ID: 1183341542

View in Genome Browser
Species Human (GRCh38)
Location 22:37284461-37284483
Sequence CTCTGGCCTCCTCCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183341542_1183341550 15 Left 1183341542 22:37284461-37284483 CCTCCTTGAGGAGGAGGCCAGAG 0: 1
1: 0
2: 4
3: 24
4: 262
Right 1183341550 22:37284499-37284521 CATTTCCCTGTTGCCCAGACTGG 0: 1
1: 0
2: 7
3: 375
4: 6462
1183341542_1183341548 -9 Left 1183341542 22:37284461-37284483 CCTCCTTGAGGAGGAGGCCAGAG 0: 1
1: 0
2: 4
3: 24
4: 262
Right 1183341548 22:37284475-37284497 AGGCCAGAGGGAGGGAGAAAAGG 0: 1
1: 0
2: 36
3: 325
4: 2804
1183341542_1183341551 16 Left 1183341542 22:37284461-37284483 CCTCCTTGAGGAGGAGGCCAGAG 0: 1
1: 0
2: 4
3: 24
4: 262
Right 1183341551 22:37284500-37284522 ATTTCCCTGTTGCCCAGACTGGG 0: 1
1: 0
2: 3
3: 122
4: 1333
1183341542_1183341554 26 Left 1183341542 22:37284461-37284483 CCTCCTTGAGGAGGAGGCCAGAG 0: 1
1: 0
2: 4
3: 24
4: 262
Right 1183341554 22:37284510-37284532 TGCCCAGACTGGGTCTTAAATGG 0: 1
1: 0
2: 0
3: 15
4: 172
1183341542_1183341555 27 Left 1183341542 22:37284461-37284483 CCTCCTTGAGGAGGAGGCCAGAG 0: 1
1: 0
2: 4
3: 24
4: 262
Right 1183341555 22:37284511-37284533 GCCCAGACTGGGTCTTAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 98
1183341542_1183341557 28 Left 1183341542 22:37284461-37284483 CCTCCTTGAGGAGGAGGCCAGAG 0: 1
1: 0
2: 4
3: 24
4: 262
Right 1183341557 22:37284512-37284534 CCCAGACTGGGTCTTAAATGGGG 0: 1
1: 0
2: 0
3: 15
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183341542 Original CRISPR CTCTGGCCTCCTCCTCAAGG AGG (reversed) Intronic
900103077 1:971057-971079 CTCTGACCTCCTCCTCACAGGGG + Intronic
900144105 1:1150555-1150577 GTCTGGCCTCCTCCCAAATGGGG - Intergenic
900403692 1:2483305-2483327 CTCTGGCCACATCCTCAGTGGGG + Intronic
900593871 1:3471711-3471733 CTCCGGCCTCCTCCCCCAGCTGG + Intronic
901089573 1:6632393-6632415 CTCCGGCCCCCGCCTCAGGGAGG - Exonic
902788892 1:18751736-18751758 CTCTGTGCTCCTCTCCAAGGTGG + Intergenic
903647350 1:24903320-24903342 CTCTGGCCTCCACCTCACCCTGG + Intronic
904036459 1:27561601-27561623 CTCTGGCCTCCTTGTTCAGGGGG + Intronic
905446436 1:38030950-38030972 CTCTGGCCTCCTTCCCTGGGTGG + Intergenic
906059338 1:42938232-42938254 CTCTGTCCTCCTCCTCCAGGAGG + Intronic
907629892 1:56070004-56070026 CACTGGCCTCATCCTAAAGCTGG + Intergenic
909481309 1:76131012-76131034 TTCTGGCCCCCTTGTCAAGGTGG - Intronic
910112770 1:83700541-83700563 CTCTGCAGTCCTCCTCCAGGTGG + Intergenic
911943168 1:104073152-104073174 CTCCGGCCCCCGCCTCAGGGAGG - Intergenic
913076580 1:115345231-115345253 CTTTGGCCTGCACCTCAAGGTGG - Intergenic
915239982 1:154514374-154514396 CTTTAGCCTACTCCTCAAAGAGG - Intronic
915466920 1:156103535-156103557 CTCCCATCTCCTCCTCAAGGGGG - Intronic
915526261 1:156478162-156478184 CTCTGGCCTTCTCCTTGAAGAGG + Intronic
917536000 1:175875127-175875149 CTTTTGCCTCCTCTTCACGGAGG + Intergenic
917727092 1:177838574-177838596 GTATGCACTCCTCCTCAAGGAGG + Intergenic
919902468 1:202054465-202054487 TTCCAGCCTCCCCCTCAAGGAGG - Intergenic
920759034 1:208763812-208763834 CTCAGGCCTCCTCCATCAGGCGG + Intergenic
922783191 1:228269572-228269594 TTCTAGCCTCCGCCTCCAGGCGG + Intronic
1062865231 10:846839-846861 CGCTTGCCTCCTGCTGAAGGTGG - Intronic
1065046142 10:21748908-21748930 CTCTGGCCTCCCATTCATGGGGG + Intergenic
1065699485 10:28411008-28411030 CTGTGTCCTCTTCCACAAGGTGG + Intergenic
1066445655 10:35480390-35480412 CTCTCCGCTCCTCCTCAAGAGGG - Intronic
1068676438 10:59774397-59774419 CTCTGAGCTCCTCCTCTAAGGGG - Intergenic
1069855063 10:71435688-71435710 CTCAGGCCGCATCCTGAAGGTGG + Intronic
1069875494 10:71560455-71560477 CTCAGGGCCCCTCCTCAAGTGGG - Intronic
1069993465 10:72328898-72328920 CTCCTGCCACCTCCTCAGGGAGG - Intergenic
1070768234 10:79068495-79068517 TTTTGGCTTCCTCCCCAAGGTGG + Intergenic
1071905953 10:90173788-90173810 ATCTGGCCTTGTCCTCATGGTGG + Intergenic
1072654420 10:97320077-97320099 CTCTGGAAACCTCATCAAGGAGG + Exonic
1073291759 10:102416708-102416730 CACTGGCCTTCTCCACAAAGCGG + Exonic
1073323083 10:102627531-102627553 CCCTGGCTTCCTCTTCAATGAGG - Intronic
1073447502 10:103590279-103590301 CTGTGGCCTGCGCCTCAAGAAGG + Exonic
1075488669 10:122847859-122847881 CTCTGTCCTCCTGCTAATGGGGG + Intronic
1076048167 10:127311761-127311783 CTCTTGCCTCATCCTCAGTGAGG + Intronic
1076477661 10:130763751-130763773 CTCTGGCTTCCTCCTCCTGCTGG - Intergenic
1076679754 10:132165626-132165648 CTGTGGGCTCCTCCTCAGGCCGG - Intronic
1083224547 11:61276676-61276698 CTCTTGCCTCCTCCTCAGGCTGG - Exonic
1083738372 11:64694549-64694571 CTGTGGCCTCCTCCTCCAAGTGG - Intronic
1084575384 11:69985479-69985501 CCCTGGCCCCCTCCCCCAGGCGG - Intergenic
1085325682 11:75604836-75604858 CTCTGGTCTGCTCCTCAGAGAGG - Intronic
1087385905 11:97468064-97468086 CATTGGCCTCCTACCCAAGGAGG - Intergenic
1087997258 11:104824742-104824764 ATGTGGCCACCTCCTTAAGGGGG + Intergenic
1088657429 11:112014029-112014051 CTCACTCCTCCTCCCCAAGGAGG + Intronic
1089508524 11:118980655-118980677 CGCGGGCCTCCTCCGCAAAGCGG - Exonic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1094064758 12:26350771-26350793 CTCTGCCCTCCTGCTCATGGGGG - Intronic
1094388290 12:29919336-29919358 CTCTTTCCTCCCCCTCAAGTAGG + Intergenic
1095420168 12:42017145-42017167 CTCTCACCTCTTCCTAAAGGTGG - Intergenic
1097179042 12:57160486-57160508 CTCATGCCACCTCCTCATGGTGG + Intronic
1097270663 12:57772113-57772135 CTCTGGCCTGCGCCTCCACGTGG - Exonic
1098390945 12:69969300-69969322 GTCAGGCCTCCACCTCAAGGTGG + Intergenic
