ID: 1183324337

View in Genome Browser
Species Human (GRCh38)
Location 22:37183335-37183357
Sequence GCCCTCAACAAAATGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183324336_1183324337 -5 Left 1183324336 22:37183317-37183339 CCTCAGGGGTGTTTGTGAGCCCT No data
Right 1183324337 22:37183335-37183357 GCCCTCAACAAAATGTCCTGTGG 0: 1
1: 0
2: 2
3: 13
4: 128
1183324335_1183324337 -2 Left 1183324335 22:37183314-37183336 CCACCTCAGGGGTGTTTGTGAGC 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1183324337 22:37183335-37183357 GCCCTCAACAAAATGTCCTGTGG 0: 1
1: 0
2: 2
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183324337 Original CRISPR GCCCTCAACAAAATGTCCTG TGG Intronic
903855843 1:26337178-26337200 TCCCTCCACAAACTGTACTGGGG + Intronic
906919631 1:50049171-50049193 GCTCTCAACAAACTGTGTTGTGG - Intronic
908403763 1:63794257-63794279 GCCCTCACCAAAAGGTAATGAGG - Intronic
910321209 1:85946455-85946477 ACCCTCAACACAGTGTCCTAAGG + Intronic
913459753 1:119071554-119071576 TCACTTAACAAAATGTCCTCTGG - Intronic
915552273 1:156642114-156642136 GCCCTCTTCCGAATGTCCTGCGG + Exonic
917618304 1:176768668-176768690 GTCCTAAACAAAATATCCTCCGG - Intronic
917891602 1:179443679-179443701 TCCCTCAGCATAATGTCCTCAGG + Intronic
919293768 1:195668304-195668326 GACCTCAACAAAATAATCTGGGG - Intergenic
920773008 1:208907423-208907445 GCAGTCAACAAATTGTCCTTAGG + Intergenic
1073500094 10:103929063-103929085 GCCCACAAGAAAATTCCCTGCGG - Intergenic
1073861945 10:107754732-107754754 CCCCTCAACAAAATGTCACATGG - Intergenic
1076403187 10:130196504-130196526 GCTCTCCACAAGATGTCCTGGGG - Intergenic
1078455020 11:11468297-11468319 GCCCTCAACAACTTGCCTTGGGG - Intronic
1079059480 11:17235668-17235690 GCCCTCAACAAAGTGAACAGTGG + Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1084350567 11:68595999-68596021 TCCAGCAACAAAAGGTCCTGTGG - Intronic
1085031390 11:73272946-73272968 TCCCTCAACCAAAGTTCCTGGGG - Intronic
1090737586 11:129623789-129623811 TCCCATGACAAAATGTCCTGTGG + Intergenic
1090842613 11:130506113-130506135 GTCCTCACCCAAATCTCCTGTGG + Intergenic
1092698485 12:11200795-11200817 GCCCTAAACAAAAAGTCCTCTGG - Intergenic
1093461530 12:19411490-19411512 GCCCTGGCCAAAATGTCCTGGGG - Intronic
1093704460 12:22259268-22259290 GCCCTCAAACAAAAGTCCAGGGG + Intronic
1095462260 12:42455527-42455549 GCCTTCAGCAAAATGTTCTCCGG + Intronic
1097056928 12:56255973-56255995 CCCCTCAACAGAAGGTGCTGGGG - Exonic
1100614667 12:96221827-96221849 GCCCTAAATAAAATGCCCTGTGG + Intronic
1101572582 12:105967373-105967395 GCCCTCATCCAAATGATCTGAGG - Intergenic
1103281398 12:119760659-119760681 GCCCCTGACAAAATGTCCAGTGG - Intronic
1108178585 13:47819338-47819360 GCCCTCACCCAAATCTCATGTGG + Intergenic
1110100636 13:71597171-71597193 GACCTCAAATAAATGTCATGAGG - Intronic
1111079574 13:83285625-83285647 GCCCTGGACAAAAGGACCTGGGG + Intergenic
1112499452 13:99931327-99931349 GCCCACAACAAACGGTCTTGGGG - Intergenic
1113040012 13:106094579-106094601 GCACTCAACAAAATTTGATGTGG + Intergenic
1113485821 13:110651812-110651834 GCCCTCAGCAAAACCTCCTGTGG + Intronic
1113915824 13:113873721-113873743 GCGCTCACCCTAATGTCCTGTGG + Intergenic
1117999143 14:61506609-61506631 GCCCTGAACTAACTGCCCTGGGG + Intronic
1119657279 14:76426098-76426120 GCCCTCACCAAAATGTCCTCTGG - Intronic
1119938208 14:78612833-78612855 GCCTCTAACAAAATGTTCTGTGG + Intronic
1122544343 14:102513914-102513936 GCCCTTTACAGAATGTCATGGGG + Intergenic
1129108866 15:73325966-73325988 GCTCTCAACGAAATGACCCGGGG - Intronic
1129234426 15:74215243-74215265 TCACTTAACATAATGTCCTGGGG - Intergenic
1129633916 15:77293875-77293897 CCCCCAAACAAAATGTCCAGAGG + Intronic
1129901427 15:79153994-79154016 GCCCTTAAAAAAGAGTCCTGAGG - Intergenic
1134056521 16:11173714-11173736 GCCCTCCTCACACTGTCCTGAGG + Intronic
1134077806 16:11304298-11304320 GATCTCAGCAAAGTGTCCTGGGG + Intronic
1135091740 16:19523078-19523100 GCCCTCCAAAATATGTCCAGGGG - Intergenic
1145747916 17:27333594-27333616 TCCCACATCAAAATGTCGTGTGG - Intergenic
1145816404 17:27798123-27798145 GCCCTCACCATAGTGTGCTGAGG - Intronic
1146637576 17:34517805-34517827 GCCCTTAAGAAAATGTCCCAAGG + Intergenic
1146722452 17:35132873-35132895 GCCCTCTACAAGGTGTCCTGTGG + Intronic
1146722471 17:35132951-35132973 GCCCTCTACGAGGTGTCCTGTGG + Intronic
1148699773 17:49580427-49580449 GGTCTCAAGCAAATGTCCTGCGG - Intronic
1149125009 17:53218490-53218512 ACCCTCACCAAAATATCATGTGG - Intergenic
1150885895 17:69085114-69085136 GCCCTCAAGAGAACGTGCTGTGG - Exonic
1158584646 18:58720997-58721019 GGACTCAAAAAAATGTGCTGTGG + Intronic
1166950857 19:46427195-46427217 GCAACCAACAAAATTTCCTGAGG - Intergenic
1167528383 19:49999748-49999770 GACCTCATCAACATTTCCTGAGG - Intronic
928603908 2:32926750-32926772 GACCTGAACAAACTATCCTGGGG - Intergenic
928666497 2:33555229-33555251 GCTCTCAGCAAAATGTACAGAGG - Intronic
929434938 2:41921391-41921413 GCCCCCTACAAAATGTCCTATGG + Intergenic
929718466 2:44338757-44338779 GCCCTCACTCAAATGTCCAGTGG - Intronic
932587553 2:73041153-73041175 TCACTCAACAAAATATCTTGGGG - Intronic
936081432 2:109435189-109435211 GCCTTCAACATACTGACCTGGGG - Intronic
937843608 2:126553169-126553191 ACACTCAACAATATGTCTTGAGG - Intergenic
940331824 2:152483550-152483572 GCCCTTAAAAAAATGTCATCAGG + Intronic
940906001 2:159170544-159170566 GGTTTCAACAAAATGTCTTGTGG - Exonic
941002433 2:160216148-160216170 GCCCACCACTAAATGACCTGTGG + Intronic
941783406 2:169473750-169473772 GCCTTCTACAGAATGTCATGTGG - Intergenic
942784392 2:179683881-179683903 GCCCTGAACAAACTGTGCTAAGG + Intronic
946746858 2:222854749-222854771 TCACTTAACAAAATGTCCAGAGG - Intergenic
1173736370 20:45364340-45364362 GCCCTCAACAAAATGTTACAAGG + Intronic
1182420624 22:30246986-30247008 GCCTTCGACAAAACGCCCTGTGG + Intergenic
1183324337 22:37183335-37183357 GCCCTCAACAAAATGTCCTGTGG + Intronic
1185162196 22:49236768-49236790 GCCCTCAACCCTGTGTCCTGGGG - Intergenic
952047196 3:29337210-29337232 GCACCCAACATAATGTCCTTGGG + Intronic
952285410 3:31963612-31963634 GTCCTCTACGAAATGTCCTATGG - Intronic
954378175 3:50205659-50205681 GCCCCCAACAAGGCGTCCTGTGG - Intronic
954840576 3:53508095-53508117 GCCCTCCTCAAAATGAGCTGAGG - Intronic
956287754 3:67628496-67628518 CCACTCACCAAAAAGTCCTGTGG - Intronic
959805797 3:110551960-110551982 GCACACAAAAAAATGTCCTTGGG + Intergenic
964516921 3:157520961-157520983 GTGCTCAACAAAATGTGCTCTGG - Intronic
969397754 4:6933773-6933795 GTCCTAAACAGAATGCCCTGAGG + Intronic
971750191 4:30637112-30637134 GCCCTAATCAAAATGTTCAGTGG + Intergenic
974620738 4:64350303-64350325 GCTTTCAGAAAAATGTCCTGTGG + Intronic
974816568 4:67012410-67012432 GTCCTCAACAAAATTTCATGTGG + Intergenic
975964415 4:79953073-79953095 GCCTTCAACACTAGGTCCTGTGG - Intronic
978070715 4:104464656-104464678 GCCATGAACAGAATGTTCTGAGG + Intergenic
983019845 4:162662098-162662120 GCCATCAATAAAATGTCATGTGG - Intergenic
983124141 4:163929760-163929782 GCCCTGCAAAAAATGTCATGTGG - Intronic
985284219 4:188318572-188318594 GCACTCAACAACGTTTCCTGAGG - Intergenic
985664426 5:1174614-1174636 GCTGTCAACAAAGTTTCCTGAGG + Intergenic
986960728 5:13208457-13208479 TCACTCAACATAATGTCCTCTGG - Intergenic
998191896 5:140032460-140032482 GCCCTCATCAAAATGTCCAAAGG + Intronic
1001162422 5:169332355-169332377 GGCTTTAACCAAATGTCCTGTGG - Intergenic
1003394169 6:5739149-5739171 GCACTCAACATAATGCCCTTGGG + Intronic
1004910192 6:20275634-20275656 CAACTCAACAAAATCTCCTGAGG - Intergenic
1006661042 6:35644862-35644884 GCACACAAAAAAATTTCCTGGGG + Intronic
1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG + Intergenic
1007933463 6:45712938-45712960 ACCCACAAGAAAATGTCATGGGG - Intergenic
1008257244 6:49318554-49318576 TCACTTAACATAATGTCCTGTGG - Intergenic
1009647131 6:66419638-66419660 GCCATCAACAAAATTTCCTTAGG + Intergenic
1010218733 6:73428884-73428906 TCCCTCATGAAAATATCCTGGGG + Intronic
1016426687 6:143942541-143942563 GACCCCAACAAAATGGCCTTTGG - Exonic
1016842653 6:148539888-148539910 GCCCTCAGCAACACGTGCTGAGG - Intronic
1019582152 7:1770068-1770090 GCCCTCAAAAAAAAGTCCTGAGG + Intergenic
1019753876 7:2753466-2753488 TCACTCAACATAATGTCCTTGGG + Intronic
1024893375 7:54227757-54227779 GCTCTCAGCAAAATGCACTGAGG - Intergenic
1024900543 7:54314630-54314652 GCTCTCAGCAAAATGCACTGAGG + Intergenic
1026041983 7:66875805-66875827 GCCCTTAACAGTATGTCTTGGGG + Intergenic
1029675905 7:102068637-102068659 GCCCTTAACAAACTGCCCGGTGG + Intronic
1030383619 7:108842236-108842258 TCACTTAACATAATGTCCTGAGG + Intergenic
1030905605 7:115178052-115178074 GCTGTCAACAGAATGTCGTGAGG - Intergenic
1030977284 7:116142592-116142614 GCCCTCAACAAGTTAACCTGTGG - Intronic
1032293615 7:130614125-130614147 GCCCTCAACATAAAATCCTCTGG + Intronic
1033444123 7:141405325-141405347 GCCATCAACCACATGTCCTTGGG + Intronic
1035610173 8:956733-956755 GCCCTCTCCAATCTGTCCTGAGG + Intergenic
1038988384 8:32838274-32838296 GACCTCATATAAATGTCCTGTGG - Intergenic
1039313618 8:36347469-36347491 GTCTTCAACAAATTGTTCTGAGG + Intergenic
1040101987 8:43513648-43513670 GTCCTCCTCAAAATGACCTGTGG - Intergenic
1040498328 8:47986343-47986365 GCGATCCCCAAAATGTCCTGAGG - Intergenic
1042127527 8:65553611-65553633 TCCCTCTACAAAATGTACAGGGG - Intergenic
1042155247 8:65838687-65838709 CCCCTCAACTAAATGTCCCAGGG + Intronic
1044785762 8:95790868-95790890 GTACTCAACAAAATATACTGCGG + Intergenic
1046670882 8:117054841-117054863 GCTCTGAATAAAATGTTCTGTGG - Intronic
1048100845 8:131349724-131349746 GCCCTCAATAAAATGTTTTCTGG + Intergenic
1049520129 8:143083533-143083555 GCCCTCAACAAAGGGCTCTGAGG + Intergenic
1055604210 9:77951030-77951052 GCCCTAAACAAAGTATACTGGGG - Intronic
1058770647 9:108227957-108227979 TCCCTAAACATAATTTCCTGTGG + Intergenic
1059034163 9:110735425-110735447 TCACTTAACATAATGTCCTGCGG - Intronic
1060396805 9:123322001-123322023 GCCCTCAACACAGTGCTCTGGGG - Intergenic
1060473812 9:123970475-123970497 CCCCTTAACCAAATGCCCTGAGG - Intergenic
1186344091 X:8673498-8673520 GCCCTCAAAAAAATGTACCCTGG + Intronic
1187856669 X:23643592-23643614 GCTCTTAACGAACTGTCCTGCGG - Intergenic
1189883013 X:45511405-45511427 GAGCTTAAGAAAATGTCCTGTGG - Intergenic
1190752633 X:53375498-53375520 GCCCTCAAAAACATCTCTTGAGG + Exonic
1190774789 X:53544053-53544075 GACCTCAGCAAGATGCCCTGTGG - Intronic
1193892276 X:87064628-87064650 AACTTCATCAAAATGTCCTGAGG + Intergenic
1193962603 X:87944796-87944818 GCCCACAAGAAAATTTTCTGTGG - Intergenic
1195805967 X:108765701-108765723 TCCCTCAACATAATGTCTTCAGG + Intergenic
1197127273 X:122961604-122961626 GCCTTCAAAAAAATGTCCAGTGG + Intergenic
1197488704 X:127088671-127088693 GCTTTCAACAAAATGCCCTGGGG + Intergenic
1199081982 X:143587284-143587306 GCCCACAACAAATTTCCCTGTGG - Intergenic
1199927809 X:152487112-152487134 GTACTCAAATAAATGTCCTGGGG + Intergenic
1201302175 Y:12518091-12518113 CCCATCAACCAAATCTCCTGTGG - Intergenic