ID: 1183323909

View in Genome Browser
Species Human (GRCh38)
Location 22:37181069-37181091
Sequence TACCCACTGCTCCCCAAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183323909_1183323914 15 Left 1183323909 22:37181069-37181091 CCAGCCTTGGGGAGCAGTGGGTA 0: 1
1: 0
2: 3
3: 34
4: 260
Right 1183323914 22:37181107-37181129 CACCTGAACACCCAGAACACAGG 0: 1
1: 0
2: 0
3: 41
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183323909 Original CRISPR TACCCACTGCTCCCCAAGGC TGG (reversed) Exonic
900227268 1:1539260-1539282 TGCCCAGTGCCCCTCAAGGCAGG + Intronic
900326955 1:2113058-2113080 TGCCCACTGCTGGCCGAGGCTGG + Intronic
900492851 1:2961285-2961307 TTCCCACCTCTCTCCAAGGCAGG + Intergenic
901203123 1:7477842-7477864 TACCCACTCGTCCACACGGCGGG - Intronic
901535714 1:9881834-9881856 TACCTTGTGCTCCCCAAGCCTGG - Intronic
902611781 1:17602131-17602153 TCCCCATTGCTCACCCAGGCTGG - Exonic
904558064 1:31378370-31378392 TACCCCCTGTCCCCCAGGGCAGG - Intergenic
907320878 1:53601585-53601607 TCCCCACTGCTGTCCAAGGGAGG + Intronic
909273513 1:73654793-73654815 GACCCACAGCTCCTCATGGCTGG - Intergenic
909741710 1:79037368-79037390 TTCCCACAGCTCCACTAGGCAGG - Intergenic
912084532 1:105982268-105982290 TTCTCACAGCTCCCCCAGGCAGG - Intergenic
912948821 1:114106609-114106631 AACCCTCTGCTCCACATGGCTGG + Intronic
915922426 1:159986640-159986662 TAGGCACTCCTCCCCAAGGGTGG + Intergenic
917034703 1:170735650-170735672 TCCCCACTGCTCCCACAGGCTGG + Intronic
918902592 1:190443589-190443611 GACCCACTGCTCCCTCATGCAGG - Intronic
920313552 1:205062250-205062272 TACCCAGGCCTCCCCAAAGCTGG - Intronic
922783897 1:228273650-228273672 TACCCATTGCTCTTCAAGGATGG - Intronic
922968484 1:229713985-229714007 TAGCCACTGCACTCCAAGCCTGG - Intergenic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923094386 1:230762973-230762995 TAGCCACTGCTCCCAAAGATGGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923622606 1:235590544-235590566 TACCCAGTGCTCCCGAAAGACGG - Intronic
1062786390 10:268834-268856 ATCCCACAGCTCCCCAAGTCTGG - Intergenic
1063769527 10:9182214-9182236 GACCCACAGATCCCCATGGCTGG + Intergenic
1064748230 10:18499112-18499134 TACACAGTGCTCCACAAGGCAGG - Intronic
1065507762 10:26446534-26446556 TACTCACTGTTCCTCAAGGCTGG + Intronic
1066052073 10:31645088-31645110 CACCCCCTGCCCGCCAAGGCTGG - Intergenic
1066267140 10:33787497-33787519 CACCCACCTCTTCCCAAGGCAGG - Intergenic
1067068811 10:43118208-43118230 TGTCCACTGATCCCAAAGGCTGG + Intronic
1068080765 10:52314787-52314809 TGCCCACTGCTCCCAAATGCAGG - Intronic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1072735737 10:97878145-97878167 AGCCCACTGCTCCCCAGGCCAGG - Intronic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1075715263 10:124551779-124551801 TGCCTGGTGCTCCCCAAGGCCGG - Intronic
1077996004 11:7453264-7453286 TACCCACTCCTCCCCATAGTGGG - Intronic
1079759115 11:24306782-24306804 TACACACTGCTCCCAAATGATGG - Intergenic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1080888879 11:36391312-36391334 TACCCACTGCCCCAGCAGGCAGG + Intronic
1081591713 11:44427703-44427725 TAATCTCTGCTCCCCAAGACAGG + Intergenic
1082028067 11:47587081-47587103 TTCCCACTGATGCCCAAAGCAGG + Intronic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084071297 11:66737585-66737607 AAACCACTGCTGCCCAAAGCTGG + Intergenic
1084268644 11:68017580-68017602 TGCCCTCTGCGCCCCAAGGGAGG - Intronic
1084270334 11:68026089-68026111 TACCCACTCCTCCAAAAGGCAGG - Exonic
1084607067 11:70178538-70178560 TACCCACTGCAACCCATTGCTGG - Intronic
1085451549 11:76637124-76637146 TGCCCACTAGGCCCCAAGGCTGG + Intergenic
1085623969 11:78057910-78057932 TGCCCACTGCTCACCAATCCTGG + Intronic
1087817987 11:102679810-102679832 TGCCTTCTGCTCCCCCAGGCTGG - Intergenic
1089621473 11:119725153-119725175 GACCCTCTGCCCCCCAAGCCTGG + Intronic
1089757175 11:120695599-120695621 TACCCACTGCCTCCCAGGCCTGG + Intronic
1089835925 11:121370582-121370604 TACTCACTGCAGCCCAAGGTGGG - Intergenic
1091991622 12:4960449-4960471 GGCCCACTGCTGCCCAAGGCAGG + Intergenic
1092003856 12:5052427-5052449 TCACCACTTCTCCCAAAGGCAGG - Intergenic
1092190242 12:6514164-6514186 TCCCTACTGCTCCCAAAGTCAGG - Intronic
1096779882 12:53985666-53985688 TACCTCGTGCTCCCCAAGGCAGG - Exonic
1099290174 12:80767129-80767151 TGCCCACTGCTCCCATAGGGAGG + Intergenic
1101382200 12:104223816-104223838 CAGCCACTGGTCCCCAAAGCTGG - Intronic
1102092480 12:110203474-110203496 TCCCCACTGATCCCCAAGCCTGG + Intronic
1103026364 12:117577472-117577494 TGCTCACTGCCACCCAAGGCAGG + Intronic
1103453523 12:121046662-121046684 TACACACTCCTCTACAAGGCTGG + Intergenic
1104656052 12:130574800-130574822 CACCCACTGCTTGCCAAGCCTGG + Intronic
1106197631 13:27507975-27507997 CACACAAAGCTCCCCAAGGCAGG - Intergenic
1109735292 13:66476051-66476073 TACCCAGTTCTCACCAAGGAAGG - Intronic
1110352092 13:74520739-74520761 TAGCCACTGCACTCCCAGGCTGG + Intergenic
1118691788 14:68346947-68346969 TTCCCTCTACCCCCCAAGGCTGG + Intronic
1119871742 14:78023645-78023667 CCCCCACTGCTACCCAGGGCAGG - Intergenic
1125491041 15:40148638-40148660 CACACACTGCTCTCCAAGGTGGG + Intergenic
1127165425 15:56240958-56240980 TACCCCCTGCTCCACAAGAATGG - Intronic
1128088015 15:64899019-64899041 AACCCACTCCTTCCCCAGGCAGG - Intronic
1128185428 15:65640229-65640251 TGCCAACTCCTCCCCAAGTCTGG + Intronic
1128994289 15:72285557-72285579 GAACCACTGCTTCCCCAGGCGGG - Exonic
1130132681 15:81157482-81157504 TGCTCCCTGCTCCCCAAGACTGG - Intergenic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1132382297 15:101374619-101374641 TAGCCTCTCCTCCCCAAGCCAGG - Intronic
1132404335 15:101533294-101533316 CCCCCTCTGCTCCCCAGGGCTGG - Intergenic
1133394915 16:5439117-5439139 TTCCCAAATCTCCCCAAGGCTGG - Intergenic
1133910556 16:10062170-10062192 TATCCACTTCTACCTAAGGCAGG + Intronic
1134131645 16:11654362-11654384 TGCCCACTGCTCCCCTGGGGTGG + Intergenic
