Intronic
1028532833 7:91857281-91857303 TTGTATATGGTGAGAGATGGGGG - Intronic
1028591103 7:92496261-92496283 CTGTATATGAATACAGAAGATGG - Intronic
1028787430 7:94811632-94811654 TTGTATATGGTGAGAGATAGGGG - Intergenic
1028933029 7:96435110-96435132 TTGTACATGGTGAGAGATGGGGG + Intergenic
1029070935 7:97896991-97897013 TTGTAAGTGATGAGAGATAAGGG - Intergenic
1029862433 7:103587348-103587370 TTGTATATGGTGAGAGATATGGG - Intronic
1030168463 7:106577828-106577850 TTGTAGATGAAGAGCAATGAAGG - Intergenic
1030593893 7:111512920-111512942 TTGTATATGGTGTGAGATAAGGG - Intronic
1030706022 7:112693909-112693931 TTGTATATGGTGAGAGATAGGGG + Intergenic
1030785510 7:113656140-113656162 TTGTATATGATGTGAGAAGGGGG - Intergenic
1030853256 7:114517484-114517506 TTGTTTATGGTGTGAGATGAGGG + Intronic
1030880877 7:114877532-114877554 TTGTATAAGGTGAGAGATAAAGG + Intergenic
1031023392 7:116652599-116652621 TTGGATGAGAAGGGAGATGAGGG + Intergenic
1031033061 7:116755689-116755711 TTGGATTTGAAGAGAGAGAAAGG + Intronic
1031260400 7:119511199-119511221 TTGCATATGGTGAGAGATGAGGG - Intergenic
1031271972 7:119662860-119662882 TTGTATATGGCAAGAGATAAGGG - Intergenic
1031506445 7:122590582-122590604 TTATATATGAATATATATGAAGG - Intronic
1031623842 7:123969460-123969482 TTGTATATGTTGAGAGATAGGGG + Intronic
1031653157 7:124316814-124316836 TTGTATATGATGTGAGATAGTGG - Intergenic
1031802256 7:126262412-126262434 TTGTATGTGGTGAGAGATAAGGG + Intergenic
1031846472 7:126811042-126811064 TTGTATATGGTGAGAGATAGAGG + Intronic
1031892684 7:127313269-127313291 TTGTATATGGTGAGAGATAGGGG - Intergenic
1033270248 7:139924829-139924851 TTGTATATGGTGAGAGATAGGGG + Intronic
1033500331 7:141942395-141942417 TTGTATATGTCAAGAGATAAGGG - Intronic
1033638210 7:143233153-143233175 TTGTATATGGAGAGAGATAGGGG + Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1033813832 7:145048938-145048960 TTGTATATGGTGAGAGATAGGGG + Intergenic
1034058111 7:148058155-148058177 TAGTACATGAAGAGAGAGCATGG + Intronic
1034062361 7:148104624-148104646 AATTATATGAAGAGAGATGGAGG + Intronic
1034994053 7:155566728-155566750 TTGTATGTGGTGAGAGATGGGGG - Intergenic
1036067743 8:5402302-5402324 TTGAATATGTAAAGACATGAGGG - Intergenic
1036099878 8:5767985-5768007 TTGTATATGGAGAGAGATAGGGG + Intergenic
1036247652 8:7132964-7132986 TTGTAAGTGATGAGAGATAAAGG + Intergenic
1036253173 8:7181463-7181485 TTGTAAGTGATGAGAGATAAGGG - Intergenic
1036364322 8:8106016-8106038 TTGTAAGTGATGAGAGATAAGGG + Intergenic
1036422247 8:8608358-8608380 TTGTATATGGAAAGAGATAGGGG + Intergenic
1036539992 8:9697269-9697291 TTGTATATGAGGAAAGGTAAGGG - Intronic
1036894230 8:12619180-12619202 TTGTAAGTGATGAGAGATAAGGG - Intergenic
1036956472 8:13193059-13193081 TTGGATAGGAACAGAGAGGAGGG - Intronic
1037353757 8:17995199-17995221 TTGTATATGGTGAGAGATAGAGG + Intronic
1037386663 8:18350902-18350924 TTGTATATGATGAGAGATACAGG - Intergenic
1037621772 8:20570200-20570222 TTGTATATGGTGAGAGATAGGGG + Intergenic
1038225084 8:25648510-25648532 TTCTATATGATGAGAGATAGGGG + Intergenic
1038871688 8:31501934-31501956 TTGTATATGATGAAAGATAGAGG + Intergenic
1038992647 8:32885809-32885831 ATGAATATTAAGAGAGATTAAGG + Intergenic
1039241605 8:35562972-35562994 TTGTATATGGTGACAGATAAGGG + Intronic
1039648856 8:39318529-39318551 TTGTATATGAAAAGATGTGGAGG + Intergenic
1040615729 8:49036448-49036470 TTGTATATGGAGATACATAAGGG - Intergenic
1040623967 8:49123883-49123905 TTGTATATGGCGAGAGATAGGGG + Intergenic
1040720336 8:50313131-50313153 TTGTATATGGGGTGAGATAAGGG - Intronic
1040790351 8:51221756-51221778 TTGTATATGGTGAGAGATAGAGG - Intergenic
1040966872 8:53091270-53091292 TTGTATAGGGTGACAGATGAGGG + Intergenic
1040984949 8:53283537-53283559 TTGTATATGGTGAGAGATAGAGG - Intergenic
1041056147 8:53988580-53988602 TGGTATAAGGAGAGGGATGAAGG + Intronic
1041078966 8:54196705-54196727 TTGTATATGGTGAGAGATATGGG + Intergenic
1041198784 8:55429244-55429266 TTGTATAAGAAGTGAGATTTAGG - Intronic
1041582694 8:59480661-59480683 TTGTATATGACAAGAGATAGGGG + Intergenic
1041940214 8:63379084-63379106 TTGTATATGATGTTAGATAATGG + Intergenic
1041995416 8:64050950-64050972 TTGTATATAATGAGAGATCAGGG - Intergenic
1042032861 8:64495971-64495993 TTGTATATGATGAGAGATAGGGG - Intergenic
1042033550 8:64504640-64504662 TTGTTTATGATGTGAGATAAAGG - Intergenic
1042163105 8:65918409-65918431 TTGTATGTGATGAGAGATAGGGG - Intergenic
1042199330 8:66265723-66265745 TTGTATATGAGGTGAGATATGGG - Intergenic
1042330446 8:67574706-67574728 TTGTATATGGGGTGAGATAAGGG - Intronic
1042628225 8:70783879-70783901 TTGTATATGATTTGAGATAAGGG + Intronic
1042972473 8:74425339-74425361 TGGAATATGAAGACAAATGATGG + Intronic
1043047847 8:75350510-75350532 TAGTACATGAAGAATGATGATGG - Intergenic
1043092040 8:75916897-75916919 TTGTATATGGTGAGAGATAGGGG + Intergenic
1043249065 8:78046939-78046961 TTGTATATGGTGAGAAATGGGGG - Intergenic
1043320988 8:78986471-78986493 TTGTATATGGTGTGAGATAAGGG - Intergenic
1043351823 8:79370847-79370869 TTGTATATGATAAGAGATAGGGG - Intergenic
1043516013 8:80995839-80995861 TAGAATATGATGAGAGATGTGGG + Intronic
1043541908 8:81273469-81273491 TTGTATATGGTAAGAGATAAGGG + Intergenic
1043610671 8:82059133-82059155 TTGTATATGATGAAAGGTGGAGG + Intergenic
1043762824 8:84090607-84090629 TTGTATATGGTGAGAGATAGGGG + Intergenic
1044001775 8:86891260-86891282 TTGTATATGGTGAGAGATAAGGG + Intronic
1044139140 8:88627501-88627523 TTGTATATGTTGAGAGACCAGGG + Intergenic
1044143518 8:88684639-88684661 TTATATATGAAGAGATATATGGG + Intergenic
1044316930 8:90760516-90760538 TTGTATATGGTGAGAGATAGGGG + Intronic
1044468186 8:92532512-92532534 TTGTATATGATGAGACATAGGGG - Intergenic
1044878533 8:96698316-96698338 TTGTATATCATGAAAGATGGGGG - Intronic
1045765242 8:105659845-105659867 TTCTATATAAAAAGAGATTACGG + Intronic
1046046466 8:108971173-108971195 TTGTATATGGTGAGAGATAGCGG + Intergenic
1046103367 8:109640029-109640051 AGGAAGATGAAGAGAGATGAGGG + Intronic
1046242935 8:111522040-111522062 TTGTATTTGATGTGAGATAAGGG + Intergenic
1046534096 8:115486325-115486347 TTGGAGAGGGAGAGAGATGAGGG - Intronic
1047114492 8:121825454-121825476 TTGTATTTAAAAAGAGCTGATGG - Intergenic
1047431185 8:124793740-124793762 TTGTATATGATGAGAGACGGGGG + Intergenic
1047869219 8:129064082-129064104 TTGTATATGGTGTGAGATAAGGG + Intergenic
1047936812 8:129789159-129789181 TTGTATATAGTGAGAGATAAGGG + Intergenic
1048108199 8:131435968-131435990 TTGTATATAATGAGAGATAGGGG - Intergenic
1048115965 8:131522865-131522887 TTGTATATGGTGTGAGAAGAGGG - Intergenic
1048127910 8:131657594-131657616 TTCTATATGAAGAGAGCAAATGG - Intergenic
1048417932 8:134247794-134247816 TTGTATATGGAGAGAGATAGAGG - Intergenic
1048732662 8:137461165-137461187 TTGTCTGTGAACAGAGCTGATGG + Intergenic
1049924175 9:392879-392901 TTCTTTATGGAGAGACATGATGG - Intronic
1050020123 9:1274881-1274903 TTGTATATGATGTTAGATAATGG - Intergenic
1050084983 9:1955508-1955530 TTTTATATGTTGAGAGATAAGGG - Intergenic
1050316497 9:4407261-4407283 TTGTATATGGTGAGAGATAAGGG - Intergenic
1050399411 9:5235356-5235378 TTGAAGATGAAGAGGGATCATGG + Intergenic
1050457721 9:5849506-5849528 TGGTGTGGGAAGAGAGATGAAGG - Intergenic
1050665949 9:7936732-7936754 TTGCATAGCCAGAGAGATGAAGG + Intergenic
1050672098 9:8008930-8008952 TTTTATATGATGTGAGATAAGGG + Intergenic
1050771627 9:9208376-9208398 TTGTTTCTAAAGAGAGGTGAGGG + Intronic
1050779628 9:9316122-9316144 TGGTATAAGATGAAAGATGAAGG - Intronic
1050989345 9:12128682-12128704 TGGTATATGATGTGAGATTAGGG + Intergenic
1051007027 9:12357619-12357641 TTGTATATGATGAGAGATTGGGG - Intergenic
1051012023 9:12428434-12428456 TTGTATATGGTGAGAGATAGGGG - Intergenic
1051313303 9:15800785-15800807 TTGTGTATGACAAGAGATAAGGG + Intronic
1051543181 9:18244304-18244326 TTATACATGAAGAGAAATGAGGG - Intergenic
1051848676 9:21482485-21482507 TTATATGTGAAGAGAGATTGGGG + Intergenic
1051862436 9:21641655-21641677 TTGTATATGGTGAGAGATAGGGG - Intergenic
1051875792 9:21791785-21791807 TTGTATATGGAGTGAGATGAGGG - Intergenic
1052266953 9:26585708-26585730 TTGTATACGGTGTGAGATGAGGG + Intergenic
1052302319 9:26966838-26966860 TTGTATATGGTGAGAGATATGGG + Intronic
1052374976 9:27708764-27708786 TTGTATATGGTGAGAGATAGTGG + Intergenic
1052539239 9:29786710-29786732 TTGTATATGATGAAAGACAAGGG - Intergenic
1052714222 9:32095793-32095815 TTGTATATGGTGAGAGATAGGGG + Intergenic
1052901680 9:33798984-33799006 TTGTATAAAGAGAGAGATGGAGG - Intronic
1052955874 9:34252919-34252941 TTGTATATGATGATAGAATAGGG + Exonic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1053520524 9:38773334-38773356 TTGTATATGGTGAGAGATAAGGG + Intergenic
1053590472 9:39509336-39509358 TTGCATATGGTGAGAGATAAGGG - Intergenic
1053617663 9:39785013-39785035 TTGTATATGGTGAGAGATCAGGG + Intergenic
1053848333 9:42264734-42264756 TTGCATATGGTGAGAGATAAAGG - Intergenic
1053875845 9:42544380-42544402 TTGTATATGGTGAGAGATCAGGG + Intergenic
1053896808 9:42750257-42750279 TTGTATATGGTGAGAGATCAGGG - Intergenic
1054235854 9:62557342-62557364 TTGTATATGGTGAGAGATCAGGG - Intergenic
1054266498 9:62922419-62922441 TTGTATATGGTGAGAGATCAGGG - Intergenic
1054341638 9:63869170-63869192 TTTTATATGATGAGAGATAGGGG + Intergenic
1054549994 9:66591869-66591891 TTGTATATGGTGAGAGATCAGGG - Intergenic
1054575831 9:66855953-66855975 TTGCATATGGTGAGAGATAAGGG + Intergenic
1054837500 9:69693341-69693363 TTGTATATGGTGAGAGATAGGGG + Intergenic
1054838710 9:69710660-69710682 TAGTATATGGAGAGAGCTAAAGG + Intronic
1054868800 9:70029787-70029809 TTGTATATGGCGAGAGATAGGGG + Intergenic
1054908699 9:70433698-70433720 TTGTATATGGTGAGAGATGGGGG + Intergenic
1054983041 9:71229285-71229307 TTGTATATGGTGAGAGATAGGGG - Intronic
1055001149 9:71450290-71450312 TTGTGTAGGAAGAGAGTTAATGG - Intergenic
1055037580 9:71834822-71834844 TTGTATATGATGAGAAATAGAGG - Intergenic
1055061200 9:72070882-72070904 TTGTATAAGGTGAGAGACGAGGG - Intronic
1055238421 9:74153364-74153386 TTGTATATGGTGAGAGATAGGGG + Intergenic
1055442354 9:76348900-76348922 TTTTAAATGAAGAGAAATTAAGG - Intronic
1055579618 9:77693929-77693951 TTGTATATGATGAGAGATAGAGG + Intergenic
1055683837 9:78748088-78748110 TTGTATATGGTATGAGATGAGGG + Intergenic
1055684752 9:78759586-78759608 TTGTATGTGATGAGAGATAGGGG - Intergenic
1056488037 9:87078490-87078512 TCTTATATGAAGAGACAAGAGGG + Intergenic
1056510819 9:87303678-87303700 TTGTATATGGTGTGAGATAAAGG - Intergenic
1056734358 9:89194064-89194086 TTGTATATGGGGAGAGATAGAGG - Intergenic
1057288652 9:93783625-93783647 TTGTGTATGATGAGAGATAGCGG + Intergenic
1057374511 9:94507229-94507251 TTGTATATGATGTGAGATAAAGG - Intergenic
1057562857 9:96141542-96141564 TCATCTTTGAAGAGAGATGAAGG + Intergenic
1058013100 9:99999848-99999870 TTGTATACGGGGCGAGATGAGGG + Intronic
1058297470 9:103327018-103327040 TTCTCTGTAAAGAGAGATGAGGG + Intergenic
1058303205 9:103402448-103402470 TTGTATATGGTGAGATATAAGGG - Intergenic
1058331936 9:103772817-103772839 TTGTATATGGTGAGAGATACGGG + Intergenic
1058340809 9:103893889-103893911 TTGTATATGGTGAGAGGTGGGGG - Intergenic
1058522371 9:105823473-105823495 TTGTGTATGATGAGAGATAGGGG + Intergenic
1058718778 9:107744737-107744759 GTGTATATGAGAAGAGATGCAGG - Intergenic
1058768204 9:108204003-108204025 TTTTATATGGTGAGAGATAAGGG - Intergenic
1059030147 9:110684153-110684175 TTGTATATGGAGAGAGATAGGGG + Intronic
1060079666 9:120631151-120631173 TTGTATATGGTGAGAGATAAAGG + Intronic
1060097200 9:120802103-120802125 TTGTATATAGTGTGAGATGAGGG + Intergenic
1060122810 9:121010949-121010971 TTGTATATGGCAAGAGATAAGGG - Intronic
1060263656 9:122096417-122096439 TTGTCTAAGAACAGACATGAAGG - Intergenic
1060324485 9:122599724-122599746 TTGTCTATGGTGAGAGATGGAGG + Intergenic
1060383145 9:123196193-123196215 TTGTATATGATGAAAGATAGGGG - Intronic
1061297700 9:129685980-129686002 TTGTCTAAGAAGAGAGGTGAGGG + Intronic
1203450458 Un_GL000219v1:109131-109153 TTGTGTATGATGAGAGATAGTGG + Intergenic
1203631994 Un_KI270750v1:79229-79251 TTGTCTATTACAAGAGATGATGG + Intergenic
1185748029 X:2587209-2587231 TTGTATATGGTGAGGGATGGGGG - Intergenic
1186248468 X:7640212-7640234 CTGTGTATGAAGAGAGTAGAGGG + Intergenic
1186329858 X:8520213-8520235 CTGTAAAGGAACAGAGATGAAGG + Intergenic
1186380461 X:9053408-9053430 TTATGGAAGAAGAGAGATGAAGG + Intronic
1186657051 X:11624192-11624214 TTGCATATGATGAGAGATAGGGG - Intronic
1187178711 X:16921710-16921732 TTGTATATGGTGAGAGAGGGGGG - Intergenic
1187214222 X:17260334-17260356 TTGTATATGGTGAGAGATAGGGG - Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1187620863 X:21052962-21052984 TTGTGTATGGAGTGAGATAAGGG - Intergenic
1187780151 X:22812272-22812294 TTGTACATGGTGTGAGATGAGGG - Intergenic
1188045184 X:25417574-25417596 TTGTATATGGCGAGAGATAGGGG + Intergenic
1188077795 X:25800191-25800213 TTGTATATGGTAAGAGATAAAGG + Intergenic
1188118420 X:26274873-26274895 TTGTATATTACAAGAGATGGGGG + Intergenic
1188264984 X:28062174-28062196 TTGTATATGGAGAGAGATAAGGG + Intergenic
1188265607 X:28069583-28069605 TTGTATATGGTGAGAGATAGGGG + Intergenic
1188265748 X:28071722-28071744 TTGTATATGGTGAGAGATACAGG - Intergenic
1188266471 X:28082129-28082151 TTGTCTATGATGAGAGATAAAGG - Intergenic
1188332359 X:28890878-28890900 TAATGTATGAAGACAGATGAAGG + Intronic
1188428987 X:30083716-30083738 TTGTAGATCATGAGAGATAAGGG + Intergenic
1188563857 X:31502086-31502108 TTGTATATGGTGAGAGATAGGGG - Intronic
1188668604 X:32855632-32855654 TTGTATATGGCGAGAGATAAGGG - Intronic
1188814004 X:34688493-34688515 TTGTATATGTTGAGAGATAGGGG + Intergenic
1188890366 X:35604651-35604673 TTTTATATTAAGATTGATGAAGG - Intergenic
1188916325 X:35915994-35916016 TTGTATATGACGAGATATATGGG - Intergenic
1188924068 X:36017559-36017581 TTGTATATGGTGAGAGATAGTGG + Intergenic
1188972495 X:36634685-36634707 TTATATATGATGAGAAATAAGGG + Intergenic
1188996511 X:36892989-36893011 TTGTATATGGTGAGAGATAGGGG - Intergenic
1189129883 X:38486906-38486928 TTGTATATGGTGAGAGATATGGG + Intronic
1189602130 X:42638339-42638361 TTGTTTTTGAGGAGAGAAGAGGG + Intergenic
1189659719 X:43284663-43284685 TTGTATATGGTGAGAGATAGGGG + Intergenic
1189858169 X:45244784-45244806 TTGTATGTGATGAGAGATAGAGG + Intergenic
1189864887 X:45317251-45317273 TTGTATATGGAAAGAGATAAGGG - Intergenic
1189892072 X:45613296-45613318 TTGTGTATGATGTGAGATAAGGG - Intergenic
1190052365 X:47159793-47159815 TTGTATATGGTGAGAGGTAAGGG - Intronic
1190523423 X:51303593-51303615 TTGTATATGGTGAGAGATAGAGG - Intergenic
1190631430 X:52390790-52390812 TTGTATATGATGTGAGACAAAGG - Intergenic
1190636301 X:52437401-52437423 TTGTATATGGTGAGAGATGAGGG - Intergenic
1190642066 X:52489669-52489691 TTGTATATGGTGAGAGATAGGGG + Intergenic
1190645607 X:52523197-52523219 TTGTATATGGTGAGAGATAGGGG - Intergenic
1190654011 X:52595331-52595353 TTTTATATGGTGAGAGATGAGGG - Intergenic
1190820789 X:53969941-53969963 TTGTATATGGCAAGAGATAAAGG - Intronic
1190822684 X:53988381-53988403 TTGTATATGATGTGAGATAAGGG - Intronic
1190893368 X:54591173-54591195 TTGTATATGGTGAGAGATTGGGG + Intergenic
1190943092 X:55062773-55062795 TTGTATATGGTGAGAGATAGGGG + Intergenic
1191130878 X:57008910-57008932 TTGTATATGGCAAGAGATGGGGG + Intergenic
1191611526 X:63119909-63119931 TTGTATATGGTGAGAAATAAAGG - Intergenic
1191691357 X:63941976-63941998 TTGTATATGGGGTGAGATAAGGG - Intergenic
1191704075 X:64075207-64075229 TTGTATATGGTGAGAGATGGGGG - Intergenic
1191794627 X:65007773-65007795 TTGTATATGGTGAGAGATAGGGG - Intronic
1191916978 X:66212488-66212510 TTGTATATGGTGAGAGATATAGG + Intronic
1191967121 X:66771235-66771257 TTGTATATGGTGAGAGATAGGGG + Intergenic
1192064983 X:67873962-67873984 TTGTATATGGTGAGAGATAAAGG + Intergenic
1192138166 X:68625557-68625579 TTGTATATGGTGTGAGATAAGGG + Intergenic
1192153901 X:68728802-68728824 TTGTATATGGAGAGAGATAGGGG - Intergenic
1192291370 X:69799159-69799181 TTGTGTATGATGAGAGATTGGGG - Intronic
1192394639 X:70766934-70766956 TTGTATATGATGAGAGATAGGGG - Intronic
1192512795 X:71734796-71734818 TTGTATATGATGTGAGACAAGGG + Intergenic
1192513902 X:71746713-71746735 TTGTATATGATGTGAGACAAGGG - Intergenic
1192596719 X:72417093-72417115 TTGTAAATAAATAGTGATGATGG - Intronic
1192633556 X:72795910-72795932 TTGTATATGGTGAGAGATAGGGG + Intronic
1192648154 X:72924891-72924913 TTGTATATGGTGAGAGATAGGGG - Intronic
1192658529 X:73018485-73018507 TTGTATATGATGTGAGAAAAGGG + Intergenic
1192785097 X:74327283-74327305 TTGTATATGGCGAGAGATAGAGG - Intergenic
1192821118 X:74646778-74646800 TTGTATATGATGATAGATAGTGG + Intergenic
1192842365 X:74870290-74870312 TTGTATATGATGAGAGATGGGGG - Intronic
1192853065 X:74978044-74978066 TTGTATATGATGAGAGATAAGGG + Intergenic
1192893024 X:75410055-75410077 TTGTATACGGAGAGAGATATGGG - Intronic
1192959916 X:76118098-76118120 TTGTATATGGTGAGAGATAGGGG - Intergenic
1192978403 X:76312157-76312179 TTGTATAAGGTGAGAGATGAGGG + Intergenic
1192980756 X:76338028-76338050 TTGTATATCATGATAGGTGAAGG - Intergenic
1192990177 X:76443995-76444017 TTGTATATGATGAGAAATAAGGG + Intergenic
1193045822 X:77052761-77052783 TTGTATATGGTGAGTGATAAAGG - Intergenic
1193072908 X:77325294-77325316 TTGTAAATGGCGAGAGATGGTGG - Intergenic
1193134705 X:77957806-77957828 TTGTATATGATGAGAGGTAGGGG + Intronic
1193167354 X:78296070-78296092 TTGTATATGGTAAGAGATGGGGG + Intronic
1193175750 X:78390107-78390129 TTGTATATGGCAAGAGATGGGGG - Intergenic
1193175758 X:78390213-78390235 TTGTATATGGTGAGAGATAGGGG - Intergenic
1193336969 X:80301516-80301538 TTGTATATGGAAAAAGATAAAGG + Intergenic
1193377789 X:80782326-80782348 TTGTATATGGCGAGAGATAGGGG - Intronic
1193446390 X:81609434-81609456 TTGTATATGATGAGAGATGGGGG + Intergenic
1193488032 X:82111545-82111567 TTGTATATGGTGAGAGATAGGGG + Intergenic
1193498737 X:82245122-82245144 TTGTATATGATGAGAGATAGGGG - Intergenic
1193516278 X:82468818-82468840 TTGTATATGGTGTGAGATAAGGG + Intergenic
1193556864 X:82964585-82964607 TTTTATAAGGTGAGAGATGAGGG + Intergenic
1193592011 X:83400698-83400720 TTGTATATGGTGAGAGATTGGGG - Intergenic
1193610247 X:83622859-83622881 TTGTATATTCTGAGAGATAAGGG + Intergenic
1193620195 X:83743499-83743521 TTGTATATGGTGAGAGATAGGGG - Intergenic
1193626449 X:83827542-83827564 TTGTGTATGGTGAGAGATGGAGG - Intergenic
1193671497 X:84392088-84392110 TTGTATATGGTGAGAAATAAGGG + Intronic
1193681443 X:84524288-84524310 TTGTATATGATGTGAGATAAGGG - Intergenic
1193750489 X:85336969-85336991 TTGTATATGGTGAGAGATAGAGG + Intronic
1193843767 X:86442722-86442744 TTGTATATGCCAAGAGATAAGGG + Intronic
1193921841 X:87437684-87437706 TTGTATTTGATGAGAGATACAGG + Intergenic
1193997894 X:88389443-88389465 TTGTATATGATGAGAGATAGGGG - Intergenic
1194003553 X:88462344-88462366 TTGTATATGATGTGAGAAAAGGG - Intergenic
1194057775 X:89158958-89158980 TTGTATATGGTGAGAGATAGGGG + Intergenic
1194379070 X:93172224-93172246 TTGTATATGGTGAGAGATATGGG - Intergenic
1194390329 X:93310236-93310258 TTGTATATGGTGAGAGATAGGGG - Intergenic
1194421796 X:93684173-93684195 TTGTATAGGCAGAGAGGTGGGGG + Intronic
1194441070 X:93935085-93935107 TTGTATATGGTGAGAGATAGGGG + Intergenic
1194573329 X:95579866-95579888 TTGTATATGGTGTGAGATGATGG - Intergenic
1194624050 X:96207757-96207779 TTGTATATGGCAAGAGATAATGG - Intergenic
1194877176 X:99203142-99203164 TTGTATATGGTGAGAGATAGGGG + Intergenic
1194921604 X:99773153-99773175 TTGTATATGGTGAGAGATGGGGG + Intergenic
1195122467 X:101769397-101769419 TTGTATATGGCAAGAGATAAAGG + Intergenic
1195168350 X:102242213-102242235 TTATATAAGATGAGAGATAAGGG + Intergenic
1195190507 X:102444874-102444896 TTATATAAGATGAGAGATAAGGG - Intronic
1195224143 X:102774909-102774931 TTGTACATGATGAGAGATAGGGG + Intergenic
1195250850 X:103045424-103045446 TTGTATATGGTGAGAGATAGGGG + Intergenic
1195277137 X:103292790-103292812 TAGTATATGTAGAGACATGTGGG + Intergenic
1195376522 X:104233188-104233210 TTGTATTTTTAGAGAGATGTTGG - Intergenic
1195415224 X:104612354-104612376 TTGTATATGATGAAAGATAGGGG + Intronic
1195502226 X:105614649-105614671 TTGTATAAGGAGAGAGATATGGG - Intronic
1195632503 X:107072961-107072983 TTGTATAGGATGAGAGATGGGGG - Intronic
1195648093 X:107255120-107255142 TTGTATATGGTGAGAGATAAGGG - Intergenic
1196154470 X:112412673-112412695 TTGTATATGGTGAGAGATAGAGG - Intergenic
1196215231 X:113042889-113042911 TTGTATATGGTGAGAGATAGGGG + Intergenic
1196234802 X:113266526-113266548 TTGTATATGGTGAGAGATAGGGG - Intergenic
1196316037 X:114225029-114225051 TTGTATAGGGTGAGAGATAAGGG - Intergenic
1196331814 X:114479868-114479890 CTATATATGAAGATATATGAAGG + Intergenic
1196381542 X:115096658-115096680 TTGTATATGGTGTGAGATTAGGG - Intergenic
1196485332 X:116200131-116200153 TTGTATAAGAAAAGACATAAGGG + Intergenic
1196507898 X:116470284-116470306 TTGTATCTGGTGAGAGATAAAGG + Intergenic
1196514910 X:116598270-116598292 TTGTATATGGTGAAAGATGGGGG + Intergenic
1196517908 X:116634849-116634871 TTGTATATGGTGAGAGATAGGGG - Intergenic
1196523513 X:116703273-116703295 TTGTATCTGATGAGAGATAAGGG + Intergenic
1196557243 X:117102199-117102221 TTGTATATGGTGAAAGATGAGGG + Intergenic
1196642785 X:118082768-118082790 TTGTATATGGTGAGAGATAAGGG + Intronic
1196921297 X:120588098-120588120 TTGTATATGGTGAGAGATAGGGG - Intergenic
1197010469 X:121555902-121555924 TTGTATATGATGAGAGACAGGGG - Intergenic
1197026534 X:121756664-121756686 TTGTATATGGTGAGAGATATAGG - Intergenic
1197059090 X:122155198-122155220 TTGTATATGATGTGAGATAAGGG - Intergenic
1197068303 X:122261566-122261588 TTGTATATGGTGAGAGATAGGGG + Intergenic
1197078652 X:122384797-122384819 TTGTATATGGTGAGAGATAAGGG - Intergenic
1197086581 X:122483521-122483543 TTGTATATGGTGAGAGATAGGGG - Intergenic
1197090662 X:122532476-122532498 TTGTATATGGTGAGAGATACTGG - Intergenic
1197126325 X:122950332-122950354 TTGTATATGGTAAGAGATAAGGG + Intergenic
1197166015 X:123378581-123378603 TTGTATTTTAGTAGAGATGAGGG + Intronic
1197167480 X:123393812-123393834 CTGTTTATGAATAGAAATGATGG + Intronic
1197367069 X:125576878-125576900 TTGTATATGATGAGAAATAGTGG - Intergenic
1197402895 X:126014007-126014029 TTTTATATGGTGAGAGATAAGGG + Intergenic
1197563734 X:128055332-128055354 TTCTATATGGTGAGAGATAATGG + Intergenic
1197567807 X:128109965-128109987 TTGTATATGTTGAGAGATAGGGG + Intergenic
1197670812 X:129274863-129274885 TTGTATATGGTGAGAGATAAGGG + Intergenic
1197798338 X:130321825-130321847 TTGTATATGGTGAGAGATAGGGG + Intergenic
1197810607 X:130439016-130439038 TTGTATATGGTGAGAGATAGGGG + Intergenic
1198007632 X:132514321-132514343 TTGTATATGGTGAGAGGTAAGGG - Intergenic
1198011228 X:132556774-132556796 TTGTATATGGTGAGAGATAGCGG + Intergenic
1198109544 X:133490839-133490861 TTGTATATGATGAAAGATAAGGG + Intergenic
1198190945 X:134305067-134305089 TTGTATATGGTGAGAGATAGGGG - Intergenic
1198294142 X:135269068-135269090 TTGTATATGGTGAGAGATAGGGG - Intronic
1198367165 X:135952484-135952506 TTGTATATATTGAGAGATCAGGG - Intergenic
1198543269 X:137663278-137663300 TTGTATGTGATGAGATATAAGGG + Intergenic
1198548002 X:137713814-137713836 TTGTATATAATGAGAGATAGAGG + Intergenic
1198842252 X:140870362-140870384 TTATATATGGAGAGAGAGGGGGG - Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199024993 X:142926074-142926096 TTGTATATGTTGAGAGATAGGGG - Intergenic
1199259068 X:145749540-145749562 TTGTATATGGAGAGAGATAGGGG - Intergenic
1199316867 X:146389521-146389543 TTGTATATGTTGAGAGATAGAGG + Intergenic
1199325822 X:146496958-146496980 TTGTGTATGATGAGAGATAGGGG - Intergenic
1199327420 X:146515402-146515424 TTGTATATGGTGAGAGATAGGGG + Intergenic
1199341560 X:146683671-146683693 TTATATATGATGACAGATAAGGG + Intergenic
1199367483 X:147003936-147003958 TTGTATATGATGAAAGGTAAGGG + Intergenic
1199409239 X:147500924-147500946 TTGTATGTGTTGAGAGATAAGGG - Intergenic
1199867039 X:151861085-151861107 CTGTGCATGAAGAGAAATGAAGG - Intergenic
1199915766 X:152338703-152338725 TTGTGTATGATGAGAGATAGGGG + Intronic
1200272810 X:154702330-154702352 TTGTATATGGTGAGAGATAGGGG - Intronic
1200304171 X:155008085-155008107 TTGTACAGCAAAAGAGATGAGGG + Intronic
1200319530 X:155172490-155172512 TTGTATATGGTGTGAGATAAGGG + Intergenic
1200333986 X:155328923-155328945 TTGTATATGGTGAGAGATAGGGG - Intronic
1200365174 X:155655528-155655550 TTGTATATGGTGAGAGATATGGG + Intronic
1200666745 Y:6034431-6034453 TTATACTTGAAGAGAGAAGAGGG - Intergenic
1200723684 Y:6638341-6638363 TTGTATATGGTGAGAAATAAGGG + Intergenic