ID: 1183359128

View in Genome Browser
Species Human (GRCh38)
Location 22:37374329-37374351
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 2, 1: 0, 2: 2, 3: 9, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183359119_1183359128 8 Left 1183359119 22:37374298-37374320 CCAGCACGATAACCATGCCAAAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG 0: 2
1: 0
2: 2
3: 9
4: 174
1183359118_1183359128 9 Left 1183359118 22:37374297-37374319 CCCAGCACGATAACCATGCCAAA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG 0: 2
1: 0
2: 2
3: 9
4: 174
1183359121_1183359128 -4 Left 1183359121 22:37374310-37374332 CCATGCCAAAGAGGCAGCCCAGG 0: 1
1: 1
2: 5
3: 35
4: 288
Right 1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG 0: 2
1: 0
2: 2
3: 9
4: 174
1183359124_1183359128 -9 Left 1183359124 22:37374315-37374337 CCAAAGAGGCAGCCCAGGATGGT 0: 2
1: 0
2: 3
3: 17
4: 171
Right 1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG 0: 2
1: 0
2: 2
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900994364 1:6112489-6112511 CTGGGTGGTCCTGATGTGGTCGG - Intronic
901150418 1:7097476-7097498 CAGGCTGGTCCTGGTGCAGTGGG + Intronic
903837263 1:26213059-26213081 CAGGATGGTCTTGAAGTCCTGGG + Intergenic
904807911 1:33144763-33144785 CAGGATGGTCCTGGTCTAGGTGG + Intergenic
905601064 1:39251924-39251946 GAAGATGATGATGATGTAGTAGG + Intronic
906726290 1:48046911-48046933 CAGGATGGTGAAGGTGTACTTGG + Intergenic
907236415 1:53053373-53053395 CATGATGGTCATGATGTTCCAGG - Intergenic
909640165 1:77863550-77863572 CAAGATGTTCATGATCTGGTGGG + Intronic
911487309 1:98517366-98517388 CTGGATGGTCTTGATGTTTTTGG - Intergenic
911534798 1:99087872-99087894 CAGGCTGGTCTTGATGTCCTGGG - Intergenic
911906085 1:103570107-103570129 AAGGATCTTCATGAGGTAGTTGG - Intronic
914225830 1:145718929-145718951 CAAAATGGTCCTGATGTGGTGGG - Intergenic
916534223 1:165688104-165688126 CAGGATGGTCTTGATCTCCTGGG - Intronic
917257631 1:173132566-173132588 CATGATGGAAATGATGTGGTGGG + Intergenic
917473001 1:175342135-175342157 CAGGCTGCTCATGCTGTGGTGGG + Intronic
919026824 1:192182560-192182582 CAGAATGTTCATGATGTTGCTGG + Intronic
923619682 1:235568271-235568293 AAGGATGGGCTTGATGTACTTGG - Intronic
924669041 1:246104585-246104607 CAGGCTGGTCATGTTGCAATAGG + Intronic
1063709681 10:8465111-8465133 CAAGGTGGACATGATCTAGTGGG + Intergenic
1064205036 10:13316156-13316178 CAGAATGGTCAAGATTTGGTCGG + Intergenic
1066486705 10:35852551-35852573 CAGGTTGCTCATGTTGTAGGTGG + Intergenic
1067215757 10:44301367-44301389 CATGATGGTCATGATGATGCTGG + Intergenic
1067878941 10:50027128-50027150 CCGGTTGGGCATGAAGTAGTCGG + Intergenic
1069789993 10:71013289-71013311 CAGGCTGGTAATGATGCAGTAGG + Intergenic
1070125655 10:73619445-73619467 CAGGATGGTCTTGAACTTGTGGG + Intronic
1072183302 10:93009482-93009504 CAGGGAGTTCATGATTTAGTGGG + Intronic
1073464740 10:103687870-103687892 CTGGCTGCTCATGATGCAGTAGG - Intronic
1074142395 10:110685443-110685465 CAGAATGGTCATGGGGTAGCTGG + Intronic
1075889145 10:125930546-125930568 CAGGCTGGTCTTGATCTACTGGG + Intronic
1083626201 11:64073324-64073346 CAGGATGGGCATGGGGGAGTGGG - Intronic
1085464449 11:76714435-76714457 CAGGATGGTAATGATCTTGGGGG + Intergenic
1085854455 11:80160492-80160514 AGGTATGGTCATAATGTAGTAGG - Intergenic
1087390581 11:97527225-97527247 CAGGATGGTGATGGTGGAGAAGG - Intergenic
1088318916 11:108534861-108534883 CATGATGGTCATGATGCAGGTGG + Intronic
1088993856 11:114978696-114978718 CTGGATGGTCATGTTGGAGCTGG - Intergenic
1089790019 11:120936023-120936045 CAGGATGATGATGACGAAGTTGG - Intronic
1096872068 12:54599208-54599230 CAGCATGGTCACGCTGTATTGGG + Intergenic
1097997728 12:65907813-65907835 CTGGATAGTAATGATGTAATTGG + Intronic
1098865286 12:75755414-75755436 CATGATGGTAAGGATGGAGTTGG - Intergenic
1099309264 12:80997211-80997233 TAGGATGGTTACGATGTGGTAGG - Intronic
1100305578 12:93347131-93347153 CAGGATGGTAATAAATTAGTCGG - Intergenic
1102912369 12:116726886-116726908 CAGGAATGTCATGATGTGGCAGG - Intronic
1104909868 12:132235556-132235578 CAGGGTGGTCAGCATGGAGTTGG + Intronic
1106514109 13:30438195-30438217 CAGGATGGTCTTGAACTTGTGGG + Intergenic
1106568972 13:30909608-30909630 CAGGATGTTCATGAGATACTTGG + Intronic
1106897060 13:34314884-34314906 CATGGTGGTCATGAGGTAGCTGG - Intergenic
1107444555 13:40458580-40458602 CAGGATGGTCCTGAAGGAGAGGG + Intergenic
1109486685 13:63031717-63031739 TAGGATGATCATTTTGTAGTAGG - Intergenic
1110664452 13:78100475-78100497 CTGAATGTTCATGATGTACTTGG - Intergenic
1111766276 13:92534074-92534096 CAGGCTGGTCTTGATCTAATGGG - Intronic
1112010413 13:95289405-95289427 CAGGCAGGACATGATGGAGTTGG - Intronic
1119035944 14:71230920-71230942 CAGGGTGGGCACGATGCAGTTGG - Intergenic
1119932186 14:78558259-78558281 AAGGATGGTCATGAAGCTGTTGG - Intronic
1120129866 14:80793787-80793809 CAGGATGGTGATTATATATTTGG + Intronic
1121374809 14:93398760-93398782 CAGGAAGGTCTTTATGTAGGAGG + Intronic
1121614693 14:95305360-95305382 GAGGATGGTCATGATGGACAGGG - Intronic
1122342483 14:101037462-101037484 CAGGATGGTCCTGAAGGAGGGGG - Intergenic
1122429154 14:101628993-101629015 CAGGGTGGCCATCATGGAGTGGG + Intergenic
1125514930 15:40313236-40313258 CTGGATGATCTTGAAGTAGTTGG + Intergenic
1126410788 15:48371062-48371084 CAGGATGGTGATGATGATGATGG + Intergenic
1127754906 15:62082802-62082824 AAGGATGGTGATGATGAAGAAGG - Intergenic
1129068124 15:72926809-72926831 CATGATGTTCTTGAGGTAGTTGG - Intergenic
1129564762 15:76609711-76609733 AAAGATGGACATGATGTACTAGG + Intronic
1130397284 15:83513675-83513697 ATGGAGGGTCATGATTTAGTGGG - Intronic
1132916697 16:2351691-2351713 CAGGATGGTCATGAACTCCTGGG + Intergenic
1135432616 16:22399101-22399123 CAGGATGGTCATGAACTCCTGGG + Intronic
1135805817 16:25541580-25541602 CAGGATGGTCTTGATCTTCTGGG + Intergenic
1137643996 16:50058703-50058725 GAGGATCTTCATGAGGTAGTTGG + Intergenic
1137791909 16:51182191-51182213 CAGCAAGCTCATGAGGTAGTCGG + Intergenic
1137983330 16:53088032-53088054 AAGGATGGACATGATGGATTTGG + Intronic
1139690797 16:68640853-68640875 CAGATTGGTCATTATGGAGTGGG - Intronic
1139828942 16:69781035-69781057 CAGGTTGGTCCTGTGGTAGTGGG + Intronic
1140144243 16:72290123-72290145 CAGGATGGTCTTGGGGTGGTGGG - Intergenic
1141131025 16:81436955-81436977 CAGGCTGGTCATGAACTCGTGGG + Intergenic
1143984392 17:10898807-10898829 CAGGATGGTCTTGATCTCCTGGG - Intergenic
1144539320 17:16123865-16123887 CAGGTAGTTCATGATTTAGTAGG - Intronic
1145290048 17:21535785-21535807 CAGGCTGGTCATGATCTCCTGGG + Intronic
1145415771 17:22712606-22712628 GAGGATGGTGATGGTGGAGTTGG + Intergenic
1149453818 17:56771071-56771093 CAGGATGGTCTTGAGGCAGCTGG + Intergenic
1152653954 17:81511411-81511433 GAGGATCTTCATGAGGTAGTCGG + Exonic
1153269233 18:3303224-3303246 CAGGCTGGTCATGAACTTGTGGG + Intergenic
1153982168 18:10319829-10319851 CAGGTTTGTCATCATGTGGTAGG + Intergenic
1160480203 18:79233079-79233101 CAGGCTGGTCTTGATCTCGTGGG - Intronic
1162427832 19:10607564-10607586 CAGGCTGGTCATGAAGTCCTGGG + Intronic
1162929514 19:13950378-13950400 CAGGCTGGTCTTGATCTCGTGGG + Intronic
1163413421 19:17171262-17171284 CAGGAGGGAAATGATGTTGTTGG - Intronic
1165533697 19:36425165-36425187 CAAGTTGGTCATAATCTAGTTGG + Intergenic
929491676 2:42402473-42402495 CAGGCTGGTCTTGAACTAGTGGG - Intronic
930990704 2:57650637-57650659 CAGGAGGGTGATGAAGTAGGAGG + Intergenic
931916447 2:66961891-66961913 CATGAAGGTCATGTTTTAGTGGG + Intergenic
933910812 2:86939949-86939971 CAGGATGGTCTTGAACTACTGGG + Intronic
934021917 2:87963461-87963483 CAGGATGGTCTTGAACTACTGGG - Intergenic
934751898 2:96799201-96799223 CAGGATGAGGATGAAGTAGTCGG - Exonic
936030650 2:109067855-109067877 CAGGGTGGTCGTGATGGAGGAGG - Intergenic
938899428 2:135787364-135787386 CTGGATGGTCAAGTTGTAATAGG + Intergenic
939425849 2:142035528-142035550 AAGGAAGGCCATGCTGTAGTGGG - Intronic
939600794 2:144187742-144187764 TGGGATGATGATGATGTAGTGGG + Intronic
939726239 2:145724798-145724820 CAGGATGGTCATGACCTTCTGGG + Intergenic
942646486 2:178115940-178115962 CAGGATGGTCATGAATTCCTGGG - Intronic
942922106 2:181387481-181387503 CAGGGTGGTCATCAGGAAGTAGG + Intergenic
943480237 2:188408202-188408224 CACCATTGTCATGATGTAGCAGG + Intronic
944862076 2:203824674-203824696 CAAGATGGCCAAGAGGTAGTGGG + Intergenic
944998074 2:205317298-205317320 CATCATGGTCATCATGTATTTGG + Intronic
945511016 2:210702745-210702767 CAGGTTGGTCATAGTGAAGTGGG + Intergenic
945551876 2:211230257-211230279 CAGGATGGTCTTGATCTCCTGGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
947764121 2:232624909-232624931 CAGGAGGGGCATCATGGAGTCGG - Intronic
947773333 2:232688110-232688132 CAGGCTGGTCTTGAAGTCGTGGG - Intergenic
948703638 2:239776349-239776371 CAGGAAGGTCATGATGGGATGGG - Intronic
948879768 2:240850801-240850823 GAGGATGGTCAGGAGGCAGTCGG - Intergenic
1169160739 20:3375907-3375929 CAGGATGGTGATGAAGAAGCAGG + Intronic
1170449489 20:16467353-16467375 AAAGGTGGTCATGATGTACTGGG - Intronic
1172535619 20:35670940-35670962 CAGGATTCTCTTGATCTAGTTGG - Intronic
1176274167 20:64254508-64254530 CATGAAGGTCATGAGGTGGTGGG + Intergenic
1180717675 22:17882875-17882897 CGGTATGGTCATGGTGGAGTAGG - Intronic
1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG + Exonic
1183546450 22:38456603-38456625 CAGGATGGTCAGGATGTAGCTGG - Intergenic
953082623 3:39634947-39634969 CAGAAGGGTCATGATATGGTGGG + Intergenic
954517560 3:51192344-51192366 CAGGGTGGTGATGATCTTGTAGG - Intronic
959615983 3:108347719-108347741 CAGGATGGTAATGGTAGAGTTGG + Intronic
963539114 3:146563916-146563938 CAGGCTGGTCTTGATCTGGTGGG + Intergenic
964457636 3:156885788-156885810 CTGGATGGTCAGGATGTTGCAGG + Intronic
966890748 3:184405876-184405898 CATGATGGTGATGATGAAGGAGG - Intronic
967121279 3:186384972-186384994 GATGATGGTCATGATGGAGGTGG + Intergenic
969809568 4:9637600-9637622 CAGGATGGTCTTGAAGTCCTAGG + Intergenic
972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG + Intergenic
976283601 4:83349263-83349285 GAGGATGGTCATGGTGGAGAAGG - Intergenic
977710835 4:100123024-100123046 TATGATGGTGATTATGTAGTTGG - Intergenic
979458842 4:120957014-120957036 CAGGATGGTCTTGAACTACTCGG + Intergenic
979761977 4:124417665-124417687 CAAGATATTCATGATCTAGTGGG + Intergenic
982711287 4:158760827-158760849 ATCCATGGTCATGATGTAGTAGG + Intergenic
983208333 4:164933464-164933486 CAGGATGGTCATGGTGGGGTGGG + Intergenic
983392080 4:167145073-167145095 CAGGATGGTCATGCTGGAGTTGG + Intronic
983504337 4:168536382-168536404 CAGGATGGTAATAATGCAGGAGG - Intronic
984363252 4:178765318-178765340 CAGTATGGTCAGGTTCTAGTGGG + Intergenic
986035522 5:3933436-3933458 CAGGCAGGTCATGATGTCGGGGG - Intergenic
988259390 5:28864346-28864368 TAGAATGGTAATGATGTACTAGG - Intergenic
989955548 5:50355011-50355033 CAGAATGGTCAGGATGCAGGTGG - Intergenic
991079139 5:62576578-62576600 CAGGCTGGTCTTGAACTAGTAGG - Intronic
992407779 5:76475971-76475993 CAGGATGGGAAAGATGGAGTGGG + Intronic
992749927 5:79852569-79852591 CAAAATGGTCATGATCTAATGGG + Intergenic
994121839 5:96123003-96123025 CACAATGTTCAGGATGTAGTAGG + Intergenic
995574830 5:113518410-113518432 CAGGATGGTCTTGAACTACTGGG + Intronic
998465414 5:142339944-142339966 CAGGCTGGTCGTGACGTACTGGG - Intergenic
1002905942 6:1449343-1449365 CAGGATGGGCAAGATGGAGCAGG + Intergenic
1006083193 6:31579354-31579376 CAGGCTGGTCTTGAACTAGTGGG - Intergenic
1007894808 6:45343288-45343310 CAGGATGGTCTTGATCTTCTTGG - Intronic
1011212036 6:84965442-84965464 CAGGCTGGTGTTGATGTACTGGG + Intergenic
1015914310 6:138200225-138200247 CAGCATGGTCATGATCAAGTGGG - Intronic
1019353447 7:566203-566225 CATGATGGTCATGGTGAAGATGG - Intronic
1019369632 7:654714-654736 GAGGATGGTGATGATGTAGATGG - Intronic
1019566226 7:1680352-1680374 CAGGATGGTCAAGACGTGGATGG + Intergenic
1019577783 7:1745843-1745865 CAGGATGGTCATGATGTAGTGGG - Exonic
1019736809 7:2654182-2654204 CAGGATGGTCTTGAACTCGTGGG - Intronic
1020436848 7:8173883-8173905 CATGATGGTTATGTTGTAGTGGG + Intronic
1021511031 7:21432781-21432803 CAGGCTGGTCTTGAACTAGTGGG - Intronic
1023933468 7:44722248-44722270 CGGGATTTTAATGATGTAGTAGG + Intergenic
1024149657 7:46558079-46558101 CAGGAGAGTGAGGATGTAGTTGG + Intergenic
1026186524 7:68086003-68086025 CAGGCTGGTCATGAACTTGTGGG - Intergenic
1027152238 7:75740732-75740754 CAGGCTGGTCATGATCTCCTGGG + Intergenic
1028890541 7:95983429-95983451 TAGAATGATCCTGATGTAGTTGG - Intronic
1029435058 7:100559307-100559329 CTGCATGATCATGGTGTAGTGGG - Intronic
1030430622 7:109442879-109442901 CAGGATGGTGATTATTTAGAAGG - Intergenic
1032841632 7:135718736-135718758 GAGGATGGTCAAGAAGTAGATGG + Intronic
1033113079 7:138600389-138600411 CAGGATGGTCATGAACTCCTGGG - Intronic
1035176129 7:157052467-157052489 CGGGAGGGTGATGATGTATTAGG + Intergenic
1036661851 8:10714181-10714203 CAGGATGGAGATGGTGTCGTGGG + Intergenic
1041592869 8:59610239-59610261 CAAGATGTACATGATGTAGTAGG - Intergenic
1041840947 8:62270290-62270312 CAGGCTGGTCATGAACTACTTGG + Intronic
1043682835 8:83052105-83052127 CAGGATGGTCATGAACTCGTGGG - Intergenic
1046745188 8:117868658-117868680 CAGGATGGTCTTGAGGTCCTGGG + Intronic
1050041213 9:1495848-1495870 GAGGATGGACATCATGGAGTGGG + Intergenic
1052774437 9:32719424-32719446 CAGGAAGCTCATGGTGTAATAGG - Intergenic
1055886707 9:81071379-81071401 CAAGAAGGTCATGATGAAGAGGG + Intergenic
1058936494 9:109774005-109774027 CAGGGTGGACAGGATTTAGTAGG + Intronic
1059372440 9:113853455-113853477 CAGTAAGGTCATGATGGAGGTGG - Intergenic
1187273839 X:17801660-17801682 CTGGGTGGTCATGACGTAGGTGG + Exonic
1187541118 X:20196397-20196419 CAAGAAGCTCATGATCTAGTGGG + Intronic
1189982124 X:46521470-46521492 CAGGATGCTGATGAGGAAGTAGG + Intronic
1190667413 X:52707953-52707975 CAGGCTGGTCTTGACGTCGTGGG + Intergenic
1190672005 X:52750455-52750477 CAGGCTGGTCTTGACGTCGTGGG - Intergenic
1190720429 X:53143334-53143356 GAGGATCTTCATGAGGTAGTTGG + Intergenic
1193117654 X:77790862-77790884 CAGGATGGTCTTGACCTACTGGG - Intergenic
1194657954 X:96596607-96596629 GAGGATGATCGTGATATAGTAGG - Intergenic
1195264083 X:103163342-103163364 CAGGATGGTCTTGAAGTCCTTGG + Intergenic
1197259748 X:124305330-124305352 CAGGAATGTCTTTATGTAGTAGG + Intronic
1200914338 Y:8558060-8558082 CAGGATGGCCCAGATGTTGTAGG + Intergenic