ID: 1183343029

View in Genome Browser
Species Human (GRCh38)
Location 22:37292527-37292549
Sequence CTGGGTTTCCGGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183343016_1183343029 13 Left 1183343016 22:37292491-37292513 CCTGGAGGAGGTGGGCCTCTGTG 0: 1
1: 0
2: 2
3: 43
4: 375
Right 1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG 0: 1
1: 0
2: 3
3: 23
4: 280
1183343019_1183343029 -2 Left 1183343019 22:37292506-37292528 CCTCTGTGAATAGGGCAAGTCCT 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG 0: 1
1: 0
2: 3
3: 23
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183343029 Original CRISPR CTGGGTTTCCGGAGGGAAGG GGG Intronic
900650381 1:3727400-3727422 CTGGGCCTCCGGAGGGAGGTGGG + Intronic
900966010 1:5959133-5959155 CATGGTGTCCGGAGGGAGGGAGG - Intronic
901215938 1:7555462-7555484 CTGGGTCTCAGGAGAGAAAGAGG - Intronic
902446757 1:16471287-16471309 CAGGGGTTAAGGAGGGAAGGAGG - Intergenic
902525431 1:17054165-17054187 CCGGGTGGGCGGAGGGAAGGCGG + Exonic
902589938 1:17466561-17466583 GTGGGATTCGGGAGGGAAAGTGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903221632 1:21872761-21872783 CTGGGTAGACGGATGGAAGGAGG + Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
905031254 1:34885745-34885767 CTGGCTTCCCGGCGGGATGGGGG + Exonic
905370252 1:37479241-37479263 CTGGATTTCCTGAGGGATGGGGG - Intronic
905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG + Intergenic
907418221 1:54329112-54329134 CTGGACTTCTGGAAGGAAGGGGG + Intronic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
910766787 1:90790080-90790102 CTGGCTTTGAGGATGGAAGGGGG + Intergenic
910857781 1:91713188-91713210 CTGGGCTTATGGAGCGAAGGGGG - Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912709864 1:111942585-111942607 TTGGTTATCCGGAGGGCAGGAGG - Intronic
913998384 1:143670897-143670919 CAGGGATTAAGGAGGGAAGGAGG + Intergenic
914703815 1:150155599-150155621 CGGGGTGTCTGGAGGGAACGAGG - Intronic
915249401 1:154577694-154577716 CTTGGTTTCCTCAGGGAAGAGGG - Exonic
915288613 1:154868365-154868387 CTGGGTCTCCTGAGGGCATGGGG - Intronic
915357408 1:155263766-155263788 GTGGTTTTGTGGAGGGAAGGAGG - Intronic
915461721 1:156074666-156074688 CTCGGTTGCCGGGGGGCAGGTGG - Exonic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
918535870 1:185573784-185573806 ATGGGCTTCCAGACGGAAGGAGG + Intergenic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
922784904 1:228277965-228277987 CAGGGACTCAGGAGGGAAGGGGG + Intronic
923107444 1:230865583-230865605 CTGGTTCTCCTCAGGGAAGGAGG - Intronic
923430866 1:233919226-233919248 CTAGTTGTCCTGAGGGAAGGTGG + Intronic
1062761270 10:22463-22485 TTGGGTTGCAGGAGGTAAGGTGG - Intergenic
1063131001 10:3176592-3176614 CTGGGTTTCCAGAAAGTAGGAGG - Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1066243228 10:33557922-33557944 TTGGCTTTCCGGAGGGATGCTGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1069606906 10:69744459-69744481 CTTGGATTCCCCAGGGAAGGAGG - Intergenic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1071371913 10:84960025-84960047 CTGGGTTGCAGCAGAGAAGGAGG - Intergenic
1072623577 10:97096706-97096728 CTGGGTTTGCTGGGGGAAGGGGG - Intronic
1073074023 10:100812155-100812177 CTCGGTTCCCTGATGGAAGGTGG - Intronic
1073077134 10:100831142-100831164 CTGGGATTCTGATGGGAAGGAGG - Intergenic
1073214090 10:101827105-101827127 CTGGGTGTCAGGCAGGAAGGGGG + Intronic
1075020505 10:118948718-118948740 CTGGATTTGCAGAGGGAGGGAGG - Intergenic
1076404142 10:130201215-130201237 GTGAGTACCCGGAGGGAAGGAGG + Intergenic
1076699861 10:132265816-132265838 CTGGCTGTCCGGGGGGATGGAGG - Intronic
1077017840 11:404753-404775 CTTGGCTTCCGCAGGGCAGGGGG + Exonic
1077111510 11:864157-864179 CTGGGTTGCCCCAGGGATGGGGG + Intronic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1078413817 11:11149083-11149105 CTGGATTTCAGGAGCGAGGGTGG + Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080264656 11:30388345-30388367 CTTGGCTCCCGGAGGGAAGGGGG + Intronic
1080574832 11:33588725-33588747 TAGGGTTTGCTGAGGGAAGGTGG - Intronic
1081236993 11:40658449-40658471 CTGGGTTTCAGTAGAGAAAGGGG + Intronic
1081613651 11:44578196-44578218 CTGGGTGTCCAGAGGAAAAGGGG - Intronic
1083486018 11:62983496-62983518 CTGGGTGGCCGGAGGGGAGTGGG + Intronic
1083632582 11:64103455-64103477 CTGTGTCTCCGGGGGAAAGGAGG - Exonic
1084069238 11:66723366-66723388 CTCGGGTTCTGGAAGGAAGGAGG + Intronic
1084771161 11:71343703-71343725 CTGGGTTCCGGGTGGGAGGGAGG - Intergenic
1085196407 11:74674726-74674748 CTGGCTTTGAGAAGGGAAGGGGG - Intergenic
1085407919 11:76275004-76275026 CTGACTTTGAGGAGGGAAGGGGG + Intergenic
1086408809 11:86522950-86522972 TTTGGTATCCGGGGGGAAGGGGG + Intronic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1088739818 11:112758083-112758105 GTGGGGTTCCGGAGTGAAGGGGG - Intergenic
1089125772 11:116175522-116175544 CTGGGTTTCCTTAGGGATAGAGG - Intergenic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089562381 11:119350542-119350564 AGGGGTTTCTGGAGGAAAGGAGG + Intergenic
1089699742 11:120237464-120237486 CTGGGGTTCTGGGGGGAATGGGG - Intronic
1089806918 11:121098580-121098602 CTGGCATTCAGGAGAGAAGGTGG + Intergenic
1094810276 12:34130202-34130224 TTGGGTTGCAGGAGGTAAGGTGG - Intergenic
1095963691 12:47852079-47852101 CTGGGGTTCCTTAGTGAAGGGGG + Intronic
1096575270 12:52548863-52548885 CTGGGTTCCCTGAGTGAAGAAGG + Intronic
1097889045 12:64759204-64759226 CTGGGCTGCAGGAGGGCAGGTGG + Exonic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1101858455 12:108463388-108463410 TTGGGATTCTGGAGGGCAGGTGG - Intergenic
1102206835 12:111096619-111096641 CTTGCTTTCTGGAGGGAAAGAGG - Intronic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1103346218 12:120252103-120252125 CTGGGTTTGGGGTGGGGAGGTGG - Intronic
1104970347 12:132528098-132528120 CTGGGGCTCCAGAGGGAAAGCGG - Intronic
1106398296 13:29403048-29403070 CTGAACTTCAGGAGGGAAGGAGG + Intronic
1107821681 13:44291569-44291591 GTGAGTTTCCAGGGGGAAGGTGG + Intergenic
1114484085 14:23052813-23052835 CTGGGTTTCACGGGGGGAGGGGG + Intronic
1114549244 14:23523750-23523772 CTGGGGTTCCAGATGGAATGGGG - Exonic
1115892683 14:38049374-38049396 CTGAGTTTCTTGAGGGAATGAGG + Intergenic
1118332485 14:64825042-64825064 ACGGGTTTCAGGAGGGCAGGTGG + Intronic
1118332513 14:64825162-64825184 AAGGGTTTCAGGAGGGCAGGTGG + Intronic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1121472656 14:94167284-94167306 CAGGGTTTGGGGTGGGAAGGAGG + Intronic
1121509349 14:94500792-94500814 CTGGGGGTCCAGAGGCAAGGTGG - Intronic
1122023867 14:98860327-98860349 CTGGGTTGCAGGATGGGAGGTGG - Intergenic
1124159291 15:27254257-27254279 CGAGGTTTCCAGAGGGAGGGAGG + Intronic
1124631847 15:31342393-31342415 CTGGGTCTCAGGAGGGAAGGCGG - Intronic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130100794 15:80892436-80892458 CTGGGTTTTAAGAGAGAAGGTGG - Intronic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1132694791 16:1197079-1197101 CTGGCTTCCCGAAGGGCAGGTGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133025786 16:2988426-2988448 CTGGGGTTCTGGAGACAAGGAGG + Intergenic
1133220520 16:4317391-4317413 CTGGCATCCTGGAGGGAAGGTGG + Intronic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133421868 16:5653215-5653237 CTGGGTTTCTGTGAGGAAGGTGG + Intergenic
1133971010 16:10568009-10568031 CTGGGCTTCCTGAGGCAAGACGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134143993 16:11745376-11745398 CGGGGTTTGAGGAGGGAATGGGG + Intergenic
1134855357 16:17514280-17514302 CTGGGTTGCCGCAGAGAAAGAGG + Intergenic
1135939356 16:26807552-26807574 ATTGGTTTCTGGGGGGAAGGAGG - Intergenic
1137398194 16:48131898-48131920 CTGGGCTTCCTGAGCCAAGGTGG - Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1141148265 16:81547103-81547125 CTGGGCTCCCGGAGGCAGGGAGG + Intronic
1141463944 16:84194864-84194886 CTTGGCTTCCTGAGGGACGGAGG + Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1143134571 17:4704301-4704323 CTCGGTTCCCGGAGTGATGGCGG + Exonic
1143769247 17:9157547-9157569 CTGGGTTTCTGGTTGGAAAGTGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1145018825 17:19414927-19414949 CTCGGTTGCCGGAGGGGAGCTGG - Intronic
1147444468 17:40466518-40466540 CTGGCTTTTGGGAGGGGAGGTGG + Intergenic
1147607402 17:41782035-41782057 CTGGATTCCCTGAGGGCAGGCGG - Intronic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1152351294 17:79785292-79785314 CCGGGTTTCCTGAGGCAAGAGGG - Exonic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1152954177 18:22795-22817 TTGGGTTGCAGGAGGTAAGGTGG - Intergenic
1153909887 18:9697466-9697488 GTGGGTTGGCGCAGGGAAGGTGG + Intergenic
1156388633 18:36629500-36629522 CTGGGTTTCTTGAGGGAGGTTGG + Intronic
1156463103 18:37332659-37332681 CTGGTTTCCCAGGGGGAAGGAGG + Intronic
1156479717 18:37428410-37428432 CTGGGTCTCTGTAAGGAAGGAGG + Intronic
1157190322 18:45576237-45576259 CTGGGTGTTTGGAGAGAAGGTGG + Intronic
1157335212 18:46732880-46732902 CTGGGTCTCGGGAGGGCTGGTGG + Intronic
1159388652 18:67759550-67759572 CTGGGTTGGAGCAGGGAAGGGGG - Intergenic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160715541 19:574898-574920 CTGGGTTTCCACAGGGCTGGCGG - Intronic
1161068233 19:2248492-2248514 CTGGGCCTTCGGAGGGAAGTGGG - Exonic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1162431556 19:10631854-10631876 TTGGCTTTCCTGGGGGAAGGAGG - Exonic
1162905036 19:13818213-13818235 CTGGCTCCCGGGAGGGAAGGGGG - Intronic
1163358339 19:16829554-16829576 ATGGGTTCCCCGAGGGAGGGCGG - Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1163752167 19:19084375-19084397 GCGGGTTTGGGGAGGGAAGGTGG - Intronic
1163897047 19:20068436-20068458 TTGGGTTTACAGAGGGGAGGGGG - Intergenic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165926311 19:39328229-39328251 CTGGGTCCCGGGAGGGAAGGAGG - Intergenic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166674538 19:44731998-44732020 CTATGTCTCCGGAGGGCAGGTGG + Intergenic
1167248063 19:48385716-48385738 CTTGGTTTGTGGAAGGAAGGTGG + Intronic
1167793002 19:51692337-51692359 CTGGGTCTCTGGGGAGAAGGAGG + Intergenic
1168247536 19:55120474-55120496 CTTGTTTTCCTGGGGGAAGGAGG - Intergenic
1168354424 19:55692563-55692585 GTGGGTTTCTGGGGGGCAGGGGG + Intronic
925851774 2:8088708-8088730 CTAGCATTCCAGAGGGAAGGAGG + Intergenic
926108966 2:10170067-10170089 CAGGCTTTCCAGAGAGAAGGAGG + Intronic
926395141 2:12433728-12433750 CATGGTTGACGGAGGGAAGGAGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
930552464 2:52852673-52852695 CAGAGTTCCCGGAGGGGAGGGGG - Intergenic
930624164 2:53678315-53678337 CTGGGTTACCGGGTTGAAGGCGG - Intronic
932714160 2:74089622-74089644 ATGGGTTTACGGAAGTAAGGGGG - Intronic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
936875453 2:117184051-117184073 CTCGGTTTCCAGAGGCAAGTGGG - Intergenic
942249388 2:174034517-174034539 CTGGGATGCCGGAAGGAGGGTGG + Intergenic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
945733172 2:213566136-213566158 ATGGGTTGCTGGAGTGAAGGAGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946761201 2:222994923-222994945 CAGGGTTTTCTGAGGGAATGTGG + Intergenic
947342313 2:229152861-229152883 TTGGGTTTGGGGAGGGAAAGAGG - Intronic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948131888 2:235607189-235607211 CTGGGTCTGGGCAGGGAAGGGGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948311395 2:236989606-236989628 CCAGGTTTCCAGAGGGAACGAGG - Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
1169213858 20:3782834-3782856 TCGGATTTCGGGAGGGAAGGTGG + Intergenic
1172016196 20:31874858-31874880 CTGGGTTTGCAGATCGAAGGGGG + Intronic
1172884557 20:38222509-38222531 CTGGGCCTCCAGCGGGAAGGTGG - Exonic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1174142896 20:48429021-48429043 CTGGCTTTGAGGATGGAAGGAGG - Intergenic
1175887740 20:62302275-62302297 AGGGGTTCCCGGAGGGGAGGGGG - Intronic
1176191134 20:63810442-63810464 CTTGGTTTGCGAGGGGAAGGGGG - Intronic
1176385759 21:6137934-6137956 CTGGGATGGCGGAGGGCAGGTGG + Intergenic
1178981356 21:37267619-37267641 CCGGGTTAGCGGAGGGAGGGAGG + Intronic
1179737714 21:43400318-43400340 CTGGGATGGCGGAGGGCAGGTGG - Intergenic
1180083699 21:45498037-45498059 CAGGGTTTCATGTGGGAAGGAGG + Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1180958368 22:19751127-19751149 CTGGGTCTCAGGAGGGAACCGGG + Intergenic
1181235950 22:21447702-21447724 CTGGGGTTCCGGGGGGTGGGGGG + Exonic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1182213889 22:28699926-28699948 TTGTGTTTCAGGATGGAAGGGGG - Exonic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1183258301 22:36777267-36777289 CTAGGTGTCTGGAGGGAATGTGG - Intergenic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183360163 22:37379232-37379254 CTGGGCTGCGGGAGGGAAGCAGG - Intronic
1183483475 22:38077248-38077270 GGGAGTTTGCGGAGGGAAGGCGG + Intergenic
1183560733 22:38570444-38570466 CTGGGATGACGGAGGGAGGGAGG + Intergenic
1184207345 22:43013929-43013951 CTTGGGTGCCTGAGGGAAGGTGG - Intronic
1184316689 22:43698724-43698746 CTGAGTTCCCTGAGGAAAGGTGG + Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1185015345 22:48339538-48339560 CTGGGTTGCTGGAGTGCAGGCGG - Intergenic
1185025765 22:48410934-48410956 TGGGGTTTCTGCAGGGAAGGAGG + Intergenic
1185111489 22:48902514-48902536 CAGGGTCTCGGGAGGGGAGGAGG + Intergenic
950424877 3:12919749-12919771 CAGGGTCCCCGGAAGGAAGGAGG - Intronic
951873629 3:27395348-27395370 CCTGGTTTCAGGGGGGAAGGAGG - Intronic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
954127389 3:48539522-48539544 TTTGCTTTCCAGAGGGAAGGGGG - Intronic
954646056 3:52132261-52132283 CTGAGCTTCAGGAGGGGAGGAGG - Intronic
954699492 3:52443849-52443871 CTGGGCTTCCCAGGGGAAGGTGG + Intronic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
960815319 3:121665946-121665968 CTGGCTCTCAGGAGGGAAGCAGG - Intronic
961123536 3:124395312-124395334 CTGGGCTCCCCGAGGGAGGGAGG - Exonic
961518750 3:127455160-127455182 CTGGGTTGCCTGGGGAAAGGGGG - Intergenic
961662199 3:128475360-128475382 CTGGGTCACCGGGGGGCAGGAGG + Intergenic
962433591 3:135344474-135344496 CTTGGTTGCCAGATGGAAGGGGG - Intergenic
964035166 3:152187078-152187100 CTGGGTTTCCTAAGGTAAGCTGG + Intergenic
965433219 3:168614576-168614598 CTGGGTTTTAGGAGTAAAGGAGG - Intergenic
966743994 3:183258439-183258461 GTGGGTTTGGGGAGGAAAGGAGG - Intronic
967438390 3:189477849-189477871 CTGGGCTTCTGGAGGGGAGGGGG - Intergenic
967741734 3:193010480-193010502 CTGTGTTCCTGGAGGGAATGTGG + Intergenic
968653579 4:1769392-1769414 CTGCCTTTCCAGAGGCAAGGGGG - Intergenic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969042729 4:4313489-4313511 CTAGATTTCAGGAGAGAAGGAGG + Intronic
969116133 4:4871830-4871852 CTGCGTTCCAGGAGGGCAGGCGG - Intergenic
969307870 4:6336014-6336036 CCGGGTATCCTGAGGGCAGGTGG + Intronic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
978549526 4:109910461-109910483 CTGGGTGTCAGGAAAGAAGGAGG - Intergenic
981366672 4:143912162-143912184 CGGCGGCTCCGGAGGGAAGGAGG - Intergenic
985936447 5:3101385-3101407 CTGGGCTTCCGGGGGGCTGGGGG - Intergenic
986331701 5:6721113-6721135 CTGAGTCTCCTCAGGGAAGGAGG + Intronic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
986684192 5:10261263-10261285 CTGGGTTCCCAGAGTGAGGGAGG + Intronic
986773292 5:10992855-10992877 CAGGCTCTCTGGAGGGAAGGAGG - Intronic
990171358 5:53053492-53053514 CCGGTTTTCAGCAGGGAAGGTGG + Intronic
991479710 5:67064252-67064274 CTGAGATGCAGGAGGGAAGGTGG + Intronic
991925479 5:71701573-71701595 CTGGGTGGCAGGAGGGCAGGAGG + Intergenic
992143498 5:73822159-73822181 GTGCTTTTCCGGGGGGAAGGAGG + Intronic
994104045 5:95925807-95925829 CTGGGATGCCGGAGGGGAGGTGG - Intronic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001252855 5:170161783-170161805 CTGGATTACCGGAGGGTAGCTGG - Intergenic
1001688282 5:173612515-173612537 CTGGGGTTACGGATGGGAGGAGG - Intronic
1002277382 5:178113157-178113179 CAGGTTTTCCGGAGAGGAGGCGG + Intergenic
1002317898 5:178356196-178356218 CTGGGGTTGCGGAGGGGAGGAGG + Intronic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1002946756 6:1769207-1769229 CTGGGTTTACGGAGATAAAGAGG + Intronic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1004562200 6:16761316-16761338 CTGGGGTTGCGTGGGGAAGGGGG + Exonic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1010014845 6:71092449-71092471 GTGGGTTGCCTGAGGGACGGTGG + Intergenic
1011846424 6:91569129-91569151 CTGGATTTCTGGAAGAAAGGTGG - Intergenic
1014501458 6:122195209-122195231 CAGAGTTTCCGGAGGGAGTGTGG + Intergenic
1015692243 6:135937926-135937948 CTGGTTTTGCGGAAGGAAGAAGG - Intronic
1018538292 6:164848044-164848066 CTGGGACTCCGGAAGGAAGTGGG - Intergenic
1019230205 6:170554236-170554258 CTGTGTTTCCATAGGTAAGGAGG - Intergenic
1019256820 7:57580-57602 CTGGGTTTCAGAAGGGAGGATGG + Intergenic
1019918422 7:4148141-4148163 CCTGGTCTCCGGAGGGGAGGTGG - Intronic
1020083287 7:5297699-5297721 CTGGTTTCCCTGAGGGAATGTGG + Intronic
1020359855 7:7316292-7316314 CTTGGTTTCCATAGGGAAGATGG - Intergenic
1023279980 7:38559419-38559441 CTGGGTTTCCCGATGGAATGGGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1025996055 7:66528215-66528237 CTGGGGTTGCAGAGGGATGGGGG + Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1029530499 7:101122170-101122192 CTGGGATTCCAGAGGGACAGAGG + Intergenic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1034324780 7:150220520-150220542 CTGGGACCCCGGAGGGAAGCCGG + Intergenic
1034768411 7:153748711-153748733 CTGGGACCCCGGAGGGAAGCCGG - Intergenic
1037020595 8:13965769-13965791 CTTGGTTTTGGGAGGGAGGGAGG - Intergenic
1037504268 8:19515088-19515110 CTGGGTTCCCGAAGGAATGGGGG - Intronic
1039882325 8:41632690-41632712 CTGGGCTGGCGGAGGGAAGGAGG + Intergenic
1041015856 8:53592624-53592646 CCTGGTTTCAGGAGTGAAGGAGG + Intergenic
1042868982 8:73380455-73380477 CTGGCTTGCTGGAGGGAAGAAGG - Intergenic
1043363200 8:79499735-79499757 CTGAGTTTCCAGGGGGAGGGAGG - Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1045279931 8:100741446-100741468 CTGGGCATCCCAAGGGAAGGGGG + Intergenic
1046540534 8:115575644-115575666 GTGGGTTTCAGGAGAGGAGGTGG - Intronic
1048023712 8:130564706-130564728 CAGCTTTTCCGGAGGGAGGGAGG - Intergenic
1048275931 8:133065922-133065944 CTGGGTTTCCAGCGGGGATGAGG + Intronic
1048998628 8:139810072-139810094 GTGGGTTTCAGGAGGGAACAGGG - Intronic
1049001849 8:139831307-139831329 CTGGGTTTCCGGGGTGGAGAAGG + Intronic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049218570 8:141418621-141418643 CTTGGTAGCAGGAGGGAAGGAGG + Intronic
1051243023 9:15080322-15080344 CACGGTTTCAGGAGGGGAGGAGG - Intergenic
1051244260 9:15093233-15093255 CTGGCTTTGAAGAGGGAAGGAGG - Intergenic
1053167812 9:35856872-35856894 TGGGATTCCCGGAGGGAAGGGGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1057077240 9:92144393-92144415 TTGGGGATCGGGAGGGAAGGTGG + Intergenic
1057794956 9:98148978-98149000 CTGGGGTTAAGGAGGGAATGGGG + Intronic
1059455058 9:114395097-114395119 CTGGGGTGCAGGAGGGAGGGAGG + Intergenic
1059593594 9:115691981-115692003 GTGGGCTCCCTGAGGGAAGGAGG + Intergenic
1060526567 9:124324287-124324309 CTGGGTTTCCAGAGGAACAGGGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1062144345 9:134980625-134980647 CTGGGTGGCCGGGGGGCAGGTGG + Intergenic
1062323987 9:136003877-136003899 CTGGGCTTCCAGAGGGAGTGGGG - Intergenic
1185644349 X:1606585-1606607 TTGGAATTCCAGAGGGAAGGAGG + Intergenic
1186417289 X:9394743-9394765 GTGTGTTTCCAGAGAGAAGGGGG + Intergenic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1188144749 X:26597195-26597217 CTGGGTCTTAGGAGGGCAGGGGG + Intergenic
1190113509 X:47610467-47610489 CTGGTTTCCAGGAGGGTAGGTGG - Intronic
1195481031 X:105345461-105345483 CTGGGTCTCAGAAGGGCAGGAGG - Intronic
1195727763 X:107935665-107935687 GTGGGGTGCCGGAGGGAAAGGGG - Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199599935 X:149535852-149535874 GTGGGTTGGAGGAGGGAAGGAGG - Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic