ID: 1183346324

View in Genome Browser
Species Human (GRCh38)
Location 22:37310271-37310293
Sequence ATCTTAACTCAGATGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183346318_1183346324 0 Left 1183346318 22:37310248-37310270 CCCCGAGAAGCTCTATGTCATAA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346315_1183346324 15 Left 1183346315 22:37310233-37310255 CCACGTGCTGTCCGCCCCCGAGA 0: 1
1: 0
2: 0
3: 6
4: 43
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346310_1183346324 30 Left 1183346310 22:37310218-37310240 CCTGTCCTGCCCCAGCCACGTGC No data
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346311_1183346324 25 Left 1183346311 22:37310223-37310245 CCTGCCCCAGCCACGTGCTGTCC 0: 1
1: 0
2: 5
3: 40
4: 414
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346320_1183346324 -2 Left 1183346320 22:37310250-37310272 CCGAGAAGCTCTATGTCATAAAT 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346312_1183346324 21 Left 1183346312 22:37310227-37310249 CCCCAGCCACGTGCTGTCCGCCC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346316_1183346324 4 Left 1183346316 22:37310244-37310266 CCGCCCCCGAGAAGCTCTATGTC 0: 1
1: 1
2: 0
3: 9
4: 70
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346313_1183346324 20 Left 1183346313 22:37310228-37310250 CCCAGCCACGTGCTGTCCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346314_1183346324 19 Left 1183346314 22:37310229-37310251 CCAGCCACGTGCTGTCCGCCCCC 0: 1
1: 0
2: 0
3: 8
4: 179
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346319_1183346324 -1 Left 1183346319 22:37310249-37310271 CCCGAGAAGCTCTATGTCATAAA 0: 1
1: 1
2: 0
3: 11
4: 142
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1183346317_1183346324 1 Left 1183346317 22:37310247-37310269 CCCCCGAGAAGCTCTATGTCATA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183346324 Original CRISPR ATCTTAACTCAGATGGGAGA GGG Intronic
902295159 1:15462242-15462264 ATTATAAATCGGATGGGAGAAGG - Intronic
902298020 1:15481779-15481801 ATTATAAGTCGGATGGGAGAAGG - Intronic
906069046 1:43004209-43004231 ATCTTAACTCCCAGGAGAGAGGG - Intergenic
906982971 1:50651001-50651023 ACGTTAACTCTGAAGGGAGATGG + Intronic
907600726 1:55766634-55766656 GTCTTAACTCAGCTGGGCCATGG - Intergenic
912573910 1:110646577-110646599 GTAACAACTCAGATGGGAGATGG + Intergenic
912666122 1:111581180-111581202 AGCTTGACTATGATGGGAGACGG + Intronic
913361396 1:117984397-117984419 GGCTTAACATAGATGGGAGAGGG + Intronic
914688209 1:150001490-150001512 ATCTCAAATCAGATAGCAGAGGG + Intronic
917936179 1:179869330-179869352 TTATTACCTCTGATGGGAGAGGG + Intronic
918506409 1:185259303-185259325 ATGTTAACTCCTATGAGAGATGG - Intronic
919486047 1:198148354-198148376 ATTTTAAATAAGATGGTAGACGG - Intergenic
920864156 1:209737577-209737599 AGCATATCTCAGAGGGGAGAAGG + Intergenic
922034449 1:221834854-221834876 ATAGTAACTCAGAAGGTAGAGGG - Intergenic
922552563 1:226506889-226506911 ATCTCAGCTCTGAGGGGAGAGGG - Intergenic
924596213 1:245447181-245447203 ATGTTAATTCAGATGGGCCACGG - Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065747157 10:28853060-28853082 ACTTTAACTCATATGGGAAAGGG - Intronic
1065960922 10:30733551-30733573 ATTTGCACTCAGATGGTAGAAGG + Intergenic
1067974370 10:51007360-51007382 AACTTAACTCGGATGGTAAAAGG - Intronic
1068597077 10:58914049-58914071 ATCATCACAGAGATGGGAGAAGG + Intergenic
1068794076 10:61058623-61058645 ATCTATATTCAGATGGAAGATGG - Intergenic
1069486132 10:68825082-68825104 ATCAGAATTCAGATGTGAGATGG + Intergenic
1070170894 10:73932078-73932100 TTCCCAACTCAGAGGGGAGAAGG + Intergenic
1071749450 10:88458132-88458154 AAGCTAACCCAGATGGGAGATGG - Intronic
1072076245 10:91976951-91976973 ATCCTAAATGAGATGGGTGATGG + Intronic
1072508637 10:96095761-96095783 ATCAAACCTCAGATAGGAGAGGG - Intergenic
1074094413 10:110297247-110297269 ATATAAACTCAGTTGGGACAAGG + Intronic
1078377049 11:10804874-10804896 GGCTTAACTCAAAAGGGAGAGGG - Intronic
1080411450 11:32028865-32028887 ATCTGACCTCAGAGGGCAGATGG + Intronic
1081839113 11:46183059-46183081 ATCTGAACTTAAATGGCAGAGGG - Intergenic
1083575067 11:63784400-63784422 GGCTTAACTCAGCTGGGAGAAGG + Intergenic
1084460210 11:69292944-69292966 ATTCTCACTCAGGTGGGAGATGG - Intergenic
1087617087 11:100499292-100499314 TTATCAACTCAGATGGGGGAAGG + Intergenic
1088717054 11:112558041-112558063 ATGTTACCTCATATGGCAGAAGG + Intergenic
1088810713 11:113389952-113389974 ATCTTCATTCTGATGAGAGACGG + Intronic
1092518936 12:9246441-9246463 ATCACAAATCAGATGGTAGAAGG - Intergenic
1093070125 12:14699712-14699734 ATCTGAACTTAAATGGGAGTTGG + Intergenic
1093074527 12:14743880-14743902 ATCTGAACTAAGATGGCATATGG - Intergenic
1096498026 12:52050022-52050044 ATATTGACTTACATGGGAGAAGG + Intronic
1097078300 12:56410988-56411010 ATCCCAACTCAGAAGGGACAGGG + Intergenic
1097457905 12:59822603-59822625 ATCTTAACACAAATGACAGATGG - Intergenic
1097706734 12:62876594-62876616 ATATGCAGTCAGATGGGAGAGGG + Intronic
1101300205 12:103471934-103471956 ATTTTAAGTCAAATGGGAAAAGG - Intronic
1102717330 12:114985788-114985810 ATCTTAAGTCACATGGTCGATGG + Intergenic
1104320988 12:127750570-127750592 ATCATAACACAGATGGGACGTGG - Intergenic
1105757359 13:23480221-23480243 CTCTTAAAACAGATAGGAGAAGG + Intergenic
1113010570 13:105761284-105761306 ACTTTAGCTCAGATGGGTGAAGG - Intergenic
1113421568 13:110175167-110175189 ATCTCCACTGAGCTGGGAGAAGG + Intronic
1115086815 14:29525477-29525499 ATCTTAACTCACATGATATAAGG - Intergenic
1119945587 14:78690220-78690242 ACAATAACTAAGATGGGAGAAGG - Intronic
1124362891 15:29051859-29051881 ATCTGGGCTCAGATGGGAGCAGG - Intronic
1126611311 15:50532343-50532365 AGCTTAACTAACCTGGGAGAAGG + Intronic