1134583107 16:15388350-15388372 TACTCACAGTTCCACAAGGCTGG - Intergenic
1135314604 16:21433891-21433913 TACTCACAGTTCCACAAGGCTGG - Intronic
1135367527 16:21866171-21866193 TACTCACAGTTCCACAAGGCTGG - Intronic
1135444287 16:22504991-22505013 TACTCACAGTTCCACAAGGCTGG + Intronic
1136003687 16:27314241-27314263 CACCCAGCGCTCCCCAAAGCCGG + Intronic
1136193181 16:28631027-28631049 TACTCACAGTTCCACAAGGCTGG + Intergenic
1136311270 16:29412572-29412594 TACTCACAGTTCCACAAGGCTGG - Intergenic
1136324717 16:29514365-29514387 TACTCACAGTTCCACAAGGCTGG - Intergenic
1136439402 16:30254350-30254372 TACTCACAGTTCCACAAGGCTGG - Intronic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1139559218 16:67730998-67731020 TACCCTCTGCTCCCCACCACTGG - Intronic
1139858791 16:70003502-70003524 TACTCACAGTTCCACAAGGCTGG - Intergenic
1139885909 16:70206650-70206672 TACTCACAGTTCCACAAGGCTGG - Intergenic
1140553036 16:75887941-75887963 TATGCACTGCTCCCCATGGCAGG + Intergenic
1140929073 16:79610356-79610378 TGCCCACTGGCCCCCAAGGCAGG + Intergenic
1141424800 16:83937945-83937967 TCCACAGTGCCCCCCAAGGCTGG + Intronic
1142215945 16:88829888-88829910 CACCCCCTGCTCACCCAGGCTGG - Intronic
1142289382 16:89185782-89185804 TAACCACGGTTCCCCAGGGCAGG + Intronic
1142396314 16:89833739-89833761 CACGTGCTGCTCCCCAAGGCAGG - Intronic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142630595 17:1223674-1223696 GACTCACAGTTCCCCAAGGCTGG + Intronic
1143090449 17:4446622-4446644 TACACCCTCCTGCCCAAGGCTGG - Intronic
1143711877 17:8741282-8741304 TCCCCAGTGCCCCCCAGGGCTGG + Intronic
1144661241 17:17072324-17072346 CACCCACTGCTGGCCTAGGCCGG + Intronic
1145249393 17:21289180-21289202 AACCCACTGGTCCCCAACGTGGG + Intronic
1146283895 17:31561500-31561522 TAGACACTGATCCCCAGGGCTGG - Intergenic
1147168012 17:38603636-38603658 GACCCTCTTGTCCCCAAGGCAGG + Intronic
1149122475 17:53186183-53186205 CTCCCAATGCTCCCCCAGGCTGG + Intergenic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1150587777 17:66533960-66533982 TTCCCACTCCTCCAAAAGGCAGG - Intronic
1150604882 17:66682150-66682172 TACCCAGTGATCCCCGATGCAGG - Intronic
1150826377 17:68479804-68479826 TACCCACAGTTCCACATGGCTGG + Intergenic
1151635480 17:75344860-75344882 TAACAGCTGCTCCCCCAGGCGGG - Intronic
1152020643 17:77778641-77778663 CACCCACTCCTCCCCACAGCAGG - Intergenic
1152220671 17:79063452-79063474 TACCCACCGCTTCCCTGGGCTGG - Intergenic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152426495 17:80221036-80221058 TTCCAACTGCGCACCAAGGCGGG - Exonic
1153282136 18:3424668-3424690 TACTCTCTCCTCCCCGAGGCTGG - Intronic
1153468658 18:5417619-5417641 TTACCACTTCTCCCCAAGTCAGG - Intronic
1153925064 18:9828180-9828202 TTCCCACTATTCCCCAGGGCAGG - Intronic
1157771715 18:50353686-50353708 TAACCACTGCTTCCCAAGTTGGG - Intergenic
1159209915 18:65305382-65305404 TACACTCTGCTCCCCACTGCTGG + Intergenic
1160571269 18:79819159-79819181 CTCTCACTGCTCACCAAGGCCGG + Intergenic
1161551775 19:4916951-4916973 GAACCACTGCTCCCCAAACCCGG + Intronic
1161975920 19:7607737-7607759 TACCCCCTCCCCCCCAAGGTGGG + Intronic
1162299112 19:9834416-9834438 TACCCACAGTTCCCCAACTCTGG + Intergenic
1162450420 19:10750990-10751012 CACACACAGCTCCCCAAGGTGGG - Intronic
1162479526 19:10920509-10920531 TCACCACTGTTCGCCAAGGCAGG + Exonic
1165061579 19:33207518-33207540 GCCCCCCTGCTCCCCAATGCTGG + Exonic
1165485537 19:36093242-36093264 TACCCACCCCTCCCCTTGGCTGG - Intronic
1165581876 19:36872412-36872434 CACCCACTGCCCCCCAGGGAGGG - Intronic
1167750145 19:51374533-51374555 TACTCACTGCACACCATGGCAGG - Intergenic
1168393941 19:56032625-56032647 TTCCCACTGCTCCTCAATGAGGG - Exonic
925718264 2:6804631-6804653 TCTCCACTGCTCCTCAAGACCGG + Intergenic
927191301 2:20519031-20519053 TCCTCACTGATCCCCATGGCAGG + Intergenic
927865449 2:26584785-26584807 TCCCCAGGGCTCCCCACGGCCGG - Intronic
928968978 2:37007101-37007123 TACCCACTGCTCCTGATGCCTGG + Exonic
929109069 2:38391227-38391249 CAGACACTGCTCCCCCAGGCTGG - Intergenic
929543503 2:42840832-42840854 TCCCCACTGCCCCCCACTGCAGG - Intergenic
930037327 2:47094914-47094936 CACACACTCCTCCCCAGGGCTGG + Intronic
931813483 2:65877452-65877474 CACTCACTTTTCCCCAAGGCAGG - Intergenic
932055253 2:68436968-68436990 AACCCACTCCTCCCAATGGCAGG - Intergenic
932294977 2:70616628-70616650 GAGCCACTGCTCCCCAAGCAGGG + Intronic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932462379 2:71891298-71891320 TCCCCACTGTCCCCCAAGGCAGG - Intergenic
932960356 2:76406305-76406327 TTCCCAATGCTGCCCAATGCTGG - Intergenic
933837784 2:86259837-86259859 TTCCCACTTCTCCCCTAGGGCGG - Intronic
935607648 2:104986341-104986363 TGCACAATGCTCCCCAAGGATGG + Intergenic
936009721 2:108917810-108917832 CACCCATTGCTGCCCAAGGTTGG - Intronic
936717447 2:115204736-115204758 TATTCACTGCTCCCCACGGGAGG - Intronic
937346183 2:121127032-121127054 GACCCACTGCTCACCCAGTCTGG + Intergenic
938727622 2:134121228-134121250 TAGCCCCTGCTCCCCGTGGCGGG + Intronic
945054709 2:205858570-205858592 TGCACACTGCACCCCAAAGCAGG - Intergenic
946274791 2:218623019-218623041 TAACCACTCCTCCCAAAGGAGGG + Intronic
946404871 2:219486904-219486926 ACCCCACTGCTCCCCAAGGAGGG - Intronic
947621576 2:231594294-231594316 TGCTCACTGCACCCCAAGGGAGG - Intergenic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
947888713 2:233596624-233596646 TACTCACAGCTCCACATGGCTGG - Intergenic
948063070 2:235056208-235056230 GACACACTGGTCCCCAGGGCTGG - Intergenic
948607508 2:239145498-239145520 TCCCTAGTGCTTCCCAAGGCGGG - Intronic
1169933534 20:10858678-10858700 TTTCCACTGCACCCCAAGGTTGG - Intergenic
1172035398 20:32007207-32007229 TCCCCACTCCTGCCCATGGCAGG + Intergenic
1172898364 20:38316372-38316394 GTCCTACTGGTCCCCAAGGCTGG - Intronic
1173144858 20:40515708-40515730 TACCTTCTGCTCCCAAGGGCTGG - Intergenic
1173829638 20:46073577-46073599 TTCTAACTGCTCCCCAAGGCAGG - Intronic
1174334144 20:49845734-49845756 GTGCCACTGCTCACCAAGGCAGG - Intronic
1175659911 20:60803686-60803708 TGGCTACTGCTCCCCAAGGCAGG - Intergenic
1176212742 20:63932935-63932957 TTCCCCCTGCTCCCCTATGCAGG - Exonic
1176220829 20:63968809-63968831 AACGCCCTGCTGCCCAAGGCTGG + Intronic
1177659162 21:24060512-24060534 GACTCACAGCTCCCCACGGCTGG + Intergenic
1178013600 21:28317003-28317025 TACCCACAGTTCCACATGGCTGG - Intergenic
1178210299 21:30523523-30523545 GACTCACTGTTCCCCAGGGCTGG + Intergenic
1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG + Intergenic
1179584364 21:42365415-42365437 TTCCCACTGCAGCCCAATGCTGG + Intronic
1179821681 21:43940662-43940684 CTCCCACTGCCCCCCAAGGCAGG + Intronic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
1184325238 22:43778128-43778150 TACCCACTGTGCCACAGGGCTGG - Intronic
1184686204 22:46097507-46097529 CACCCACTGTTCCCGAGGGCTGG - Intronic
1185018936 22:48362307-48362329 CACCCTGTGCTCCCCAGGGCAGG + Intergenic
1185128148 22:49023119-49023141 ACCCCACTGCACCCCAAGCCCGG + Intergenic
949947642 3:9202945-9202967 CAGCCACTTCTCCCCAAGCCAGG + Intronic
952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG + Intronic
953903942 3:46858826-46858848 CACCCGCTGCTCCCCAAGTCTGG + Intronic
953985528 3:47439583-47439605 CACCCACTGCTTACCAGGGCAGG + Intronic
954955695 3:54516813-54516835 TACTCACTGCTATCAAAGGCAGG + Intronic
957612787 3:82490150-82490172 GACCCACTTCTGCCCAATGCCGG + Intergenic
959310465 3:104729574-104729596 TGCCCGCAGCTCACCAAGGCTGG + Intergenic
960126647 3:114005910-114005932 CAACCACTGCTTCCCAAGGGAGG + Exonic
960559093 3:119062838-119062860 CACCCTCTGCTTCTCAAGGCAGG + Intronic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
961471455 3:127115740-127115762 TCCCCACTCCTCTCCAAGGATGG - Intergenic
962206579 3:133440039-133440061 AACCCACAGTTCCCCACGGCTGG + Intronic
962276442 3:134018226-134018248 TGCCCACTCCTCCCCAGGGGTGG - Intronic
962998644 3:140655791-140655813 TACTCACTGCTTCCCTTGGCTGG - Intergenic
963056847 3:141193221-141193243 CACCCACTGCTTCCCTGGGCAGG - Intergenic
963855577 3:150249927-150249949 TACCCACAGCACCACAATGCTGG - Intergenic
964306631 3:155347890-155347912 TGCCTACTGCTCCCCCAGGCTGG + Intergenic
969174552 4:5388587-5388609 GACCCTGAGCTCCCCAAGGCTGG - Intronic
969314281 4:6372133-6372155 TCCCCACTGGGACCCAAGGCAGG - Intronic
972910507 4:43810616-43810638 GACCCACAGCTCCACATGGCTGG + Intergenic
975903929 4:79187334-79187356 GGCCCACTGCTGCCCAGGGCTGG + Intergenic
979174252 4:117642825-117642847 TACTCACAGTTCCCCATGGCTGG + Intergenic
980537240 4:134142927-134142949 TATCCACGGCTCCACAAGGACGG - Intergenic
985703506 5:1387465-1387487 TTCCCCCAGCTCCCCAAGTCAGG + Intergenic
985802099 5:2011253-2011275 TGTCCAAGGCTCCCCAAGGCTGG + Intergenic
986678853 5:10215386-10215408 AACCCAATGGTCCCCTAGGCTGG - Intergenic
986871202 5:12048832-12048854 GACCCACAGTTCCCCAAGGCTGG - Intergenic
987216253 5:15740460-15740482 TATCCACTGCTCCCCCATTCAGG + Intronic
988367820 5:30324236-30324258 TGCTCACTGCTGCCCCAGGCTGG + Intergenic
988636231 5:32987712-32987734 TACCTCCTCCTTCCCAAGGCAGG - Intergenic
989193762 5:38695856-38695878 GACCCACTCATCCCCAAAGCTGG + Intergenic
997418385 5:133747173-133747195 TACCCACTGCTGCAAAGGGCAGG - Intergenic
999314334 5:150574405-150574427 CACTCTCTGCTCCCCCAGGCAGG + Intergenic
1001051535 5:168418289-168418311 TCCCCACTGCTCCCCAGAGCTGG + Intronic
1001757346 5:174180795-174180817 TGCCCACTGGTCCCCAGGGGAGG + Intronic
1002186588 5:177457557-177457579 TACCCACCGCTCACAGAGGCTGG - Intronic
1004005524 6:11634164-11634186 AATCCACTGCTCTCCAAGCCAGG - Intergenic
1004669867 6:17785589-17785611 TACCCACTGCTCCACAAGCTGGG + Exonic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006428207 6:33979209-33979231 CAGGCCCTGCTCCCCAAGGCAGG - Intergenic
1007178236 6:39910846-39910868 TACCCATTGATCTCCCAGGCAGG - Intronic
1007507495 6:42347240-42347262 CACCCACCTCTCCCAAAGGCAGG + Intronic
1011240216 6:85264308-85264330 GACTCACTGTTCCCCATGGCTGG + Intergenic
1011265450 6:85512813-85512835 AAGCCACTGCCCCCCAAGGTTGG - Intronic
1014101579 6:117517396-117517418 TCCCCACTGCTTCCACAGGCTGG + Intronic
1015683454 6:135833518-135833540 CAACCCCTGCTCTCCAAGGCAGG + Intergenic
1018028500 6:159823552-159823574 AAGCCAGTGCTCCCCATGGCTGG + Intergenic
1019146912 6:169981490-169981512 TCCTCACTGCTCACCGAGGCTGG + Intergenic
1019559927 7:1650927-1650949 TGCCCACCCCTCCCCCAGGCTGG + Intergenic
1019707061 7:2501954-2501976 CACCCACTGCACCCCAAGGCTGG - Intergenic
1020211429 7:6160459-6160481 TGCCAGCTGCTCCCGAAGGCTGG - Intronic
1022185285 7:27961408-27961430 TTCCGACTGCTGCCCAAGGCTGG + Intronic
1022527936 7:31050344-31050366 TACCCACTGCCCACCAAACCAGG - Intergenic
1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG + Intergenic
1022794179 7:33719001-33719023 TACCCACTACTCCGCAGAGCAGG - Intergenic
1022904790 7:34845295-34845317 GACACACTGTTCCCCAGGGCTGG + Intronic
1023183675 7:37511792-37511814 TTCCCACTACTCCACTAGGCTGG - Intergenic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG + Intronic
1026950618 7:74344079-74344101 AACCTACTGCTCCCCAATCCAGG - Intronic
1028105168 7:86868285-86868307 TACCCTCTGCTCCCAGAGGTAGG - Intergenic
1028760621 7:94492057-94492079 TACCCACTTGTCCCCAGGTCTGG - Intergenic
1030326314 7:108222474-108222496 TACCTTCTGCTCCCAAAGGTTGG + Intronic
1032823845 7:135550385-135550407 CACACACTGCTGCCCAGGGCCGG + Intergenic
1033121575 7:138671117-138671139 TAGCCACTGCTCCCCAACATTGG - Intronic
1033124114 7:138692405-138692427 TAGCCACTGCTCCCCAACATTGG + Intronic
1035392631 7:158515574-158515596 CACCCACTGCTCCCAATGGGAGG + Intronic
1035737447 8:1898741-1898763 TCCCCTCTGTCCCCCAAGGCTGG - Intronic
1037252151 8:16908361-16908383 GACTCACAGCTCCACAAGGCTGG + Intergenic
1037303581 8:17480932-17480954 TTCCCACAGCTCTCCAACGCAGG - Intergenic
