ID: 1183327239

View in Genome Browser
Species Human (GRCh38)
Location 22:37200881-37200903
Sequence CTGGACTAGGAACTGTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183327230_1183327239 13 Left 1183327230 22:37200845-37200867 CCCCATTTTCATAGTTTTGTTTT No data
Right 1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG No data
1183327232_1183327239 11 Left 1183327232 22:37200847-37200869 CCATTTTCATAGTTTTGTTTTTA No data
Right 1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG No data
1183327226_1183327239 27 Left 1183327226 22:37200831-37200853 CCCGTCCACTCAGCCCCCATTTT No data
Right 1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG No data
1183327231_1183327239 12 Left 1183327231 22:37200846-37200868 CCCATTTTCATAGTTTTGTTTTT No data
Right 1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG No data
1183327228_1183327239 22 Left 1183327228 22:37200836-37200858 CCACTCAGCCCCCATTTTCATAG No data
Right 1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG No data
1183327227_1183327239 26 Left 1183327227 22:37200832-37200854 CCGTCCACTCAGCCCCCATTTTC No data
Right 1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG No data
1183327229_1183327239 14 Left 1183327229 22:37200844-37200866 CCCCCATTTTCATAGTTTTGTTT No data
Right 1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183327239 Original CRISPR CTGGACTAGGAACTGTGTTT TGG Intergenic
No off target data available for this crispr