ID: 1183325817

View in Genome Browser
Species Human (GRCh38)
Location 22:37193125-37193147
Sequence ATGGCTAATGGCAGTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 13, 3: 40, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183325817_1183325826 18 Left 1183325817 22:37193125-37193147 CCCACAAAACTGCCATTAGCCAT 0: 1
1: 0
2: 13
3: 40
4: 172
Right 1183325826 22:37193166-37193188 CACCTAGTTATTACATAGCAAGG 0: 1
1: 1
2: 1
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183325817 Original CRISPR ATGGCTAATGGCAGTTTTGT GGG (reversed) Intronic
902796227 1:18802207-18802229 ATTGCTAATGGTAGTGTTGGAGG - Intergenic
904075838 1:27841613-27841635 ATGGCTAGTGGCTGCTATGTTGG + Intronic
906009270 1:42508456-42508478 ATGGCTAATAGAAGTTATGGAGG - Intronic
906331643 1:44890005-44890027 ATGGCTAATGGCAGTTATCAGGG + Intronic
906711538 1:47933986-47934008 ATGGCTAAGGGTTGTTTTATTGG + Intronic
906859481 1:49343432-49343454 ATGGCTAATGGAAGTTATGGAGG + Intronic
907531917 1:55107878-55107900 TTTGTTAATGACAGTTTTGTGGG - Intronic
907878061 1:58514485-58514507 ATGGCTAACAGGAGCTTTGTTGG - Intronic
909158437 1:72112782-72112804 ATGGCCAATGGCAGTAGTGAGGG - Intronic
909728491 1:78865410-78865432 ATTGGTATTGGCAGTTTTTTTGG + Intergenic
910483709 1:87686602-87686624 ATTCCAAATGGCAGTTTTGTTGG + Intergenic
912951592 1:114124148-114124170 ATGGCCATTGGCATTTCTGTGGG - Intronic
917089838 1:171341916-171341938 TTGGCTAATAGCAGTTATGATGG - Exonic
919735862 1:200949991-200950013 ATGGCTAATGGCACTTGATTTGG + Intergenic
921578563 1:216867879-216867901 ATTGCTAGTAGGAGTTTTGTAGG - Intronic
922954167 1:229585329-229585351 ATGGCTAGTGGCTATTTTGCTGG + Intergenic
923975992 1:239263512-239263534 ATTGATAATGGTAGTTTTGAGGG - Intergenic
924045341 1:240024020-240024042 ATGGCTGATGTCAGTGCTGTTGG + Intronic
1066028018 10:31384600-31384622 ATTGCTCAGGGAAGTTTTGTAGG + Intronic
1067210082 10:44252872-44252894 ATCGTTGATGGCATTTTTGTTGG + Intergenic
1067463910 10:46479699-46479721 ATGGTTAATGGCAGTTATGGGGG + Intergenic
1067623285 10:47904952-47904974 ATGGTTAATGGCAGTTATGGGGG - Intergenic
1067823029 10:49547576-49547598 ATGGCTAATGACAGTTATGGGGG - Intergenic
1068262245 10:54597815-54597837 ATGGTTATTTGTAGTTTTGTGGG - Intronic
1068348801 10:55817443-55817465 ATGGCAAATGGCAGTTATAGGGG - Intergenic
1068874242 10:61979735-61979757 AGGACTAAAGGCATTTTTGTGGG - Intronic
1068907481 10:62343370-62343392 ATGGCTAATGGCAGTTATGGGGG - Intergenic
1074523257 10:114243696-114243718 ATCGCTGAAGGCAGTTTTGCAGG - Intronic
1074569204 10:114609095-114609117 ATGGCTCATGTCAGCTTTTTAGG + Intronic
1077926810 11:6689443-6689465 ATGGCTAATGGCAGTTATGGGGG + Intergenic
1078506700 11:11955548-11955570 GTGGCTAATGGCTGTTGTATTGG + Intronic
1078939509 11:15986124-15986146 ATGGCTACTGGCAGTATGTTTGG - Intronic
1079063822 11:17272840-17272862 ATTGCTTTTGGCAGTGTTGTGGG + Intronic
1079235439 11:18685477-18685499 ATGGCTAATGGCAGTTATGGGGG + Intergenic
1079947803 11:26765416-26765438 ATAGCTACTGGCAGTTATGGGGG + Intergenic
1081977979 11:47247938-47247960 ATGGGAAAAGGCAGTTTAGTAGG + Intronic
1082203112 11:49397891-49397913 ATGGACAATGGCAGGTTTCTTGG - Intergenic
1083001513 11:59296614-59296636 ATATCTAATGGCAGTTATGGGGG - Intergenic
1083043426 11:59710484-59710506 ATGGCTAATTATAGATTTGTTGG + Intergenic
1083504132 11:63139472-63139494 ATGGCTAATAGTAGTTATGGAGG + Intronic
1085945568 11:81267443-81267465 CTGGCTAATGTAAGTTTTATTGG - Intergenic
1085974602 11:81636998-81637020 ATGGCTAATAGTAGTTATGGAGG + Intergenic
1086651927 11:89302188-89302210 ATGGACAATGGCAGGTTTCTTGG + Intergenic
1086720129 11:90110072-90110094 AGAGCTAATGGCTGATTTGTGGG + Intergenic
1087697596 11:101397947-101397969 AAGGCTAATTGGAGTTTTTTAGG + Intergenic
1088162322 11:106887528-106887550 ATGCCTAAGTGCAGTTTTGGTGG - Intronic
1090193396 11:124793516-124793538 GTGGCTAGTGACTGTTTTGTTGG - Intronic
1091952460 12:4606060-4606082 ATGGGAAATGACAGTTTTCTGGG + Intronic
1092653263 12:10656985-10657007 ATGGCTAATGGAAGTTATGGGGG + Intronic
1093833441 12:23795652-23795674 ATGCTGAATGGGAGTTTTGTGGG + Intronic
1095481235 12:42638283-42638305 ATGCCTAATGGCAGAATGGTGGG - Intergenic
1095769012 12:45930262-45930284 ATCACTAATGGCACTTATGTGGG + Intronic
1096823808 12:54259018-54259040 ATGGGTATAGGCAGTTTTTTAGG - Intronic
1100172466 12:91991086-91991108 ATGAAGAATGGCAGTTTTATAGG - Intronic
1102208071 12:111104361-111104383 ATGGCTCATGGGAGGTTTGTGGG + Intronic
1102383482 12:112486807-112486829 ATGGCCAATGGCAGTGCTGTAGG - Intronic
1103774032 12:123352290-123352312 TTGGCTAATGCCATTTTTGTAGG - Intronic
1104996204 12:132659068-132659090 ATGGATAATTGCCATTTTGTAGG - Intronic
1106336811 13:28790939-28790961 ATAGCTAATGGCAGTTATGGGGG - Intergenic
1109609142 13:64740393-64740415 CTGGCTAATGGCAGTTATAAGGG + Intergenic
1110257807 13:73451436-73451458 ATTCCCAGTGGCAGTTTTGTTGG - Intergenic
1111189810 13:84792324-84792346 ATGGCTAATGACAGTTATGGAGG + Intergenic
1111518362 13:89363998-89364020 ATTGCTAATGTGAGTTTTGGAGG + Intergenic
1113524203 13:110961315-110961337 ATGGCTAATGGCAGTTATGGGGG + Intergenic
1113681753 13:112249319-112249341 CAGACTCATGGCAGTTTTGTGGG + Intergenic
1117817638 14:59613979-59614001 ATGGCTAATAGTAGTTATGGAGG + Intronic
1119044622 14:71307776-71307798 ATGGCTGATGGCAGCTCTCTTGG + Intergenic
1121003830 14:90473629-90473651 CTAGCTAATGGCAGTTATGGGGG + Intergenic
1124659419 15:31533658-31533680 ATGGCTAAAGGAAGTTCTCTAGG + Intronic