1041290164 8:56301105-56301127 TCAGCCCTGCTCCCCAAGGCAGG + Intronic
1043364269 8:79513453-79513475 GACTCACGGCTCCCCACGGCTGG - Intergenic
1045282076 8:100757949-100757971 TTCCCACCACTCCCCAAGACAGG - Intergenic
1045502721 8:102755754-102755776 TGCCCACTGCCCCACAAGGTAGG + Intergenic
1046855274 8:119024624-119024646 TGCCCACTGCCCTCAAAGGCAGG - Intronic
1047678414 8:127227857-127227879 CACTCACTTCTCCCCAAGGGAGG - Intergenic
1047739289 8:127794263-127794285 TACCCTCCGCTCCCCCAGTCTGG + Intergenic
1047994655 8:130322836-130322858 TTCCCACTGCTCTCCATTGCAGG - Intronic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049266911 8:141672532-141672554 TGCCCACTCCTCCCCGAGGATGG - Intergenic
1049357043 8:142194069-142194091 TACTGACTGCGCCCCAAAGCAGG + Intergenic
1049480065 8:142818365-142818387 TGCCCACTGCTCCCCAATGCTGG + Intergenic
1049990059 9:981965-981987 TACCCTCTCCTTCCCAAGGCAGG + Intronic
1050222239 9:3405915-3405937 TACCCACAGTTCCCCAAACCTGG + Intronic
1052937673 9:34106490-34106512 TACTCCCTGCTCTCCAAGGATGG - Exonic
1055760384 9:79600733-79600755 TGCCCATGGCTCCCCAAGCCTGG + Intronic
1056963863 9:91149882-91149904 CACCCACTGCACTCCAAGCCTGG - Intergenic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1057272129 9:93657361-93657383 TTCCCACTGTTCCCCAAATCTGG + Intronic
1058759732 9:108119396-108119418 TGCCCAATGCTCCCTAAGTCTGG + Intergenic
1059450839 9:114370612-114370634 TCCCGGGTGCTCCCCAAGGCTGG + Intronic
1059675054 9:116529862-116529884 TACTCACAGTTCCCCATGGCTGG - Intronic
1060798952 9:126531747-126531769 TAGCCCCTGCTCCACACGGCAGG + Intergenic
1061755406 9:132808924-132808946 TCCCCACCACTCCCCAAGCCAGG - Intronic
1062430124 9:136523220-136523242 GCCTCACTGCTCCCCGAGGCCGG + Intronic
1062511176 9:136907037-136907059 AGCCCACTGCTGCCCCAGGCAGG - Intronic
1186069909 X:5808429-5808451 GACTCACAGCTCCCCATGGCTGG + Intergenic
1186471812 X:9827685-9827707 GTCTCCCTGCTCCCCAAGGCAGG - Intronic
1186483512 X:9914453-9914475 TTCCCACTGCTCCCCTACCCTGG - Intronic
1186565710 X:10660093-10660115 TCCCAACTTCTCCCCAAAGCTGG + Intronic
1187505536 X:19875542-19875564 CACCCACTCCTCCACAGGGCAGG + Intronic
1189294728 X:39910314-39910336 TCCCAAATGTTCCCCAAGGCTGG + Intergenic
1191842654 X:65524115-65524137 ATCCCGCTGATCCCCAAGGCTGG + Exonic
1191875936 X:65796428-65796450 TACCCACTGCCCCACCAGACTGG + Intergenic
1192757932 X:74066077-74066099 TACCCCATGCTCCCCCAGCCAGG + Intergenic
1192923888 X:75735523-75735545 CACTCACTGCTTCCCTAGGCAGG + Intergenic
1194757218 X:97751214-97751236 TACTCACTGTTCCCAAAGGGAGG + Intergenic
1194867325 X:99085474-99085496 TACTCACTGCTCCCCTGGGTAGG - Intergenic
1197687541 X:129457663-129457685 TACCCACTACCTCACAAGGCTGG + Intronic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1199585572 X:149412727-149412749 TTCCCACAGCTTCACAAGGCAGG - Intergenic
1201524774 Y:14919894-14919916 CACTCACAGCTCCCCATGGCTGG - Intergenic