ID: 1183348052

View in Genome Browser
Species Human (GRCh38)
Location 22:37318800-37318822
Sequence CAATGTTGTCCCATCCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183348039_1183348052 12 Left 1183348039 22:37318765-37318787 CCCCGCGAGCCAGCCCCACCTCC No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348045_1183348052 -2 Left 1183348045 22:37318779-37318801 CCCACCTCCCTCCCTGTCTGGCA No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348042_1183348052 3 Left 1183348042 22:37318774-37318796 CCAGCCCCACCTCCCTCCCTGTC No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348048_1183348052 -9 Left 1183348048 22:37318786-37318808 CCCTCCCTGTCTGGCAATGTTGT No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348046_1183348052 -3 Left 1183348046 22:37318780-37318802 CCACCTCCCTCCCTGTCTGGCAA No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348036_1183348052 27 Left 1183348036 22:37318750-37318772 CCCTCTCTGGACCGTCCCCGCGA No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348041_1183348052 10 Left 1183348041 22:37318767-37318789 CCGCGAGCCAGCCCCACCTCCCT No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348037_1183348052 26 Left 1183348037 22:37318751-37318773 CCTCTCTGGACCGTCCCCGCGAG No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348044_1183348052 -1 Left 1183348044 22:37318778-37318800 CCCCACCTCCCTCCCTGTCTGGC No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348049_1183348052 -10 Left 1183348049 22:37318787-37318809 CCTCCCTGTCTGGCAATGTTGTC No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348040_1183348052 11 Left 1183348040 22:37318766-37318788 CCCGCGAGCCAGCCCCACCTCCC No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348038_1183348052 16 Left 1183348038 22:37318761-37318783 CCGTCCCCGCGAGCCAGCCCCAC No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data
1183348047_1183348052 -6 Left 1183348047 22:37318783-37318805 CCTCCCTCCCTGTCTGGCAATGT No data
Right 1183348052 22:37318800-37318822 CAATGTTGTCCCATCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183348052 Original CRISPR CAATGTTGTCCCATCCCTTT TGG Intergenic
No off target data available for this crispr