ID: 1183328393

View in Genome Browser
Species Human (GRCh38)
Location 22:37206580-37206602
Sequence CTCCCCAGTGGAAGCCTCTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183328385_1183328393 19 Left 1183328385 22:37206538-37206560 CCCAGGCCCCTACAGGTAGCTGA 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG 0: 1
1: 0
2: 4
3: 15
4: 188
1183328382_1183328393 29 Left 1183328382 22:37206528-37206550 CCTGGCTTTCCCCAGGCCCCTAC 0: 1
1: 0
2: 9
3: 35
4: 355
Right 1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG 0: 1
1: 0
2: 4
3: 15
4: 188
1183328384_1183328393 20 Left 1183328384 22:37206537-37206559 CCCCAGGCCCCTACAGGTAGCTG 0: 1
1: 0
2: 3
3: 22
4: 223
Right 1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG 0: 1
1: 0
2: 4
3: 15
4: 188
1183328387_1183328393 13 Left 1183328387 22:37206544-37206566 CCCCTACAGGTAGCTGATGCGCA 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG 0: 1
1: 0
2: 4
3: 15
4: 188
1183328386_1183328393 18 Left 1183328386 22:37206539-37206561 CCAGGCCCCTACAGGTAGCTGAT 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG 0: 1
1: 0
2: 4
3: 15
4: 188
1183328389_1183328393 11 Left 1183328389 22:37206546-37206568 CCTACAGGTAGCTGATGCGCATC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG 0: 1
1: 0
2: 4
3: 15
4: 188
1183328388_1183328393 12 Left 1183328388 22:37206545-37206567 CCCTACAGGTAGCTGATGCGCAT 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG 0: 1
1: 0
2: 4
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183328393 Original CRISPR CTCCCCAGTGGAAGCCTCTT GGG Exonic