1127436111 15:58959826-58959848 AGCTTCACTGAGGTGGGAGATGG + Intronic
1128398709 15:67254936-67254958 ATCTTAATCCAGGTGGGAAACGG + Exonic
1128535707 15:68488688-68488710 GTCTTAACACAGATGGCAGCAGG + Intergenic
1128549568 15:68589750-68589772 AACTTAACCTAGATGGGAGGAGG + Intronic
1128991957 15:72268320-72268342 ATCTTAACTCTGGTGTGAGTTGG - Intronic
1129232501 15:74204522-74204544 ATTTAAAATCAGATGGGAGTTGG - Intronic
1130175843 15:81569815-81569837 ATCTTAACTCAGATGCGGAAGGG + Intergenic
1131420883 15:92304468-92304490 AGCCTAATTCAGCTGGGAGAGGG + Intergenic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1133599645 16:7326665-7326687 ATCTTAGCCCTGATGGGAGTAGG + Intronic
1140575523 16:76163663-76163685 ATCTCAACTAAGATAGGACAGGG + Intergenic
1140726583 16:77818855-77818877 ATCTTCAGTCATATTGGAGATGG + Intronic
1140997240 16:80272800-80272822 ATCTTACCTTACATGGCAGAAGG + Intergenic
1146459296 17:33033180-33033202 GTCTTAACTCAGAAGGGTCAGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147267207 17:39242052-39242074 GTCTTAGCTCAGATGTGAGTAGG + Intergenic
1148819077 17:50349856-50349878 ATGATTACTCAGATGGGAGGAGG - Intronic
1156716769 18:40021787-40021809 AGCCTAACTCACCTGGGAGAAGG + Intergenic
1156724495 18:40111794-40111816 ATTTAGAATCAGATGGGAGATGG - Intergenic
1156906901 18:42363613-42363635 ATCTGAACTGAGAGGGGGGAGGG + Intergenic
1156912688 18:42429271-42429293 AGCTAGCCTCAGATGGGAGATGG - Intergenic
1158940522 18:62402959-62402981 GTCTTAACTGAGATGTGAGCAGG - Intergenic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1165032913 19:33011336-33011358 TTCTTATCTCAGATTGGACAGGG - Intronic
1165396968 19:35569732-35569754 ATCTGCACAAAGATGGGAGAGGG - Intergenic
1168360226 19:55733491-55733513 ATTTCAACTCATATGGGAGAAGG - Exonic
927189319 2:20506272-20506294 AACTTCACTTGGATGGGAGAAGG + Intergenic
929055022 2:37869214-37869236 ACATTAACTCACATGGCAGAGGG - Intergenic
930452579 2:51560716-51560738 ATCTCAAGTCAAATTGGAGAAGG - Intergenic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
932599566 2:73113932-73113954 ATGTCAGCTCAGATGGGGGAGGG + Intronic
932730542 2:74218596-74218618 AGCTTCTCCCAGATGGGAGATGG - Exonic
933448630 2:82416257-82416279 ATCTTAGTTTAGATGGTAGATGG + Intergenic
934908693 2:98229909-98229931 ATATTAACCCAGATGGGGGAAGG + Intronic
937489880 2:122355532-122355554 ATGTTACATCAGATGGCAGATGG + Intergenic
942869579 2:180718773-180718795 ATCTTTAGTCAGATAAGAGAAGG - Intergenic
946168575 2:217880002-217880024 AACTGAACACAGATGGGTGATGG + Intronic
947945080 2:234094132-234094154 ATGTGACCTCAGATGGGAAAAGG + Intergenic
948151201 2:235746467-235746489 ATCCTAACACAGAAGGGAGGAGG + Intronic
1172592405 20:36127128-36127150 AGCTCATCTCAGATGGGAGGCGG - Intronic
1173121920 20:40300856-40300878 ATCTGAACCTAGATGGGGGAAGG + Intergenic
1177296221 21:19179914-19179936 ATCTTACCTCAGGTAGGAAATGG - Intergenic
1178009870 21:28272353-28272375 ATGTTCACTCAGATGGTAGCTGG + Intergenic
1181949879 22:26546248-26546270 ATCTAAACCCAGATGGAAAAGGG + Intronic
1182014685 22:27029935-27029957 ATCTTAACTCAGCTGCCTGAAGG - Intergenic
1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG + Intronic
950947011 3:16959726-16959748 TTCTAAACACAGATGGGATATGG - Intronic
959669945 3:108965079-108965101 AACTTAACTCAGCTGGAATAAGG + Intronic
963835500 3:150054627-150054649 ATCTTCACTATTATGGGAGAAGG + Intergenic
965950482 3:174302525-174302547 ATCTTAATAAAGAAGGGAGAGGG + Intergenic
969202637 4:5618053-5618075 ATCTCAACTCAGGTGGGTCAGGG - Intronic
972203741 4:36747360-36747382 ACCTTAACTCAGAAGGGGCAGGG - Intergenic
972959508 4:44435231-44435253 ATCATTCCTCAAATGGGAGATGG + Intronic
972979608 4:44679358-44679380 ATTTTGACTCTGGTGGGAGAGGG + Intronic
974409472 4:61520959-61520981 ATCTGAACTAAGAGGCGAGAAGG - Intronic
982288181 4:153756414-153756436 CTATTAACTGAGATGGGGGATGG - Intronic
985311788 4:188609526-188609548 AGCTGAGCTCAGATGGAAGAGGG + Intergenic
988319866 5:29681162-29681184 AGCTCAGCTGAGATGGGAGAGGG - Intergenic
989430714 5:41352213-41352235 AACTAAACTCATATGGGGGAGGG - Intronic
995288913 5:110426629-110426651 ATATTAATTAAGTTGGGAGAGGG - Intronic
995385195 5:111581076-111581098 AGCTTTAATCAGATGGAAGAGGG - Intergenic
995751251 5:115455448-115455470 AGTTTATCACAGATGGGAGAAGG + Intergenic
996525762 5:124477770-124477792 ATCAAACCTCAGCTGGGAGAAGG + Intergenic
997313337 5:132909449-132909471 ATCTTTACTCTGAAGAGAGAAGG + Intronic
997666334 5:135632357-135632379 ATGTTTACCCAGGTGGGAGAAGG + Intergenic
998098791 5:139414695-139414717 ATCATAACTCACATGTGCGAAGG + Intronic
998503767 5:142655600-142655622 AGCTTAACTCAGATCTAAGAAGG + Intronic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
999892248 5:155991516-155991538 CTCTAAGCTCAGAAGGGAGAAGG + Intronic
1000949203 5:167460097-167460119 TTCTAAACTCAGATGTGAGAGGG - Intronic
1001982191 5:176044986-176045008 ATCTTGACTCAGGTGGGTGCTGG + Intergenic
1002235270 5:177799071-177799093 ATCTTGACTCAGGTGGGTGCTGG - Intergenic
1002895326 6:1376724-1376746 ATCTTACCAGAGATGGGTGATGG + Intergenic
1004942462 6:20574341-20574363 ATCCTAGCTCAGATGGTATAGGG + Intronic
1004990575 6:21133234-21133256 ATCCTAAATCAAATGGGAAATGG + Intronic
1005325232 6:24693676-24693698 ATTGTATCTCAGATGGGAGAGGG + Intronic
1005454634 6:26007330-26007352 GTCTTATCCCAGCTGGGAGAAGG - Intergenic
1007603979 6:43103234-43103256 TTTTAAACTCAGAAGGGAGAAGG - Intronic
1010272481 6:73929747-73929769 AGCTTATCTCAGTTGGGGGATGG + Intergenic
1013994947 6:116297235-116297257 AGCTAAAGTCAGATGGGAGTTGG + Intronic
1015342929 6:132122846-132122868 ATGTACACTCAAATGGGAGAAGG - Intergenic
1020369191 7:7414209-7414231 AGATTAAGTCAGAAGGGAGAAGG - Intronic
1021865136 7:24948769-24948791 ATCTTAACTGAGAGGGTAGATGG + Intronic
1022629004 7:32067673-32067695 ATCTAAACTGAGGTGGGAAATGG - Intronic
1022741326 7:33124139-33124161 ATATAAACTCAGATGAGAGGTGG - Intergenic
1023309796 7:38873568-38873590 ATCTTAACTCAGACTGTTGATGG - Intronic
1024393298 7:48839235-48839257 TTAGTAGCTCAGATGGGAGAGGG + Intergenic
1024408375 7:49009519-49009541 ATCTTACCTCATATGGCAGATGG + Intergenic
1026602136 7:71785666-71785688 ATCTAAGTCCAGATGGGAGAGGG + Exonic
1028210676 7:88070211-88070233 ATCTTAACTCACAGTAGAGAGGG - Intronic
1033471513 7:141653756-141653778 ATATCAACTTAGATGGGTGAGGG - Exonic
1033724149 7:144095210-144095232 AGCTTAACCCTGATGGGAAATGG + Exonic
1038783013 8:30584610-30584632 TTCTTAACTCATGTGGGACAAGG - Intronic
1040837998 8:51752792-51752814 ATCTTGACTTTGATGGCAGATGG + Intronic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041504450 8:58579878-58579900 ATATTGACTTAGGTGGGAGATGG + Intronic
1041573019 8:59359049-59359071 CTCTTAACTTAGATGGTGGAAGG + Intergenic
1042783029 8:72512890-72512912 ATCTTAACTCAGTGAGGAAAGGG - Intergenic
1044732435 8:95240044-95240066 GTCTGAAAGCAGATGGGAGAGGG + Intergenic
1046231430 8:111363938-111363960 ATCTTATCTCAGATGTGACTTGG - Intergenic
1046680543 8:117164716-117164738 ATCTTAACACGGCTGGGAGCAGG + Intronic
1047267504 8:123320666-123320688 ATCTCAAGGCAGATGGGAGGAGG + Exonic
1047419187 8:124692583-124692605 ATCTTTCCTCTGAGGGGAGAAGG - Intronic
1047688986 8:127331313-127331335 ATCTTGGCTTAGATAGGAGACGG - Intergenic
1047921107 8:129635336-129635358 CTCTGAACTCAGATAGGAGGAGG - Intergenic
1049651855 8:143773505-143773527 ATAATGACTGAGATGGGAGAGGG - Intergenic
1049877218 8:145032517-145032539 TTCTTAAGGCAGATGGGAGGGGG - Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1057347373 9:94262310-94262332 ATAGAAACTCAGATGGGAAAAGG + Intronic
1058773960 9:108265974-108265996 TTCAGAACTCAAATGGGAGAGGG - Intergenic
1059930990 9:119260719-119260741 TTCTTAACTCAGATGTGACCTGG - Intronic
1062135867 9:134927807-134927829 ATCTTATGTCACATGGTAGAAGG - Intergenic
1188606832 X:32041482-32041504 ATGTTAACTCAGAAAGCAGAAGG - Intronic
1190008665 X:46763019-46763041 ATCTTAACTTGGGTGGGAAAAGG + Intergenic
1190284868 X:48955313-48955335 ATCATAACTCAGGTGTGTGAAGG - Intronic
1191108617 X:56788247-56788269 CTCTTTATTCACATGGGAGAAGG + Intergenic
1193042859 X:77022120-77022142 ATCAGAACCCAGATGAGAGATGG - Intergenic
1196227298 X:113180959-113180981 ATCTTAACTCACATAGGTAAAGG + Intergenic
1197165979 X:123378210-123378232 AACTTAATTCAGATGGAAGGTGG + Intronic
1197972390 X:132129226-132129248 ATGTCAACTTAGATGGGTGAGGG + Intergenic
1199184170 X:144895763-144895785 ACCTTCAGTCAGATAGGAGAAGG - Intergenic
1201863695 Y:18626544-18626566 TTCTTATGTCAGATGGGAGGGGG + Intergenic
1201869627 Y:18693834-18693856 TTCTTATGTCAGATGGGAGGGGG - Intergenic
1201914460 Y:19167579-19167601 TTCTTAAGGCAGATGGGAGGGGG - Intergenic