ID: 1183319905

View in Genome Browser
Species Human (GRCh38)
Location 22:37158793-37158815
Sequence CTTGGCTGCTAGCAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183319905_1183319913 29 Left 1183319905 22:37158793-37158815 CCTGGACACTGCTAGCAGCCAAG No data
Right 1183319913 22:37158845-37158867 TCCCTGAGTCACCAGGCCCGTGG 0: 1
1: 0
2: 0
3: 13
4: 176
1183319905_1183319912 22 Left 1183319905 22:37158793-37158815 CCTGGACACTGCTAGCAGCCAAG No data
Right 1183319912 22:37158838-37158860 GAAACTGTCCCTGAGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183319905 Original CRISPR CTTGGCTGCTAGCAGTGTCC AGG (reversed) Intronic
No off target data available for this crispr