1126065195 15:44821155-44821177 ATGGCTAATGGGAGGTGTTTGGG + Intergenic
1126085502 15:45007537-45007559 ATGGCTAATGGCAGTTAAGAGGG + Intergenic
1126094635 15:45079428-45079450 ATGGCTAATGGGAGGTGTTTGGG - Intergenic
1126559445 15:50027133-50027155 ATGGCTAATACTAGTTTTGGAGG - Intronic
1130037059 15:80370519-80370541 ATGGCTAATAGTAGTTATGGAGG + Intronic
1132308507 15:100836891-100836913 AAGGCTAAAGTCAGTTTTATAGG + Intergenic
1135477160 16:22786731-22786753 ATGGTTACTGGCAGTTGTTTGGG - Intergenic
1136410760 16:30075838-30075860 GCGGCCAGTGGCAGTTTTGTGGG - Intergenic
1138628787 16:58276554-58276576 ATGCCTAAAGACATTTTTGTGGG - Intronic
1139974216 16:70796062-70796084 ATGGCTGTTGCCGGTTTTGTGGG - Intronic
1146833678 17:36092210-36092232 ATGGCTAGTGCCAGTCTTGAGGG + Intergenic
1146848269 17:36199049-36199071 ATGGCTAGTGCCAGTCTTGAGGG + Intronic
1149484059 17:57028177-57028199 ATAGCTAATGGCAGTTATGGGGG - Intergenic
1150348426 17:64422713-64422735 ATGGCTAATGGCAGTTATAGGGG + Intergenic
1163605938 19:18275235-18275257 ATGGCAGATGGCAGTTGGGTGGG + Intergenic
1165012662 19:32859947-32859969 ATGGCCAAAGGCAGGTTTCTGGG + Exonic
1166402443 19:42493356-42493378 ACGGCTAATGGCAGTTATGGGGG - Intergenic
925471953 2:4172575-4172597 ATGGCTAATGATAGTTATGGAGG - Intergenic
925501329 2:4508287-4508309 ATGGCTATTGGCTGTGTTTTAGG + Intergenic
928046880 2:27943146-27943168 ATAGCTGTTGGCATTTTTGTTGG + Intronic
928382319 2:30829344-30829366 ATGGCTAATGGCATTTATGGGGG + Intergenic
929479215 2:42287150-42287172 CTGGATTATGGGAGTTTTGTGGG + Intronic
930057228 2:47261349-47261371 ATGGCTAGTGGCAGTTATAATGG - Intergenic
930240919 2:48934954-48934976 ATGGCTAATACCAAGTTTGTTGG - Intergenic
935304577 2:101724544-101724566 AAGGCTAATGCCAGTGTTTTAGG + Intronic
935472628 2:103478612-103478634 ATAACTAATGGCAGTTATGGGGG - Intergenic
936033866 2:109094082-109094104 ATGGTTAATGGCAGTTATGGGGG + Intergenic
937245079 2:120487256-120487278 ATGGCTGATGGCACTTGTGAAGG + Intergenic
938700662 2:133876188-133876210 ATGGCTAATGGCAGTTACGGAGG - Intergenic
938776458 2:134545488-134545510 ATGGCAACTGGCAGTGTTGAGGG - Intronic
939446320 2:142314148-142314170 AAGGCTAATGGGAGTGTTCTAGG + Intergenic
939805909 2:146775906-146775928 AAGGCTAATGGCAGCATGGTTGG - Intergenic
940400483 2:153243039-153243061 ATGGCTAATATCAGTTGTGGAGG + Intergenic
943283601 2:185968623-185968645 ATTGCTTATAGCAGTTTTGGGGG + Intergenic
943631252 2:190254865-190254887 ATGGCTAGTGGCTGTCTTATTGG - Intronic
943758815 2:191586739-191586761 ATGGCTAATAGTAGTTATGGAGG + Intergenic
943870330 2:192988465-192988487 ATGGCTACTTGAACTTTTGTAGG + Intergenic
943985008 2:194607062-194607084 ATGGCTAATAGTGGTTTTGGAGG + Intergenic
944519948 2:200555681-200555703 ATAGCTAATGGCAGTTATGGTGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948579496 2:238974740-238974762 ATGAGTAATGGCAGTTCTCTGGG - Intergenic
1173234339 20:41230467-41230489 ATGGCTAGTGGCTGCTGTGTTGG - Intronic
1173752060 20:45484950-45484972 ATGGCCAGTGGCAGTTATGGCGG - Intergenic
1175875222 20:62226365-62226387 ATGGGTGATGGCAGTTTGGCAGG + Intergenic
1179351204 21:40612630-40612652 ATAGCCAATGGCAGTTTTAAGGG + Intronic
1180726128 22:17947985-17948007 ATCTGTACTGGCAGTTTTGTGGG - Intronic
1183325817 22:37193125-37193147 ATGGCTAATGGCAGTTTTGTGGG - Intronic
949998540 3:9638429-9638451 ATGGCTAATGGCACTTACGGGGG - Intergenic
950892917 3:16420772-16420794 ATGGCTAATGGCTGTGTTACAGG + Intronic
952294748 3:32051423-32051445 ATAGCTAATGGCAGTTATCAGGG + Intronic
954484559 3:50835967-50835989 ATGGCTATTGGCAGTTATGGGGG - Intronic
954782079 3:53069265-53069287 TAGGCTAATGTCAGTGTTGTGGG + Intronic
955454323 3:59103020-59103042 ATGGCTAATAGTAGTTATGGAGG + Intergenic
957749127 3:84389299-84389321 ATGTGTAATGGCAGTTGGGTTGG + Intergenic
959941092 3:112082074-112082096 ATGGTTGCTGTCAGTTTTGTTGG - Intergenic
961029307 3:123587964-123587986 ATGACCAAGGGCAGTTTTGGAGG + Intergenic
961969365 3:130943917-130943939 TTGGCTTATTGGAGTTTTGTTGG + Intronic
963929915 3:150992937-150992959 AGGACTGATGGCAGTTTTGAAGG - Intergenic
964855787 3:161143960-161143982 ATGGCTAATGGCTGTGATGGGGG + Intronic
964970226 3:162551252-162551274 ATGGGTAATGGCAGTTATGGGGG - Intergenic
965614688 3:170582350-170582372 ATGGCTAATGACAACTGTGTTGG - Intronic
966935362 3:184704599-184704621 ATGGCTAATAGTAGTTATGGAGG - Intergenic
970316301 4:14831481-14831503 AGGGCAAATGGAAGTTTTGGGGG + Intergenic
971429129 4:26545359-26545381 AATGCTAATGGCAGTTTAATGGG + Intergenic
973797641 4:54444623-54444645 ATGCCTAAGGGCAGTTTCATAGG - Intergenic
976654656 4:87476001-87476023 AGGGATAATGGTAGTTTTGATGG + Intronic
977527177 4:98159563-98159585 ATGGCTAATGGCATTTATGGGGG + Intergenic
977589884 4:98814501-98814523 ATGGCTAATGGCAGTTATGGGGG + Intergenic
977674217 4:99730443-99730465 ATGGCTAATAGTAGTTATGGAGG - Intergenic
979744387 4:124192652-124192674 ATGAATAATGGGAGTTCTGTGGG + Intergenic
980987839 4:139713129-139713151 ATGGCTAATAGTAGTTATGGAGG - Intronic
982308087 4:153954649-153954671 AAGGCTAATTGAAGTTTTGGAGG + Intergenic
986903997 5:12471154-12471176 ATGGTTATTTGCATTTTTGTGGG - Intergenic
987166109 5:15200292-15200314 ATGGCTAATAGTAGTTATGAAGG - Intergenic
987231519 5:15898568-15898590 ATGCCTAAGGACAATTTTGTTGG - Intronic
987831687 5:23103739-23103761 ATGGCTGATAGGAGTATTGTTGG + Intergenic
987866637 5:23549086-23549108 ATTGCTAATGCTAGTTTTGATGG - Intergenic
988915174 5:35884859-35884881 ATGGCTTGTGGCATTTGTGTGGG + Intergenic
989329764 5:40243027-40243049 ATGGTAAATGGCAGGTTTGGAGG + Intergenic
990070781 5:51780543-51780565 ATAGATAATGGCAGTTATGGAGG - Intergenic
991510081 5:67366268-67366290 AAGGATGATGGCAATTTTGTAGG + Intergenic
992284351 5:75218275-75218297 ATGGCTGTTTGCATTTTTGTGGG - Intronic
993132457 5:83915927-83915949 ATAGCTAGTGGATGTTTTGTTGG - Intergenic
993153738 5:84194798-84194820 ATGCCTACTGACAATTTTGTAGG + Intronic
993466027 5:88248363-88248385 ATGGCTAATGGCAGTTACGTAGG - Intronic
999515173 5:152294741-152294763 ATGGCTTATGGCAGTCTTCAAGG + Intergenic
1005087573 6:22022580-22022602 ATTGCTAAGGCCAGTTCTGTAGG - Intergenic
1006560299 6:34905419-34905441 ATTGCTACTGACAGTATTGTAGG + Intronic
1007892586 6:45309785-45309807 AAGGCTAACAGCAGTTTTCTCGG + Intronic
1009716807 6:67408303-67408325 ATGGCTAATTGCAGTTATGTAGG + Intergenic
1011341600 6:86321464-86321486 ATGGCTAATGGCAGTTATGGTGG + Intergenic
1011677268 6:89747029-89747051 ATGGTTGATGGTAGCTTTGTGGG - Intronic
1014738523 6:125122480-125122502 ATGGCCAATGGCAGTTATGAGGG + Intronic
1014859684 6:126449877-126449899 ATAGGAAATTGCAGTTTTGTAGG + Intergenic
1015377544 6:132527789-132527811 ATAGCTAATGTCAGTTATGGGGG + Intergenic
1016108532 6:140192006-140192028 ATGGCTAATAGCAGTTGTGGAGG + Intergenic
1016296234 6:142576039-142576061 ATGGCTAATAGCAGTTATGGGGG + Intergenic
1016539383 6:145146923-145146945 AAGACAAATGGCAGTTTTCTTGG + Intergenic
1018552679 6:165016307-165016329 ATGGTTAATGGCAGTATGATAGG + Intergenic
1020334875 7:7055428-7055450 GTGGCTAGTGGCAGTTGTATTGG - Intergenic
1020397137 7:7729146-7729168 ATGTTTAATGGCTGTTTGGTGGG + Intronic
1021407002 7:20282532-20282554 ATCTCTCATGGCATTTTTGTTGG + Intergenic
1022676323 7:32503105-32503127 CTGGTTCTTGGCAGTTTTGTAGG + Intronic
1024146832 7:46525341-46525363 ATGACTAATGGCAGTTATGGGGG + Intergenic
1024148949 7:46548763-46548785 ATGGCTTTTGAAAGTTTTGTTGG - Intergenic
1024220803 7:47284971-47284993 ATGCCTATTGGCAGGTGTGTTGG + Intronic
1024249751 7:47497008-47497030 ATGGCTAATGGCAGAGCCGTGGG - Intronic
1024943551 7:54786080-54786102 ATGGCTAAGGGCAGTTTGGTTGG - Intergenic
1025634446 7:63309418-63309440 ATGGCTAATGGCAGCTATGGGGG + Intergenic
1025648252 7:63438757-63438779 ATGGCTAATGGCAGCTATGGGGG - Intergenic
1025741095 7:64196374-64196396 ATGGCTAATGGCAGCTACGGGGG + Intronic
1025741556 7:64201688-64201710 ATGGCGAATGGCAGCTATGGGGG - Intronic
1026361302 7:69602819-69602841 TTGGCAAAAGGTAGTTTTGTTGG + Intronic
1027736725 7:81941920-81941942 ATGCTTATTGGGAGTTTTGTTGG - Intergenic
1030041427 7:105453840-105453862 ATGGCTAGTGGCCGCTGTGTTGG + Intronic
1031325567 7:120392716-120392738 ATGGCTTATGGCAGTTCTGGGGG - Intronic
1034250236 7:149684507-149684529 ATGGATAATGGCAGTTATGGGGG - Intergenic
1035416201 7:158689317-158689339 ATGGCTAATCTCAGTTCAGTTGG + Intronic
