ID: 1183355707

View in Genome Browser
Species Human (GRCh38)
Location 22:37358171-37358193
Sequence GCCATGTGAATAGGATCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183355707_1183355712 -8 Left 1183355707 22:37358171-37358193 CCCCGTGATCCTATTCACATGGC No data
Right 1183355712 22:37358186-37358208 CACATGGCCCACGGCTGCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183355707 Original CRISPR GCCATGTGAATAGGATCACG GGG (reversed) Intergenic
No off target data available for this crispr