ID: 1183359991

View in Genome Browser
Species Human (GRCh38)
Location 22:37378525-37378547
Sequence CTGGACTGTTTGGGAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183359991 Original CRISPR CTGGACTGTTTGGGAAGAGC TGG (reversed) Intronic
902563644 1:17295492-17295514 CTGGAAGCTTGGGGAAGAGCAGG + Intergenic
902744549 1:18464812-18464834 CTGGAAGGTTCTGGAAGAGCAGG + Intergenic
904195518 1:28782483-28782505 TTGGCCTGTTTGGGAAGTGAGGG + Intergenic
906260187 1:44381015-44381037 CTGGAGTGTAGGGGAGGAGCTGG - Intergenic
906831699 1:49038811-49038833 CTGGATTGTATGGTAAGAGTAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907540058 1:55207304-55207326 CTGAACTGTTTATGAAAAGCTGG + Intronic
913531391 1:119736614-119736636 GTGGAGTGTCTTGGAAGAGCAGG + Intronic
914713535 1:150235693-150235715 CTGGACTGATGGGGAAGCGGTGG + Intronic
916069951 1:161164094-161164116 CTGGATTGATTGAGAAGAGTTGG + Intronic
916362318 1:163984479-163984501 CTGGAATGTTTGAGGAGAACAGG + Intergenic
918051161 1:180973666-180973688 CTGGACTGTGTGGCAAATGCAGG - Exonic
920116715 1:203626791-203626813 CCGCACTGCTTGGGGAGAGCTGG + Exonic
921046512 1:211481536-211481558 CTCAACTGTTAGGGCAGAGCAGG - Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
923565873 1:235075560-235075582 CTGCACTGTTTTGGAAAAGTAGG + Intergenic
923658293 1:235937341-235937363 CTGCTCTGTTGGGGAAGATCTGG + Intergenic
923900252 1:238318477-238318499 CTGGCCAGTGTGGGAGGAGCAGG - Intergenic
924553528 1:245099558-245099580 CTGAACTGTCTGGAGAGAGCAGG - Intronic
1063511469 10:6648440-6648462 GTGGACTATTTGGGAAAAGAAGG - Intergenic
1064861831 10:19835098-19835120 CTTGCCTGTTGGGCAAGAGCAGG + Intronic
1066587754 10:36956276-36956298 CTGGACAGTTAGAGAAAAGCTGG + Intergenic
1067469007 10:46522979-46523001 CTGGGGTGTGTGGGAAGACCGGG - Intergenic
1067809365 10:49415362-49415384 AAGGACAGTGTGGGAAGAGCTGG + Intergenic
1069041369 10:63699097-63699119 ATGGAGACTTTGGGAAGAGCAGG - Intergenic
1070170020 10:73925830-73925852 CTGGAGGGATTGGCAAGAGCTGG + Intergenic
1071049745 10:81431971-81431993 CTGGATTGTATGGTAAGAGTAGG + Intergenic
1075310704 10:121411390-121411412 CAGGACGGTTGGGGCAGAGCTGG - Intergenic
1075318117 10:121468328-121468350 ATAGGCTGTTTGGGTAGAGCTGG - Intergenic
1075734530 10:124655706-124655728 CTGGCGTGTGTGGGAGGAGCTGG - Intronic
1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG + Intergenic
1077300868 11:1846353-1846375 CAGGGCTGTCTGGGGAGAGCCGG - Intergenic
1077302420 11:1853507-1853529 CTGGACTGCCAGGGAGGAGCTGG + Intronic
1077518645 11:3017754-3017776 CTGGACTGTCGAGGAAGGGCTGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1084313616 11:68331160-68331182 CTTTACTGGTTGGGAAGAGACGG + Intronic
1085700210 11:78739228-78739250 CTGGCAAGTTTGGGAAAAGCAGG - Intronic
1085900337 11:80691677-80691699 CTGGACAGTTAGAGAAAAGCTGG - Intergenic
1086762910 11:90656056-90656078 CTTGAATGTTTTGGAAGTGCTGG - Intergenic
1087541040 11:99520537-99520559 CTGAAAGGTTTGGGAAGAGCTGG - Intronic
1089498474 11:118919429-118919451 CTGGTCTGGTTGGGAGGACCTGG + Intronic
1089729947 11:120513099-120513121 CTGGGTTGTCTGGGAAGAGGAGG + Intronic
1090261397 11:125323281-125323303 CTAGGCTGTTTGTGAAGAGTTGG - Intronic
1090418583 11:126557901-126557923 CTACCCTGTGTGGGAAGAGCTGG - Intronic
1094142412 12:27194816-27194838 CTGGACTGTTTCTGTAGATCTGG + Intergenic
1094217445 12:27958873-27958895 CTGGCAAGTTTGGGAAGAGAAGG + Intronic
1094506103 12:31062440-31062462 TTGCACTGTTTGGGAAGACAAGG + Intergenic
1094526889 12:31237120-31237142 TTTGCCTGTGTGGGAAGAGCAGG - Intergenic
1095711416 12:45292675-45292697 CTGAACTGTTGGGGCAGAGGAGG + Intronic
1096904286 12:54919209-54919231 CTGAAGTGGTTGGGAAGAGGGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097402985 12:59152120-59152142 CTGTATTGGTTGTGAAGAGCTGG + Intergenic
1100616215 12:96233792-96233814 ATGGAATGTTAGGGAAGACCTGG + Intronic
1101689449 12:107062813-107062835 CTGGACTGTTCTGGAAGAAGAGG - Intronic
1103176719 12:118870569-118870591 TTGGAGTGTTTGGGAAGTACAGG + Intergenic
1105246227 13:18653002-18653024 CTGAATTCTTTGGGAAGGGCTGG + Intergenic
1106522569 13:30510843-30510865 CTGGACTGATTGAGGAGGGCTGG - Intronic
1113601475 13:111572269-111572291 CTGGGCTGCTTTGGAGGAGCAGG - Intergenic
1113667648 13:112152011-112152033 CTAAACAATTTGGGAAGAGCTGG - Intergenic
1113913922 13:113859984-113860006 GTGGATTCTTTGGGAACAGCTGG - Intronic
1113973065 13:114205610-114205632 CTCGTCCCTTTGGGAAGAGCTGG + Intergenic
1114648210 14:24267364-24267386 CTGGAATGTGTGGGAGGAGTGGG + Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116964831 14:51003040-51003062 CAGGACTGGTTGGAAAGAGAAGG + Intronic
1117279639 14:54225799-54225821 CTGAAGTGTTTCGGAAGAACAGG - Intergenic
1119325119 14:73755258-73755280 CTCGGCTGGTGGGGAAGAGCTGG - Intronic
1121241015 14:92430239-92430261 CTGGACTGTCTAGGAATGGCTGG - Intronic
1124598716 15:31113278-31113300 CTGGAGAGTTAGGGAGGAGCAGG - Intronic
1126023812 15:44427199-44427221 CGGAACTGCTTGGGCAGAGCTGG - Intergenic
1127842342 15:62842329-62842351 CTAGCCTGTTGGGGAAAAGCTGG + Exonic
1127881784 15:63164563-63164585 ATGGACTTTTGGGGAAGAGAAGG - Intergenic
1129111145 15:73338023-73338045 CTGAGCTGCCTGGGAAGAGCTGG + Intronic
1129807140 15:78471848-78471870 CTACACTGTCTGGGAAGAGGAGG - Exonic
1130655963 15:85792427-85792449 CTGGCCAGTGTGGGCAGAGCTGG - Intronic
1131431848 15:92394322-92394344 CGGGACGGTTTGGGGAGAGGAGG + Intronic
1131557163 15:93409810-93409832 CTTGACTCTTTGTGAAAAGCTGG + Intergenic
1132323739 15:100948064-100948086 GTGAGCTTTTTGGGAAGAGCTGG - Intronic
1132346273 15:101111019-101111041 CTGGACTGTGAGGGAGGTGCCGG + Intergenic
1134097984 16:11431776-11431798 CAGGAGAGTATGGGAAGAGCTGG - Intronic
1134310553 16:13071966-13071988 CTAGGCGATTTGGGAAGAGCGGG - Intronic
1135647033 16:24172192-24172214 ATGGACAGTGGGGGAAGAGCTGG - Intronic
1137037574 16:35579458-35579480 TTGAGCTGTTAGGGAAGAGCTGG - Intergenic
1138330410 16:56210444-56210466 CTGGATTGTGTGGTAAGAACAGG + Intronic
1141275943 16:82588362-82588384 CTAATCTGTTTGGGAAGAGTAGG - Intergenic
1142668228 17:1474686-1474708 ATGGTCTGTGTGGGCAGAGCCGG + Exonic
1142805014 17:2366968-2366990 CGGGACTGTCTGGGATGGGCTGG - Intronic
1143626064 17:8110683-8110705 CCGGACATTTTGGGAAGGGCGGG - Intronic
1146296624 17:31655225-31655247 CTGGATGGCTGGGGAAGAGCAGG - Intergenic
1148106836 17:45123520-45123542 CTGGACAGATGGGGCAGAGCTGG - Intronic
1148998636 17:51734515-51734537 CTGGACTGTTCGGGCAAGGCAGG + Intronic
1149623724 17:58064989-58065011 CTGGACTGAGGGGGAAGAGTGGG - Intergenic
1151356359 17:73560975-73560997 CTGGTCTGGGTGGGATGAGCAGG - Intronic
1151809187 17:76426660-76426682 TTGAACTGTTTGGGAAGTGTAGG - Intronic
1152079404 17:78177098-78177120 CTGGACGGGTGGGGAAGTGCCGG - Intronic
1152921336 17:83068035-83068057 CTGGACGTTTTTGGAAGTGCGGG + Intergenic
1153367035 18:4268158-4268180 TTGGCCTGTCTGAGAAGAGCTGG - Intronic
1153433935 18:5048721-5048743 GAGGACAGTTGGGGAAGAGCTGG - Intergenic
1154442691 18:14406664-14406686 CTGAATTCTTTGGGAAGGGCTGG - Intergenic
1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG + Intergenic
1158650037 18:59276058-59276080 CTGGACTTATTAGGAGGAGCTGG - Intronic
1158796679 18:60855037-60855059 CGGGAATATTTGGCAAGAGCCGG - Intergenic
1161171741 19:2815570-2815592 CTGGAGTGTTTGGGGAAACCCGG - Exonic
1162590743 19:11589524-11589546 CTGAACTGCTTGGGAGTAGCAGG + Intronic
1162739862 19:12767755-12767777 GTGTACTGTTTGGGTAGAACAGG - Intronic
1163189138 19:15663451-15663473 CTGGACGGTTTGGGGACAACTGG + Intergenic
1163214106 19:15863393-15863415 CTGGACTGTTTAGGGAATGCAGG + Intergenic
1164429321 19:28173083-28173105 CTGGAATGATTGGGAAGAGAGGG - Intergenic
1166231391 19:41427390-41427412 CTGGACTGGCTGGGCAGGGCTGG - Exonic
1166332404 19:42086631-42086653 GAGGAGTCTTTGGGAAGAGCAGG - Intronic
1167427006 19:49434526-49434548 CTGGACTGTTGGGTCTGAGCGGG - Intronic
926761542 2:16282798-16282820 CTGGCCTGTTTGGGGACAGTTGG - Intergenic
926880506 2:17539680-17539702 CTGGTCTGGTTGGGAACATCTGG + Intronic
927906715 2:26863725-26863747 CTGGAGGGTTGGGGAAGAGATGG - Intronic
928151783 2:28837388-28837410 CTGGATTCTTTGGGAAGATAAGG + Intronic
928376460 2:30778638-30778660 CTGGGCAGTTTATGAAGAGCTGG - Intronic
928379218 2:30803386-30803408 CTGAACTGTGTGGGAGGTGCTGG + Intronic
928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG + Intronic
929410576 2:41694154-41694176 CTGGAGTGTGTGGGAGGGGCTGG - Intergenic
932667808 2:73710999-73711021 CTTGACTGGTTGGGAGGGGCTGG + Intergenic
934761391 2:96858862-96858884 CTGGACTTGTAAGGAAGAGCAGG - Intergenic
934937434 2:98475690-98475712 CTGGGCTGTGTGGGCAGGGCTGG + Intronic
935712692 2:105913274-105913296 CTGGAGTCACTGGGAAGAGCTGG + Intergenic
937231678 2:120401542-120401564 CAGGAAGGTTTGGGAGGAGCAGG + Intergenic
937876517 2:126829832-126829854 ATGGAAAGTTTGGGAAGAGATGG + Intergenic
938756805 2:134388113-134388135 CTTGACTTTTTGGGAAGAGGTGG - Intronic
939813991 2:146871446-146871468 CTGGCCTGTTTAGGAAAAGAAGG - Intergenic
940718388 2:157255115-157255137 CTTGTTTTTTTGGGAAGAGCTGG + Intergenic
940765386 2:157784630-157784652 CTGGGCTGGCTGGGAACAGCAGG + Intronic
942015559 2:171810526-171810548 ATGGACTTTTTGGGAAGTGTTGG - Intronic
942051783 2:172147071-172147093 CTGGTCTGGCTGGCAAGAGCGGG - Intergenic
942172507 2:173301846-173301868 CTGGACTTTCTGGGATGAGTGGG - Intergenic
942584572 2:177461149-177461171 CTGTACCGTTTGAGAAGAGATGG + Intronic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
943566938 2:189527045-189527067 CTGGACTGAGAGGGGAGAGCTGG - Intergenic
948815448 2:240507905-240507927 CTGGTCTGTTAGGGAGGAGCTGG + Intronic
1169560937 20:6800010-6800032 CTGAGCTGTGTGGGAAGACCAGG - Intergenic
1171505513 20:25629876-25629898 CTGGACAGTCTGGGGACAGCTGG + Intergenic
1172934169 20:38607684-38607706 CTGGTCAATTTGGGAAGAGTCGG - Intronic
1173169931 20:40715752-40715774 CTGGGCTGTCTGGGAAGAGAGGG + Intergenic
1173626314 20:44475741-44475763 CTGGAGTGGCTGGGAGGAGCTGG - Intergenic
1174084405 20:47995557-47995579 CTGGATCGTATGGTAAGAGCAGG + Intergenic
1174178753 20:48661841-48661863 CTGGACAGTGTGGGGAGAGGAGG - Intronic
1175552538 20:59826671-59826693 CAGGACTGTGTGTGCAGAGCAGG - Intronic
1178682449 21:34684319-34684341 CTGGGCCGGGTGGGAAGAGCAGG + Intronic
1180216291 21:46325242-46325264 CTGGGGTGCTGGGGAAGAGCGGG + Intronic
1181807960 22:25386379-25386401 CTTTACTGGTTGGGAAGAGAGGG - Intronic
1181985668 22:26798570-26798592 CTGGCCTTTCTGGGAAGAACAGG + Intergenic
1182757391 22:32690919-32690941 CTGGACTGGTAGGAAAGAGGAGG + Intronic
1182947012 22:34333454-34333476 CTGGAGTGTCTGGGCAGAACTGG + Intergenic
1182950699 22:34372930-34372952 CTTGATGGTTTAGGAAGAGCAGG + Intergenic
1183359991 22:37378525-37378547 CTGGACTGTTTGGGAAGAGCTGG - Intronic
1184196360 22:42931811-42931833 CTGGGCTGTTTTGGAAGAGAGGG - Intronic
1185397093 22:50598265-50598287 CTGGATTTTTTGGGAAAGGCAGG + Intronic
949351067 3:3125813-3125835 CTGAAAAGTTTGGGAAGAACAGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953409433 3:42681819-42681841 CTGGGGTGTGTGGGAAGAGATGG + Intergenic
953554355 3:43931526-43931548 CTGAACTGTTTAGGAAGGGAAGG + Intergenic
953919854 3:46944357-46944379 CTGAACTGTGTGGGGAGCGCAGG - Intronic
954917885 3:54164251-54164273 CTGGAGGGTTTGGGGAGAGGGGG - Intronic
956164135 3:66383624-66383646 CAGGACAGTTAGGGAATAGCAGG - Intronic
959011402 3:101081019-101081041 CTGGATTGTATGGTAAGAGTTGG - Intergenic
964604921 3:158550263-158550285 CTGGACTTCTTGGGTCGAGCGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967224575 3:187278758-187278780 CTGGACAGCTATGGAAGAGCAGG - Intronic
969199393 4:5590509-5590531 GTGGAGTCTTTTGGAAGAGCTGG - Intronic
975052920 4:69888371-69888393 CTTGAGTGTTTGGGAAGAGAAGG - Intergenic
979638973 4:122989708-122989730 CTGGAATCTGTGGGGAGAGCTGG + Intronic
983607735 4:169609214-169609236 CTGTACTGTGGGGGAATAGCAGG + Intronic
984062661 4:175010343-175010365 CTTCAATGTTTTGGAAGAGCTGG + Intergenic
984904961 4:184618093-184618115 CTGGAGTCTTTTGAAAGAGCTGG + Intergenic
985554138 5:547833-547855 GCGGCCTGTTTGGGCAGAGCTGG - Intergenic
989110228 5:37899951-37899973 CTGAATTGTTTAGGAAGAGAAGG + Intergenic
990013730 5:51031862-51031884 CTGGTCTCTTGGGGAAGTGCAGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991426559 5:66498449-66498471 CTGGAATGTTTGCATAGAGCTGG + Intergenic
996118985 5:119649749-119649771 CTGAACTGTTTGAGTAGATCTGG - Intergenic
996327547 5:122292503-122292525 TTGGAGTGTCTGGGATGAGCAGG + Intergenic
997428220 5:133818887-133818909 CTGGACTTTGTTGGAAGAGAAGG - Intergenic
999225041 5:150014845-150014867 CTCCAGTGTTTGGGAAGACCAGG - Intronic
999624370 5:153504868-153504890 CTTGAGTGTTTGAGTAGAGCAGG - Intronic
999715789 5:154358868-154358890 CGTGACTGTTTGGGAAGCCCTGG - Intronic
1001916721 5:175567694-175567716 CTGGCCTATTGGGGAAGAGTAGG - Intergenic
1002023602 5:176382245-176382267 CTGGACTGGTTCCCAAGAGCAGG - Intronic
1002441614 5:179267227-179267249 CTGGCCTGGTGGGGAAGGGCTGG + Intronic
1002468458 5:179420460-179420482 CTGTTCTGTTTGGGAGGAGCTGG - Intergenic
1007173161 6:39878638-39878660 CAGGACTGGGTGGGCAGAGCAGG + Intronic
1007255668 6:40526619-40526641 CTGAGCTCTTGGGGAAGAGCTGG - Intronic
1010951258 6:82039832-82039854 CTGGACTGATTAGGAAGTGATGG + Intergenic
1011215821 6:85004576-85004598 CTGGGCTGCTGGGGAAGACCAGG - Intergenic
1011780275 6:90781165-90781187 CTGGACTGCTTTGGCAGAGGTGG + Intergenic
1015120259 6:129693210-129693232 CTAGATTGTTGGGGAAGACCTGG + Intronic
1015795291 6:137005286-137005308 CTGGACTTTCTGGGTAGGGCTGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017645007 6:156531936-156531958 CTGGAATGTTTGAGAATTGCCGG - Intergenic
1018290782 6:162290748-162290770 CTGGACTGTTAGGGCAGAACTGG - Intronic
1018713036 6:166510909-166510931 GTGGACTTTTTGGGAAGTCCAGG + Intronic
1019255079 7:44436-44458 CAGGACTGTTGGAGAAGAGGAGG + Intergenic
1019255087 7:44498-44520 CAGGACTGTTGGAGAAGAGGAGG + Intergenic
1019255105 7:44628-44650 CAGGACTGTTGGAGAAGAGGAGG + Intergenic
1019694006 7:2434423-2434445 CTAGACAGTATGGGAACAGCTGG - Exonic
1020255614 7:6501719-6501741 CTGGGGTGGTTGGGTAGAGCTGG - Intronic
1021918710 7:25462006-25462028 CTAGTCTGGTTGGTAAGAGCAGG + Intergenic
1022864624 7:34405087-34405109 CGGGACTGTTTTGGGAGTGCAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026792859 7:73346155-73346177 TTGGTATGTTTGGGAACAGCAGG - Intronic
1031118054 7:117689708-117689730 CTGGTGTATTTGGGAAGAACAGG + Intronic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032081976 7:128863786-128863808 CTGGACTGTTTGGGGGAAACAGG - Intronic
1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG + Intergenic
1036053880 8:5229026-5229048 ATGGTTTGTGTGGGAAGAGCAGG - Intergenic
1038399091 8:27269426-27269448 CTGGACAGCTGGGGAAGAGGTGG - Intergenic
1038782485 8:30580059-30580081 CAGGACTGCTTGGGAGGAGCTGG + Intronic
1043389071 8:79773902-79773924 CTGGTGAGTTTGGGAAGTGCTGG - Intergenic
1043911200 8:85866334-85866356 CAGGACTGTTTTAGAGGAGCAGG + Intergenic
1043921688 8:85990404-85990426 CTAGACTCTGTGGGAAGAGTGGG - Intronic
1044617674 8:94158773-94158795 CTGGAATGTTTGGTAACAGTAGG + Intronic
1047361759 8:124175598-124175620 CTGCACTGTTTGGAAACAGCTGG + Intergenic
1047411882 8:124630568-124630590 CTGGACAGTTTGAGAAGCACTGG + Intronic
1048354374 8:133641385-133641407 TTGGCCTCTGTGGGAAGAGCAGG + Intergenic
1051135766 9:13918723-13918745 CTGGAATGTTTGGGAGAATCAGG - Intergenic
1051355910 9:16239704-16239726 CTGCACTGGGAGGGAAGAGCTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053141889 9:35687785-35687807 CTGGAAAGTTTGGGAAGTCCTGG + Intronic
1054749522 9:68890304-68890326 CTGGACTATTTAGGAACAGTGGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056773372 9:89495613-89495635 CTGCCCTGGTTGGGAACAGCAGG + Intronic
1057221922 9:93262061-93262083 CTGGACAGTTGGGCAAGGGCTGG - Exonic
1057422493 9:94923645-94923667 CTGGACTGTAAAAGAAGAGCAGG - Intronic
1057848935 9:98549625-98549647 CTGGCCAGTATGGGATGAGCTGG - Intronic
1060627221 9:125124788-125124810 CTTGGCTTTTTGGGAAGAGTGGG - Intronic
1060652758 9:125343756-125343778 CCAGTCTGATTGGGAAGAGCTGG + Intronic
1062076754 9:134593933-134593955 CGGGTCTGTGTGGGAAGCGCTGG + Intergenic
1185697571 X:2206726-2206748 CTGGAGTATTTGGGAGGAGGTGG - Intergenic
1187472533 X:19581935-19581957 GTGGACTTCTTGTGAAGAGCTGG - Intronic
1189866128 X:45329232-45329254 TTGGACTTTTGGGGGAGAGCAGG + Intergenic
1192552529 X:72065546-72065568 CTGTAGGGTTTGGGAACAGCAGG + Intergenic
1194740929 X:97573525-97573547 CTGGATAGTTTGGGGAGAGGGGG + Intronic
1196518090 X:116638052-116638074 TTGCACTGTGTGGGAAGAGATGG - Intergenic
1198130240 X:133686877-133686899 CTGGACTGCTGGGGAAGAGATGG + Intronic
1198713835 X:139534937-139534959 CTCGGCTGTCTGGGAAGAGAAGG + Intronic
1198716795 X:139566312-139566334 CTGGATTGATTGAAAAGAGCAGG - Intergenic
1200230774 X:154442918-154442940 CTGCTCTGTTTGGGAAGACGTGG + Exonic
1200937605 Y:8751890-8751912 ATGGACTCTCTGGGAAGGGCAGG + Intergenic
1201304169 Y:12536647-12536669 CTGCACTGTTTGGCATAAGCAGG + Intergenic
1202088077 Y:21160141-21160163 CTGGACTGTATGAGAAAAGCAGG + Intergenic