1098592808 12:72233329-72233351 CTCTGCCCTTATTCTCAAGGGGG + Intronic
1100785551 12:98074097-98074119 TTCAGGCTTCCTTCTCAAGGGGG + Intergenic
1101873908 12:108586479-108586501 CTCTGTCCTCCTTCTCCCGGGGG - Intergenic
1103945323 12:124522979-124523001 GTCTGGCCTCCCCATCCAGGAGG - Intronic
1104679048 12:130736740-130736762 CTAAGTCCTCCTCCTCAGGGAGG + Intergenic
1104859471 12:131916974-131916996 CACTGACCTGCTCCTTAAGGCGG + Exonic
1107102516 13:36609506-36609528 CTCTTCCCTCCACCGCAAGGAGG + Intergenic
1107359103 13:39600919-39600941 TTGTGGCCTCCTCCTCCTGGTGG - Exonic
1107553353 13:41496881-41496903 CTCTGACCATCTCCTCATGGTGG + Intergenic
1107896964 13:44974941-44974963 ATCTGGAATCCTCATCAAGGAGG + Intronic
1113080010 13:106509262-106509284 CTCTGGACTACTCCTCACTGGGG + Intronic
1113925511 13:113939488-113939510 CTCTGTCCTCCCCATCAACGTGG - Intergenic
1114268527 14:21087414-21087436 CCCAGGCCTCCTCCTCGACGCGG - Exonic
1115301845 14:31893666-31893688 CTCCCGCCTCCTCCTCACTGAGG - Intergenic
1115645408 14:35365726-35365748 CAGTGGCCTCCCCCTCAGGGTGG - Intergenic
1120031486 14:79646307-79646329 CTCTGGGCCCCTCAGCAAGGAGG + Intronic
1122453947 14:101835153-101835175 CACTGGGCTGCTCCTCATGGCGG + Intronic
1122816838 14:104318219-104318241 CCCAGGCCTCCTCCTCACTGGGG + Intergenic
1123472386 15:20565029-20565051 CTCCAACCTCCTCCTCCAGGTGG + Intergenic
1123645617 15:22435324-22435346 CTCCAACCTCCTCCTCCAGGTGG - Intergenic
1123666871 15:22614889-22614911 CTCCAACCTCCTCCTCCAGGAGG - Intergenic
1123732691 15:23160020-23160042 CTCCAACCTCCTCCTCCAGGTGG + Intergenic
1123750824 15:23357400-23357422 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1123991944 15:25689818-25689840 GCCTGCTCTCCTCCTCAAGGTGG - Intronic
1124283195 15:28381316-28381338 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124299504 15:28530297-28530319 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124320711 15:28709462-28709484 CTCCAACCTCCTCCTCCAGGAGG - Intronic
1124481783 15:30085887-30085909 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124488239 15:30137985-30138007 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124521808 15:30411314-30411336 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124536856 15:30554905-30554927 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124543329 15:30606959-30606981 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1124755287 15:32400335-32400357 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124761796 15:32452686-32452708 CTCCAACCTCCTCCTCCAGGTGG - Intronic
1124776833 15:32596382-32596404 CTCCAACCTCCTCCTCCAGGTGG + Intronic
1125475303 15:40044217-40044239 CTACGTCCTCCTCGTCAAGGTGG + Intergenic
1126860466 15:52877993-52878015 CTCTGGCTTCCTCTCCCAGGGGG + Intergenic
1127703976 15:61529099-61529121 CTCTGGAAACCTACTCAAGGCGG + Intergenic
1128224254 15:65990829-65990851 CTCTGGCCTGTTTCTCAAGTGGG - Intronic
1128419741 15:67480255-67480277 CTCAGCCCTCCTCCTGAAGTTGG + Intronic
1129120797 15:73395221-73395243 CTCTGGCCGGCTCCTCAAAAAGG - Intergenic
1129232165 15:74202903-74202925 CTGGGGCCTCCTCCCCCAGGAGG - Intronic
1129300702 15:74623930-74623952 CTCCGGCCTCCTCCTAAAACAGG - Intronic
1129523567 15:76200496-76200518 CCCTGGCCTCCTCCTGCAAGTGG + Intronic
1129769673 15:78194891-78194913 GTCAGACCTCCTCCTCTAGGCGG - Intronic
1129880729 15:79004531-79004553 CTCTGGCCTCATCCTTAGAGAGG + Intronic
1133098114 16:3461347-3461369 CTCTGCCCACCTCCGCAGGGGGG - Intronic
1133226154 16:4341418-4341440 CTCCGGCCTCAGCCTCCAGGAGG - Exonic
1134291037 16:12902885-12902907 CTCTGGCCGCCTCCTCCCGCTGG + Intronic
1136540708 16:30926284-30926306 CTCTGGCCTCTTCCTCACCCAGG + Intronic
1138486388 16:57347492-57347514 CTCTTGCCTCATTTTCAAGGAGG - Intergenic
1139965337 16:70742175-70742197 CTCTTCTCTCCTCCTCAAAGTGG - Intronic
1140479955 16:75257076-75257098 CTCTGTCCTCGTCCTCAGAGAGG + Intronic
1141569241 16:84924385-84924407 CTCTGGGCCCCTCTTCAAAGTGG + Intergenic
1141718277 16:85739722-85739744 CTGTAGCCTCCACTTCAAGGAGG - Intronic
1142554069 17:760840-760862 CTCTGGCCTCAGCCTCCAAGTGG - Intronic
1142905951 17:3041925-3041947 CTCTGGCCGTCTCTTCAATGAGG + Intergenic
1143671328 17:8397964-8397986 CCCTGGGCTCCTCCTCAAGCTGG - Intergenic
1143729999 17:8876016-8876038 CCCCATCCTCCTCCTCAAGGTGG - Intergenic
1144710697 17:17399659-17399681 CTCTGGCCTCATCCTGAGGGAGG - Intergenic
1144717671 17:17445700-17445722 CTCTGGCTTCCTCCGCATGTTGG + Intergenic
1146133113 17:30295277-30295299 CTCTGTCCTCATCATCAGGGTGG + Intergenic
1146675732 17:34772616-34772638 CTCTGTCCTCCTCCTCCTCGAGG + Intergenic
1148211968 17:45814008-45814030 CTCTGGCCTCGTCCTCGCTGTGG + Intronic
1148346723 17:46908300-46908322 GTCTGGCCCTCTCCTCAAGAGGG + Intergenic
1148447085 17:47744370-47744392 CTCTGCCCTCCTCCCCACCGGGG - Intronic
1149987145 17:61355950-61355972 CTCTGGCCTGCTTCTTCAGGTGG - Intronic
1150443443 17:65210299-65210321 CTCTGGTCTCATCCTCCAAGTGG + Intronic
1150847748 17:68676823-68676845 CTCTGGGCTCCACTTTAAGGTGG - Intergenic
1151267623 17:72968922-72968944 CTCTGATCTCCTACTCAAGCAGG - Intronic
1151307505 17:73272716-73272738 CTCTCTCCTCCTCCCCATGGGGG - Intergenic
1153350630 18:4077482-4077504 CCCTGCCCTCCGCCACAAGGAGG - Intronic
1153723037 18:7926737-7926759 CTCTGGGTTCCTCCTCCAGGGGG - Intronic
1153931345 18:9882406-9882428 CTGTGGCCTCCTTCTCAAGAAGG - Intergenic
1155654500 18:28177718-28177740 CTCCGGCCTCGGCCGCAAGGGGG + Intergenic
1155758803 18:29537841-29537863 CTGTGCCCTCCTCCTCAAAAGGG - Intergenic
1155888929 18:31242457-31242479 CTCTTTTCCCCTCCTCAAGGTGG + Intergenic
1156308916 18:35904937-35904959 GCCTGGCCTCCTCTTCCAGGTGG + Intergenic
1160117196 18:76090410-76090432 CTCAGGCCTCCTCCCCATGGAGG - Intergenic
1160379939 18:78446524-78446546 CTCTGGCCAGCTCCCCACGGGGG - Intergenic
1167048357 19:47064890-47064912 CCCTTCCCTCCTCCTCAGGGTGG - Exonic
925738716 2:6986445-6986467 CTCTGGCCAGCTCAACAAGGGGG - Intronic
925856625 2:8135155-8135177 GCCTGGCCTCCTCCTCCAGGTGG - Intergenic
928066879 2:28174401-28174423 CACTTGCCTCCTCCACAAAGAGG + Intronic
930264948 2:49188908-49188930 CTATGGGCACCTCCTCCAGGAGG - Intergenic
932093807 2:68829304-68829326 CTCTGGCCTCCCCCTCTCAGCGG - Intergenic
933756400 2:85642310-85642332 CTCTGTCATCCTACTCAAGGAGG - Intronic
933846061 2:86328226-86328248 CACTAGCCTCTTTCTCAAGGTGG + Intronic
934103973 2:88679471-88679493 CTCTCACCTCCTCCTTGAGGTGG + Intergenic
934519855 2:95013318-95013340 CTCTACCCTCCTTCTCAAGGGGG + Intergenic
937253337 2:120538043-120538065 CTCTTGGCTCCTCCTAAAGCTGG + Intergenic
937349707 2:121153151-121153173 CTCTGGCGTGGTCCTCATGGAGG + Intergenic
937552205 2:123108040-123108062 CTATGTCCTACTCTTCAAGGTGG + Intergenic
938041847 2:128082685-128082707 CTGTGGCCCCCACCTAAAGGTGG + Intergenic
938081038 2:128370311-128370333 CTATAGGCTCCTCCTCCAGGAGG + Intergenic
938944518 2:136199607-136199629 CTCTGGCCACCTCATCCGGGAGG + Intergenic
941096557 2:161244756-161244778 TTCTAGCCTCCGCCTCCAGGCGG + Intergenic
943541950 2:189226724-189226746 CAGAGGCCTCCCCCTCAAGGAGG + Intergenic
944427082 2:199594720-199594742 CTCTGGCCTTCTCCTCAAGTGGG + Intergenic
947071009 2:226287909-226287931 ATCTGGCCTCTGCCTCAAAGTGG + Intergenic
947073477 2:226317123-226317145 TCCTGGCCTCCTGCTCCAGGGGG + Intergenic
947463708 2:230323786-230323808 CTCCGGCCACCTTCTGAAGGTGG - Intergenic
947472552 2:230412349-230412371 CTCTGGCCACCTTCTGAAGGTGG - Intergenic
948846890 2:240687568-240687590 CTCTGGCCTCCGTCTACAGGTGG + Intergenic
948895714 2:240925985-240926007 CTGTGGCCTCGTCCCCAAGAGGG - Intronic
1168972713 20:1941723-1941745 CTCTGGCCTGGTCCTCATGGAGG - Intergenic
1169195559 20:3680586-3680608 CTCTAGCCTCCTTTCCAAGGTGG - Intronic
1169514837 20:6304262-6304284 TACTGGCCTCCTACTAAAGGAGG - Intergenic
1172106721 20:32521601-32521623 CCCTGTCCTCCTCCTCAACTAGG - Intronic
1173228336 20:41175048-41175070 CTGTGTCCTCCTCCTCAGGCAGG - Exonic
1173620731 20:44434075-44434097 CTCTACCCTCATCCCCAAGGAGG - Intergenic
1174096395 20:48092813-48092835 CCCTGGCCTCCTCCTCCATCAGG - Intergenic
1174104574 20:48153199-48153221 CACTTGCCTCCTTCTCAAGGGGG + Intergenic
1174184834 20:48699058-48699080 CACTGTCCTCCTCCTCTAGAGGG - Intronic
1178441125 21:32599148-32599170 CTCTGGTCACTTCTTCAAGGGGG + Intronic
1178931340 21:36821198-36821220 CTGTGGCCCCCTGCCCAAGGTGG - Intronic
1179618151 21:42594993-42595015 CCCTCGCCTCCTACTGAAGGAGG + Intergenic
1180036454 21:45252736-45252758 CGATGTCCTGCTCCTCAAGGCGG - Intergenic
1180048386 21:45320253-45320275 CACGGGCCTCCTCCTGCAGGTGG + Intergenic
1180058705 21:45374018-45374040 CTGTGGGCTCCTCCCCACGGGGG + Intergenic
1180193609 21:46181083-46181105 TGCTGTCCTCCTCCTCAAGAAGG - Intronic
1182259423 22:29062600-29062622 CACTGGCCTCCCCCTCAGGAGGG - Intergenic
1182586971 22:31349112-31349134 CTCTGGCCACTTCCCCAAGGTGG - Intergenic
1183290016 22:36995411-36995433 CTCTGACCTCCTTCTGAAGCTGG + Intronic
1183341542 22:37284461-37284483 CTCTGGCCTCCTCCTCAAGGAGG - Intronic
1183601842 22:38844307-38844329 CTCGGGCCCCCTCCCCAAGCCGG + Intergenic
1183680565 22:39326475-39326497 CCCAGGGGTCCTCCTCAAGGGGG + Intergenic
1184235782 22:43182332-43182354 CTCCCGCCTCCTCCTCCAGCTGG - Intronic
1184247535 22:43243267-43243289 CCCTGGCTTCCTCCTCCAGCTGG + Intronic
1185341132 22:50291653-50291675 CTCTGAGCTCTTCCTCAGGGTGG + Intronic
949425299 3:3909461-3909483 ATCTTGGCTCCTCCTCAAGTGGG + Intronic
949641337 3:6038456-6038478 CTGTGGCATCCCCATCAAGGTGG - Intergenic
949771861 3:7587887-7587909 CACTGGCCTCTTTCTGAAGGGGG - Intronic
950495938 3:13334723-13334745 CTCTGGGCCCCTCTGCAAGGTGG - Intronic
951904381 3:27689186-27689208 CTCTGTCCTTCCCCTCAGGGTGG - Intergenic
953019718 3:39105804-39105826 CTCTGGTCTCCTCCTCACACTGG + Intronic
953791403 3:45950555-45950577 CTCTGGCCTCCTCCTCCAAGGGG + Intronic
954396716 3:50296989-50297011 CTTTGGCCGCCGCCTCATGGAGG - Exonic
955156529 3:56422132-56422154 CGCTGGCCTCCTAGTCCAGGGGG - Intronic
955655904 3:61244615-61244637 ATCTGGCCTTCTCCTGAAGCAGG + Intronic
955664563 3:61336855-61336877 CTCTGGGCTCCCACACAAGGTGG + Intergenic
956122764 3:65982439-65982461 CTCTGGACTTCTGCTCAGGGTGG - Intronic
956881873 3:73519249-73519271 CTCTGGCCTCCTCTTTACGCTGG - Intronic
959901447 3:111666163-111666185 GTCTGGCCTCATCCTCACAGTGG - Intergenic
960610943 3:119554345-119554367 CTCTTGCCTCCTCCTACAGGAGG + Intronic
961494924 3:127284481-127284503 CGCTGGCCTCTTCCTGCAGGAGG + Intergenic
961781976 3:129325634-129325656 CGCTGGCCTCCTCCACAGAGAGG + Intergenic
963259158 3:143176341-143176363 CTGGGGCCGCCTCCTCCAGGCGG + Intergenic
963317156 3:143771916-143771938 CTCTGTCCTCCTGCTCAACCTGG - Intronic
968665983 4:1822634-1822656 CTCTGGGCTCCTCTTCAACGCGG - Intronic
968702296 4:2062798-2062820 ATCCAGCCTCCTACTCAAGGAGG - Intronic
970163296 4:13210581-13210603 CTTTGGCCTCCTCCTGAGAGAGG + Intergenic
972026983 4:34393193-34393215 CTCTGACCTCCCTCTCAATGAGG - Intergenic
972666248 4:41167882-41167904 CTCTGGCCTCCTCTGCTAGCTGG - Intronic
973627974 4:52791598-52791620 CACTGTTCTCATCCTCAAGGAGG - Intergenic
975763594 4:77642370-77642392 CTCTGACCTCATCCTCCAGTGGG - Intergenic
977935779 4:102803090-102803112 CTCTGTTCTCCTCTTGAAGGTGG - Intronic
984632007 4:182070994-182071016 TTCTGGGCTCATCCTCAAGAGGG - Intergenic
985074739 4:186203361-186203383 CTGTGGCCTCCTCCACAGGTCGG + Intronic
985074746 4:186203402-186203424 CTGTGGCCTCCTCCACAGGCCGG + Intronic
985074754 4:186203445-186203467 CTGTGGCCTCCTCCACAGGCTGG + Intronic
985696452 5:1343588-1343610 TTCTGGCCTCCCCTTCATGGAGG + Intronic
985783389 5:1882221-1882243 GTCTGGCCTCCTCCGCCACGTGG + Intronic
986787216 5:11125454-11125476 CTTTGGCCTCCTCATCCGGGAGG + Intronic
988792625 5:34622780-34622802 CTCGGGCCTCCCCCACAAGTTGG + Intergenic
990568303 5:57052306-57052328 CCCTGAGCTCCTCCTCATGGTGG + Intergenic
997456263 5:134019840-134019862 CTCTAGCCTCCTCCTGAATCTGG + Intergenic
997667475 5:135643257-135643279 CTCTGGCCTCATTCTCACTGAGG - Intergenic
999836680 5:155381040-155381062 CTCTTTCCTCCTCCTCACTGTGG - Intergenic
1001595023 5:172892829-172892851 CTCTGTCCTCCTCCTCTATCTGG + Intronic
1002025228 5:176392318-176392340 CTGTTGCCTCCACCTCCAGGAGG - Intronic
1003446765 6:6191963-6191985 CTCTGGTCACCTCTTCAAAGAGG - Intronic
1003497495 6:6677292-6677314 ATCAGGCCTCCCCCTCAGGGTGG + Intergenic
1003727822 6:8785878-8785900 CTCTGCCCTCCTCCCCCAGGGGG - Intergenic
1003763544 6:9210015-9210037 CTTTGGCATCCTCCACAATGAGG + Intergenic
1005009388 6:21321635-21321657 CTCTGACCTTCTCCTGAAGTGGG + Intergenic
1006900246 6:37495620-37495642 CTCTAGCCTCCCCCTCAAAGTGG - Intronic
1012982708 6:105846867-105846889 GCCTGCCCTGCTCCTCAAGGTGG - Intergenic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1014422987 6:121267774-121267796 CTCTCTCCTCCTCCTCAAGTGGG + Intronic
1018926531 6:168210853-168210875 CTGGGGTCTCCTCCTCACGGGGG + Intergenic
1020107322 7:5428148-5428170 CCCTGGCCTCTTCCTCCAGCCGG + Intergenic
1020955631 7:14737124-14737146 CACTGGCCTTCTCCTCCATGTGG - Intronic
1021927043 7:25543698-25543720 CTGTGGCCACCTCCTCTAGTTGG + Intergenic
1022178455 7:27895179-27895201 CCCTCTCCTCCTTCTCAAGGCGG + Intronic
1022956516 7:35386292-35386314 CTGTGGCGTCCCCCTCATGGAGG - Intergenic
1023842567 7:44105315-44105337 CTTTGCCCTCCTACTCCAGGAGG + Intronic
1023896603 7:44438980-44439002 CACTGGCCTCCTCTTCACCGAGG - Intronic
1023931180 7:44707596-44707618 CTTTGACCTCCTGCTGAAGGAGG + Exonic
1024656847 7:51458231-51458253 CTCTGGCCTTCCCCTGAAGCAGG + Intergenic
1025611349 7:63077855-63077877 CTCAGGCCTGCTTCTCAGGGTGG - Intergenic
1025812171 7:64882297-64882319 CAATCGCCTCCTCCTCCAGGGGG + Intronic
1026528611 7:71177249-71177271 CTCTGTCCTATTCCCCAAGGTGG - Intronic
1026854222 7:73742628-73742650 CTCTGGCCTCCCCTAGAAGGAGG - Intergenic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1033290783 7:140080938-140080960 CTCTGGCTTCCTTCTCCAGTAGG + Intergenic
1033686177 7:143643187-143643209 TTGTGGCCTCCTCCTCAATCTGG + Intronic
1033689561 7:143724128-143724150 TTGTGGCCTCCTCCTCAATCTGG - Intronic
1033698436 7:143814434-143814456 TTGTGGCCTCCTCCTCAATCTGG - Intergenic
1034849354 7:154479602-154479624 CTCTGGGCTCCCTCTCAAAGAGG + Intronic
1034967502 7:155400276-155400298 CTCTTGACTCGTCCTCATGGAGG - Intergenic
1036036967 8:5030187-5030209 CCCTGGCCTCCTCCTTGAGATGG - Intergenic
1037630192 8:20648948-20648970 CCCTGCCCTCCTACTCAAAGGGG + Intergenic
1040487133 8:47884195-47884217 CTCCTGCCTTCTCCTCAAGTGGG + Intronic
1042204107 8:66311185-66311207 CTCAGCCCTTGTCCTCAAGGAGG + Intergenic
1045229096 8:100283494-100283516 CCCTGGGCCCCTCCTCAAGTGGG + Intronic
1045301467 8:100914306-100914328 CTCTCCCCTCCTCCACTAGGGGG + Intergenic
1045322630 8:101093441-101093463 CTGTGGGTTCCTCCTCCAGGGGG - Intergenic
1047446190 8:124921845-124921867 CTCTAGGGTCCTCTTCAAGGAGG - Intergenic
1047732411 8:127737835-127737857 CTCTCGCCTTCTCCTTCAGGTGG + Intronic
1048910378 8:139129166-139129188 TTCTGGCAACCTCCTCAGGGAGG + Intergenic
1049214696 8:141402301-141402323 CTCTGGCGCCCTGCTCAGGGAGG + Intronic
1049346340 8:142141107-142141129 CTCTGGCCTCCTCCTCGATGTGG + Intergenic
1049564550 8:143331444-143331466 GTGTGGCCTCCACCTCACGGGGG + Intronic
1049645561 8:143734179-143734201 CTCTGGCCTCCTCGCCGAGTTGG + Intergenic
1049758999 8:144323436-144323458 CTGGGGCTTCCTCCTCATGGGGG - Intronic
1050335571 9:4586839-4586861 CTCTTGTCTCCTCCTCCAGGAGG + Exonic
1050709914 9:8449825-8449847 CTCTGCCCTCTTCCTATAGGGGG + Exonic
1053428279 9:38025360-38025382 CTCAGGCTTCCTGCTCTAGGGGG + Intronic
1057179582 9:93022492-93022514 CTCAGCCCTCCGCCTCCAGGAGG - Intronic
1060133920 9:121133228-121133250 CTATGCCCTGCTCCTAAAGGTGG + Intronic
1060889199 9:127177520-127177542 CCCTGGGCTCTTCCTCAGGGAGG - Intronic
1061287266 9:129631146-129631168 CTCGGGCTGCCTCCTCCAGGCGG + Intronic
1061929609 9:133825569-133825591 CTCAGGCGTCCTCCACAACGCGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1203586040 Un_KI270747v1:4299-4321 CTTTGGCATCCTTCTCACGGAGG + Intergenic
1188412506 X:29891101-29891123 CTCTGGCCTCCTCCTGACAAAGG + Intronic
1190254571 X:48752954-48752976 CTCAGGCCTCCTCATCCAGAGGG + Intergenic
1196665312 X:118309724-118309746 ATGTGCCCTCCTTCTCAAGGCGG + Intergenic
1197153507 X:123245527-123245549 CTGTGTCCACCTCCTCAATGAGG - Intronic
1198051064 X:132954086-132954108 CTCTGGCCTCTTGCTGAAGATGG + Intronic
1198302083 X:135343218-135343240 ATCTGCCATCTTCCTCAAGGAGG - Exonic
1199044883 X:143158038-143158060 CTCGCTCCTCCTCCTAAAGGTGG + Intergenic
1200156880 X:153981451-153981473 CTCTGGCCTCTGACACAAGGTGG - Intronic
1201599609 Y:15713533-15713555 CTCTGGACCCCTCCTCTGGGGGG + Intergenic