ID: 1183319905 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:37158793-37158815 |
| Sequence | CTTGGCTGCTAGCAGTGTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1183319905_1183319913 | 29 | Left | 1183319905 | 22:37158793-37158815 | CCTGGACACTGCTAGCAGCCAAG | No data | ||
| Right | 1183319913 | 22:37158845-37158867 | TCCCTGAGTCACCAGGCCCGTGG | 0: 1 1: 0 2: 0 3: 13 4: 176 |
||||
| 1183319905_1183319912 | 22 | Left | 1183319905 | 22:37158793-37158815 | CCTGGACACTGCTAGCAGCCAAG | No data | ||
| Right | 1183319912 | 22:37158838-37158860 | GAAACTGTCCCTGAGTCACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1183319905 | Original CRISPR | CTTGGCTGCTAGCAGTGTCC AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||