ID: 1183323699

View in Genome Browser
Species Human (GRCh38)
Location 22:37180301-37180323
Sequence GCCGAGGAGCCGTGGCTCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183323699_1183323702 3 Left 1183323699 22:37180301-37180323 CCATGGAGCCACGGCTCCTCGGC 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1183323702 22:37180327-37180349 GAGCACCAGAGATCACCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 117
1183323699_1183323703 4 Left 1183323699 22:37180301-37180323 CCATGGAGCCACGGCTCCTCGGC 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1183323703 22:37180328-37180350 AGCACCAGAGATCACCCCCCGGG 0: 1
1: 0
2: 2
3: 11
4: 137
1183323699_1183323704 5 Left 1183323699 22:37180301-37180323 CCATGGAGCCACGGCTCCTCGGC 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1183323704 22:37180329-37180351 GCACCAGAGATCACCCCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183323699 Original CRISPR GCCGAGGAGCCGTGGCTCCA TGG (reversed) Exonic
900217867 1:1491197-1491219 GCCGAGGAGCCGAGACTCACTGG + Intronic
901003742 1:6161621-6161643 GCTTGGGAGCCGTGGCTCCAGGG - Intronic
901678098 1:10898494-10898516 GGCGGGGAGCCGGGGCGCCAGGG - Intergenic
902548508 1:17205487-17205509 GCCCAGGAGCTGGGGCCCCAAGG - Intronic
903010081 1:20323554-20323576 CCCGAGGACCCGGGGCTCCAGGG + Intronic
904751149 1:32741988-32742010 GCCGAGGAGCCGGGGAACCCGGG + Exonic
904806826 1:33137939-33137961 GCCGAGGAGCTGAGGGTCCAGGG + Intergenic
910676420 1:89821101-89821123 GCGGAGGAGCCGGGGCACCACGG - Exonic
911039022 1:93577911-93577933 GGCAAGCAGGCGTGGCTCCAGGG - Intronic
916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG + Intronic
916133544 1:161631960-161631982 GCCTAGGATCCAGGGCTCCAGGG + Intronic
918177710 1:182060102-182060124 GCCAAGGAACCTTGGCTACAGGG + Intronic
918481483 1:184982355-184982377 GCCCAGTAGCTGTGGCCCCACGG - Intergenic
922456604 1:225778303-225778325 GGGGAGGAGCCCTGGCTTCAGGG - Intronic
922737820 1:227998849-227998871 GCACAGGAGACATGGCTCCAAGG - Intergenic
1064251625 10:13710514-13710536 GCCTGGGAGCCGGGACTCCATGG - Intronic
1064312092 10:14220708-14220730 GCAGAGGAGGGGTGCCTCCATGG + Intronic
1064642470 10:17428589-17428611 GCCGCTGAGCTGTGTCTCCAGGG + Intronic
1072190370 10:93072951-93072973 GCCCAGGAGTCCTGGCTCCGAGG - Intergenic
1073113096 10:101074291-101074313 GCCAAGGAGCTGTGGCTCAAAGG + Intergenic
1074214722 10:111373105-111373127 GCCAAGGATGCGTGGCTCAAAGG - Intergenic
1075091819 10:119448085-119448107 GCCCAGGGGACGTGGCTTCATGG + Intronic
1075656116 10:124162347-124162369 GAGGAGGAGCCGTGGCATCAAGG + Intergenic
1076879229 10:133231725-133231747 GCCGAGGAGGCCAGGCTCGAGGG + Intergenic
1076903408 10:133350820-133350842 GGGGAGGACCAGTGGCTCCAGGG - Intronic
1077401515 11:2360425-2360447 GCCTAGGGGCCTTGGTTCCAAGG + Intergenic
1077497855 11:2895213-2895235 GCTGAGGGGCCAGGGCTCCAGGG + Intronic
1081813988 11:45928595-45928617 GCAGAGGAGCAGTGGCTGCCTGG - Intronic
1084128683 11:67118170-67118192 GCCGAGGAGCGGGGGCTTCCTGG + Intergenic
1084551122 11:69842847-69842869 CACAAGGAGCCGTAGCTCCAGGG + Intergenic
1100362246 12:93889592-93889614 GAGGAAGGGCCGTGGCTCCATGG + Intronic
1113082501 13:106534304-106534326 GCCAAGGCGCCCCGGCTCCAGGG + Intronic
1113505436 13:110812987-110813009 GCTGAGGAGCGGGAGCTCCAGGG + Intergenic
1118762735 14:68890473-68890495 GCCCAGGAGGCCTGGCTCCTGGG - Intronic
1119098163 14:71853761-71853783 GCGGAAGAGCAGTGGCTTCAAGG + Intergenic
1122200724 14:100121031-100121053 GGCGACGAGAGGTGGCTCCAAGG + Intronic
1124957220 15:34367303-34367325 GCGGAGGAGCAGGGGCGCCAGGG - Intergenic
1126574396 15:50182928-50182950 GCCGAGAAGCCCTGGTGCCAGGG - Intronic
1127826628 15:62709396-62709418 GCAGAGGAGCAGTGTCTCCTGGG + Intronic
1128395100 15:67216863-67216885 GCAGAAGAGCAGTGCCTCCAGGG + Intronic
1128451369 15:67807571-67807593 GGTGAGGAGCTGAGGCTCCAAGG + Intergenic
1129196768 15:73973177-73973199 ACCTAGGAGCCGAGGCTCCCAGG + Intergenic
1130064667 15:80593862-80593884 GCCGAGCAGCCGCGGCTGCAGGG - Exonic
1132873107 16:2124320-2124342 CCTGAGGGGCCGAGGCTCCAGGG - Intronic
1132934739 16:2474734-2474756 GCTGAGGAGCTGTGGCGCCGAGG - Intergenic
1134552196 16:15143501-15143523 CCTGAGGGGCCGAGGCTCCAGGG - Intergenic
1137983849 16:53091464-53091486 GCAGGGGATCCCTGGCTCCAGGG - Intronic
1139705356 16:68737422-68737444 GCCGAGAGGCTGCGGCTCCAAGG - Exonic
1141715979 16:85727084-85727106 GCCCAGGTGCCGGGGCTACAGGG - Intronic
1143506415 17:7368176-7368198 GCCGAGGAGACGGGGCACCGTGG - Intergenic
1145029805 17:19495748-19495770 GCCGCGTAGCGGTGCCTCCATGG + Intronic
1146400320 17:32496162-32496184 TCCGACGTGCGGTGGCTCCACGG + Intronic
1146685815 17:34841018-34841040 GGCGAGGAGCAGGGGCCCCAAGG - Intergenic
1148131883 17:45267055-45267077 GCCCCGGAGCCATGGCTCCAGGG - Intronic
1148782647 17:50130283-50130305 GCCGAGCAGCCGGGGCGCCGAGG + Intergenic
1149085502 17:52710505-52710527 GGAGAGGAGCCCTGTCTCCAGGG + Intergenic
1152087903 17:78231674-78231696 GCTGAGGAGCCGGGGGTTCAGGG + Exonic
1152552821 17:81038348-81038370 GCAGAGAAGCCCTGGCTCCCAGG + Intronic
1152575977 17:81141068-81141090 GGCTAGGAGCCGTGGATGCAAGG + Intronic
1153900619 18:9614513-9614535 CCCGGGGAGCCGGGGCTACATGG + Exonic
1156461870 18:37325789-37325811 CCCCAGGAGCCATGGCTGCATGG - Intronic
1160504346 18:79418583-79418605 TCCAGGGAGCTGTGGCTCCAAGG - Intronic
1161424727 19:4196904-4196926 CCGGAGGAGCCGTGGGTCCCAGG + Intronic
1162303444 19:9857279-9857301 GGCGTGGAGCCGGGCCTCCAGGG + Exonic
1163557242 19:17999721-17999743 GGCGAGGAGGCCTGGCTCCTGGG + Exonic
1165075642 19:33278695-33278717 CCCGAGGTGCCGCAGCTCCAGGG - Intergenic
1166981644 19:46635068-46635090 GCCAATTAGCAGTGGCTCCAGGG + Intergenic
1168264853 19:55217114-55217136 GCCAGGGAGCCTTGGCTGCAGGG - Intergenic
927136111 2:20097681-20097703 GATGAGAAGCTGTGGCTCCAGGG + Intergenic
935827734 2:106968420-106968442 GCAGAGTAGCCATGGCTGCAGGG - Intergenic
937248897 2:120511191-120511213 GTCCAGGTGCCGGGGCTCCAGGG + Intergenic
947953125 2:234164980-234165002 GGCGAGCAGCCGAGGGTCCATGG + Intergenic
948823742 2:240564320-240564342 GCCGTGGTGCCGTGGGACCATGG - Intronic
948969675 2:241415324-241415346 GCAGAGGGCCCTTGGCTCCATGG - Intronic
1175572469 20:60034488-60034510 GCCTCGGAGCCGTGGCTACCAGG + Intergenic
1179954881 21:44733066-44733088 GCGGGGCAGCCGGGGCTCCACGG - Intergenic
1179992358 21:44954614-44954636 GCTGAGGAGCCCAGGCTGCAGGG - Intronic
1180666736 22:17519229-17519251 GTGGAGGAGCAGTGGCTGCACGG - Intronic
1180740503 22:18050210-18050232 GGCAGGGAGCCATGGCTCCAGGG + Intergenic
1181169146 22:20998504-20998526 CCCAAGGAGCTGTGGCTTCATGG - Exonic
1181639543 22:24189429-24189451 GCCAAGGAGCCGAGGCTGCAGGG - Intergenic
1183323699 22:37180301-37180323 GCCGAGGAGCCGTGGCTCCATGG - Exonic
1183490846 22:38114888-38114910 CCAGAGGCGCCCTGGCTCCAGGG + Intronic
1184747807 22:46466134-46466156 GCAGAGGACCAGTGGCTCTAAGG + Intronic
1184781754 22:46653194-46653216 TCCGAGGAGCCCTGTCTGCAAGG + Intronic
1184837416 22:47032145-47032167 GAAGAGGAGCCGTGGCTCACCGG - Intronic
1185116044 22:48938884-48938906 GGCGAGGAGCCCGGGCTGCATGG - Intergenic
953666382 3:44929063-44929085 GCCCAGCAGCCGTGGCTGAAAGG - Intronic
961723199 3:128909390-128909412 GCGGAGCAGCAGTGTCTCCACGG - Exonic
962990397 3:140572600-140572622 GCTGAGGAGCAGTGGTTCCCTGG + Exonic
963188940 3:142447817-142447839 GCCGAGGACCCGGGGCTCCGCGG - Intronic
963192388 3:142487210-142487232 GCCTAGGAGTTGTGGCTGCAGGG - Intronic
963554474 3:146771010-146771032 GCCTAGGAGCCATGCCTCCCAGG - Intergenic
966448988 3:180036722-180036744 GCCGAGTACCCGGAGCTCCAGGG - Exonic
968093110 3:195909927-195909949 GCCGAGGAGCGGTGGCGCCCTGG + Intronic
968760953 4:2442627-2442649 GCCGAGGGTCCGGGGCTCCATGG - Intronic
985669683 5:1201021-1201043 CCCAAGGAGCCGTGGTTCCGTGG + Intergenic
985782156 5:1876916-1876938 GCCGGCGAGCCGCGGCTCCGCGG - Intergenic
985873385 5:2577018-2577040 CCAGAGGGGCCGGGGCTCCAGGG - Intergenic
998322072 5:141241746-141241768 GCCGAACAGCCCTGGCTCCGTGG - Intergenic
999166099 5:149550940-149550962 GGCGAGTAGCAGCGGCTCCAAGG - Exonic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
999990505 5:157045793-157045815 GCCCAAGAGCCTTGGATCCACGG + Intronic
1001083237 5:168682076-168682098 GGCCAGGACCTGTGGCTCCAGGG + Intronic
1007395863 6:41577443-41577465 GCCCAGGAAGCCTGGCTCCAAGG - Intronic
1017687487 6:156928058-156928080 ACCGAGGAGCAGTGGCCGCATGG + Intronic
1018423929 6:163663387-163663409 GCCGAGCAGAGGAGGCTCCATGG + Intergenic
1019738380 7:2661308-2661330 GCCTTGGAGCTGTGGCTCCTGGG + Intronic
1036480422 8:9134248-9134270 ACCAAGGAACCGTGGCTGCAGGG - Intergenic
1037467154 8:19172009-19172031 GCTGGGGAGGCGGGGCTCCAGGG - Intergenic
1047669210 8:127126278-127126300 GCTGAGGACCTCTGGCTCCATGG + Intergenic
1049372622 8:142274968-142274990 GCAGAGGAGCAGAGGCTGCAGGG + Intronic
1049494213 8:142922196-142922218 GCCGAGCAGCCCCGGCCCCAGGG + Intergenic
1053370781 9:37560035-37560057 GTCGAGCACCAGTGGCTCCAAGG - Intronic
1053822088 9:41978405-41978427 CCAGAGGAGCCGAGGCTCTAGGG + Intronic
1054608486 9:67209008-67209030 CCAGAGGAGCCGAGGCTCTAGGG - Intergenic
1056754830 9:89375116-89375138 GCAAAGGAGCCCTGGGTCCACGG + Intronic
1059305443 9:113349889-113349911 ACCGAGGAGCCTAGGCTCCGGGG - Intronic
1061967693 9:134025443-134025465 GCCGCTGGGCCGTGTCTCCATGG - Intergenic
1198068925 X:133128649-133128671 GCCCTGGAGCAGTGGCTGCAAGG - Intergenic
1200883657 Y:8246339-8246361 GCCTAGGAACCATGCCTCCAAGG + Intergenic