ID: 1183330640

View in Genome Browser
Species Human (GRCh38)
Location 22:37219036-37219058
Sequence CAGCAAGAGCAGATGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183330640_1183330651 30 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330651 22:37219089-37219111 TCTCCTGGCTTCTTTGAAGGTGG No data
1183330640_1183330646 -3 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330646 22:37219056-37219078 CTGCTCATACATTGTGGTTTGGG No data
1183330640_1183330645 -4 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330645 22:37219055-37219077 GCTGCTCATACATTGTGGTTTGG No data
1183330640_1183330650 27 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330650 22:37219086-37219108 GTGTCTCCTGGCTTCTTTGAAGG No data
1183330640_1183330648 5 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330648 22:37219064-37219086 ACATTGTGGTTTGGGGTTACAGG No data
1183330640_1183330644 -9 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330644 22:37219050-37219072 CTCTTGCTGCTCATACATTGTGG No data
1183330640_1183330649 15 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330649 22:37219074-37219096 TTGGGGTTACAGGTGTCTCCTGG No data
1183330640_1183330647 -2 Left 1183330640 22:37219036-37219058 CCACCCTCCATCTGCTCTTGCTG No data
Right 1183330647 22:37219057-37219079 TGCTCATACATTGTGGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183330640 Original CRISPR CAGCAAGAGCAGATGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr