ID: 1183328502

View in Genome Browser
Species Human (GRCh38)
Location 22:37207047-37207069
Sequence GTTCGGAGCGCCGCCGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183328494_1183328502 10 Left 1183328494 22:37207014-37207036 CCACCACGGCCACCACCATGCGC 0: 1
1: 0
2: 1
3: 47
4: 433
Right 1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1183328495_1183328502 7 Left 1183328495 22:37207017-37207039 CCACGGCCACCACCATGCGCGTG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1183328498_1183328502 -5 Left 1183328498 22:37207029-37207051 CCATGCGCGTGACCCTGCGTTCG 0: 1
1: 0
2: 0
3: 3
4: 24
Right 1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1183328497_1183328502 -2 Left 1183328497 22:37207026-37207048 CCACCATGCGCGTGACCCTGCGT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1183328492_1183328502 30 Left 1183328492 22:37206994-37207016 CCAGCAGAGCACGAAGAGCGCCA 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1183328496_1183328502 1 Left 1183328496 22:37207023-37207045 CCACCACCATGCGCGTGACCCTG 0: 1
1: 0
2: 0
3: 14
4: 96
Right 1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183328502 Original CRISPR GTTCGGAGCGCCGCCGCCGC TGG Exonic
900105628 1:979663-979685 GTTCCCAGAGCCGACGCCGCTGG - Exonic
900786927 1:4655223-4655245 GGCCGGCGCGCCGCCGCCGTTGG - Exonic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901109783 1:6785472-6785494 CCTCGTACCGCCGCCGCCGCCGG - Exonic
903438311 1:23368902-23368924 GTACAGAGCCGCGCCGCCGCAGG - Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
908534633 1:65066695-65066717 CTCCGGACCGCCGCCGCCGCGGG + Intergenic
913205527 1:116534642-116534664 GTGGGCAGCGCCGCCGCGGCGGG - Intronic
919486885 1:198157197-198157219 GCTCGGCGCGGCGCCGCCGTCGG - Exonic
920260540 1:204685272-204685294 CTGGGCAGCGCCGCCGCCGCCGG - Intronic
1065188875 10:23192983-23193005 CCTCGGAGCGCACCCGCCGCCGG - Exonic
1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG + Exonic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1076554254 10:131311692-131311714 CTCCGGAGCCGCGCCGCCGCCGG - Exonic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1078222626 11:9364354-9364376 GGCCGGAGCGCCGCTGACGCCGG + Intergenic
1080628591 11:34052462-34052484 GTCCGGACCGCCACCGCCGTCGG + Exonic
1082076608 11:47980451-47980473 CTGCGGAGCTCCGCAGCCGCCGG + Intergenic
1083940080 11:65891047-65891069 GTGCGGCGCGCCGCCCGCGCTGG - Exonic
1084028558 11:66467412-66467434 GGGGGGAGCGCCGCCTCCGCAGG + Intronic
1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG + Intronic
1090978386 11:131695026-131695048 GGGAGGAGCGCCGCCGCCGCCGG + Intronic
1096771728 12:53939653-53939675 GACCCGAGCGCCGCCGCCGCCGG + Intronic
1102853861 12:116277232-116277254 GGCCGGGCCGCCGCCGCCGCCGG + Exonic
1103700167 12:122845145-122845167 GTTCTGAGGGCCGCAGCAGCAGG - Intronic
1105000613 12:132687709-132687731 GCTCGGGGCGCTGCCGCGGCGGG + Exonic
1106422481 13:29595420-29595442 TGCCGGAGCCCCGCCGCCGCCGG - Exonic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1112652757 13:101416504-101416526 TCACTGAGCGCCGCCGCCGCCGG + Intergenic
1112768609 13:102773007-102773029 GTCCGGAGCGCCGGCTCCACCGG + Intronic
1116657928 14:47674746-47674768 GCTCCGCTCGCCGCCGCCGCCGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122226837 14:100285392-100285414 GCAGGGTGCGCCGCCGCCGCCGG + Intergenic
1129644741 15:77419843-77419865 GTTCTGGGTGGCGCCGCCGCCGG - Intronic
1130076574 15:80695231-80695253 GCTCCGAGCGCCGCGCCCGCCGG + Intronic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1135335738 16:21599693-21599715 GCTCGGATCACCGCCGGCGCCGG - Exonic
1141830749 16:86508896-86508918 GCTCGGCCTGCCGCCGCCGCGGG - Intergenic
1150383891 17:64742422-64742444 GATCCGAGCTCTGCCGCCGCCGG - Intergenic
1154303995 18:13217796-13217818 GCTCCGCGCGCCGCCGCGGCCGG + Intronic
1158601974 18:58863660-58863682 GTTCAGCGCGGCGCCGCCGGCGG - Intronic
1158653564 18:59308640-59308662 GTTCCTAGCGCCGCGGCCACTGG - Intronic
1159511215 18:69400709-69400731 GGTGGGAGCGCCTCCGCCGCCGG - Intergenic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1162100332 19:8335070-8335092 GCTCGGTGAGCCGCCGCAGCTGG + Exonic
1162396644 19:10421094-10421116 GTTCCGCGCGCATCCGCCGCGGG - Intronic
1162760594 19:12886127-12886149 CTTCGGAGCGCCACCACTGCGGG + Exonic
927717488 2:25361959-25361981 ATTCGGAGCGGAGCCGCCGAGGG - Intergenic
933886181 2:86720644-86720666 GAGCCGAGCGCCGCCGCCTCCGG + Exonic
933924000 2:87076062-87076084 GAGCCGAGCGCCGCCGCCTCCGG - Intergenic
935763504 2:106342855-106342877 GTGCTGAGCTCGGCCGCCGCGGG - Intergenic
937284543 2:120741760-120741782 GGTGGGAGGGCCGCAGCCGCGGG - Intronic
944412585 2:199458298-199458320 CTTCGCAGCCCCGCCGCCGTTGG - Intronic
946322235 2:218960818-218960840 GCTCGGTGGGCCCCCGCCGCTGG - Exonic
946339196 2:219057415-219057437 GTCCGGTGAGCCGCCGCCGGGGG - Exonic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1173831163 20:46089632-46089654 GTGCGGGGCGCGGCCGCCTCCGG - Intronic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1175859705 20:62143629-62143651 GGGCGGAGCGGCGGCGCCGCGGG + Intergenic
1178916760 21:36709269-36709291 GGGAGGAGCGCAGCCGCCGCAGG + Intronic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1181638645 22:24185729-24185751 GTCGGGAGTGCTGCCGCCGCTGG - Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
953427205 3:42804794-42804816 GTCCCGAGCGCCGCCGCCTGCGG + Intronic
953947574 3:47163352-47163374 GTCCGAGGCGCCGCCGTCGCGGG + Intronic
954882638 3:53846173-53846195 GCGCGGGGCGCCGGCGCCGCCGG - Exonic
964482811 3:157159653-157159675 GTTCGGGGCCCAGCCGCGGCCGG - Intronic
983061513 4:163166498-163166520 GTTCTGAACGCCGTCGCGGCCGG - Exonic
985575577 5:672034-672056 GTTTGGAGGGCAGCCGCCACAGG - Intronic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
998130466 5:139648933-139648955 GTTCGGTGCGCGGCCGGGGCCGG + Intronic
1001928720 5:175658079-175658101 GCCCGGAGCGCAGCCGGCGCGGG + Exonic
1007625365 6:43243562-43243584 GGTCGGAAGGCCGCCGCCGCCGG + Intergenic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1013117769 6:107115419-107115441 CGCCCGAGCGCCGCCGCCGCCGG - Intergenic
1019112009 6:169724211-169724233 GTGAGAAGCGCCGCCGCCGCTGG - Intronic
1019343059 7:517555-517577 GCCAGGAGCGCCGCCGCCCCGGG + Intronic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1022943730 7:35262055-35262077 GTTAGAAGCCCCGCCGCTGCAGG + Intergenic
1023418258 7:39951219-39951241 GGTCGGAGCGCAGGCCCCGCCGG + Exonic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029449560 7:100633276-100633298 GGTCGGAGAGCAGCTGCCGCTGG - Exonic
1034414070 7:150955787-150955809 GTTCCGAGTGCGGCCGCTGCTGG - Intronic
1037025439 8:14029767-14029789 GTTCGGAAGGCCGAGGCCGCTGG + Intergenic
1045432135 8:102124112-102124134 GCTCGGTGCGCCGCGGGCGCAGG - Intronic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1052362128 9:27573107-27573129 GCTGGGAGCGCTGCCGCTGCGGG - Intronic
1057546257 9:96021882-96021904 GTTCCGAGCGCAGCGGCTGCGGG + Intergenic
1060897125 9:127225172-127225194 GTTCGGGGCGGCGCCGGGGCGGG + Intronic
1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG + Exonic