ID: 1183319449

View in Genome Browser
Species Human (GRCh38)
Location 22:37156152-37156174
Sequence CAGAGGGAACAGGAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183319449_1183319455 6 Left 1183319449 22:37156152-37156174 CCTCCAGCCTCCTGTTCCCTCTG No data
Right 1183319455 22:37156181-37156203 TCCATACCAGTCCCACACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183319449 Original CRISPR CAGAGGGAACAGGAGGCTGG AGG (reversed) Intronic
No off target data available for this crispr