1035603937 8:916759-916781 AAGGCAAATGGCTGATTTGTTGG + Intergenic
1036510489 8:9395355-9395377 AGAGCAGATGGCAGTTTTGTGGG - Intergenic
1040089679 8:43385043-43385065 ATGGCAAATGGCAGTTATGGGGG - Intergenic
1040402406 8:47064616-47064638 ATGGCAAATGGCAGTTATGGGGG + Intergenic
1041228731 8:55728126-55728148 ATGGCTAGTGGCAATTATGGGGG - Intronic
1044439544 8:92207675-92207697 ATAGCTAATGGAAGTTATGGAGG - Intergenic
1046173275 8:110541723-110541745 TTTGCTTATGCCAGTTTTGTAGG + Intergenic
1050763761 9:9107128-9107150 ATGAGTAATGGAAGTATTGTAGG + Intronic
1053082648 9:35190337-35190359 ATGGCTAATAGTAGTTATGGAGG - Intronic
1056066725 9:82943220-82943242 GGTGCTAATGGCAGTGTTGTAGG - Intergenic
1056726957 9:89127678-89127700 ATAGCTAATGGCAGTTATGGGGG + Intronic
1057143178 9:92739724-92739746 GTGGCTTGTGGCAGTTTTGGGGG - Intronic
1057707866 9:97410501-97410523 AGTGCTCATGGCAGTTGTGTTGG - Intergenic
1057780702 9:98047693-98047715 ATAGCTAATGGCAATTATGGGGG + Intergenic
1057781208 9:98051983-98052005 ATGGCTAATGGCAGTTAGGAGGG - Intergenic
1059690210 9:116677505-116677527 ATGGCTAATAGCACTTATGGAGG + Intronic
1059725877 9:117007701-117007723 AATCCTAATGACAGTTTTGTGGG + Intronic
1060024045 9:120156108-120156130 ATAGCTCATTGCAGTGTTGTTGG - Intergenic
1060306807 9:122421068-122421090 ATAGCTAATGGCAGTCATGGAGG - Intergenic
1060436442 9:123597100-123597122 ATGGCAAGTGGCAGTTGTGTGGG - Intronic
1187939548 X:24368702-24368724 ATGGCTAGTGGCTATTGTGTGGG + Intergenic
1188687026 X:33081759-33081781 ATGGCTAATGGTAGTTATACAGG - Intronic
1189073080 X:37885997-37886019 ATGGCTAATGGCAGTTATGGGGG - Intronic
1189086430 X:38030170-38030192 AAGGCTAATGGCAGTTATTGGGG - Intronic
1190478024 X:50847465-50847487 ATGGTTAATGGCAGTTATGGGGG - Intergenic
1191191208 X:57669612-57669634 ATGGCTAATGGCAGTTATCTGGG - Intergenic
1191823100 X:65335021-65335043 ATAGCTTATGGCAGTTATGAGGG - Intergenic
1192307382 X:69976457-69976479 ATGCCAAATGGCACTTTTTTGGG - Intronic
1193486466 X:82090285-82090307 ATGGCTAATGGCAGTTATGGAGG + Intergenic
1193791115 X:85816022-85816044 ATGGCTAATAGTAGTTATGGAGG + Intergenic
1193855969 X:86602508-86602530 ATTGGTAATATCAGTTTTGTTGG + Intronic
1194549826 X:95283515-95283537 ATGCTTAATGGCTGTTTTCTTGG + Intergenic
1195219886 X:102736773-102736795 ATGGCTAATGGCAGTTATGGAGG - Intronic
1195558963 X:106261540-106261562 ATGGCTAATGACAGTTATGGGGG - Intergenic
1196437181 X:115685274-115685296 AGGGCTAATGACAGTTCTCTGGG - Intergenic
1196920782 X:120583290-120583312 ATGGTTAATGGCAGTTATGGGGG + Intergenic
1197281219 X:124538616-124538638 CTTGCTAATGGCAGATTTTTGGG - Intronic
1197565478 X:128079118-128079140 ATGGCTTATGCCAGTTTTCCAGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic