ID: 1183348047

View in Genome Browser
Species Human (GRCh38)
Location 22:37318783-37318805
Sequence ACATTGCCAGACAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183348047_1183348052 -6 Left 1183348047 22:37318783-37318805 CCTCCCTCCCTGTCTGGCAATGT No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183348047 Original CRISPR ACATTGCCAGACAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr