ID: 1183360921

View in Genome Browser
Species Human (GRCh38)
Location 22:37383086-37383108
Sequence CAGCTGTACCCAAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183360921_1183360931 25 Left 1183360921 22:37383086-37383108 CCTCCTGCCCTTGGGTACAGCTG 0: 1
1: 0
2: 1
3: 32
4: 262
Right 1183360931 22:37383134-37383156 CCCTCTTACAACGTGTCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 16
1183360921_1183360929 1 Left 1183360921 22:37383086-37383108 CCTCCTGCCCTTGGGTACAGCTG 0: 1
1: 0
2: 1
3: 32
4: 262
Right 1183360929 22:37383110-37383132 CCGGGTCATGCTTGCTGTCAAGG 0: 1
1: 0
2: 1
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183360921 Original CRISPR CAGCTGTACCCAAGGGCAGG AGG (reversed) Intronic
900975084 1:6011786-6011808 CACCTGGAGCCCAGGGCAGGGGG + Intronic
901399278 1:9004919-9004941 CAGGTGTCCCCCAGGGCTGGCGG + Intronic
901879171 1:12184243-12184265 CAGCAGTCCCCAGGAGCAGGGGG - Intronic
902216230 1:14936004-14936026 CAGGCGTCCCCAAGGGCAGGGGG - Intronic
902530967 1:17090430-17090452 CAGCTCTCCCCAAGGCCAGGGGG - Intronic
902652185 1:17844193-17844215 CAGCTGTGTCCAAGGGCAGTGGG + Intergenic
902686048 1:18078296-18078318 CACCTGGACCCATGGGCTGGGGG - Intergenic
903833984 1:26190877-26190899 CAGCTGTGCTCATGGGCAGCAGG + Intronic
904302124 1:29561237-29561259 CAGCTTCACCCCAGGGCTGGAGG + Intergenic
904455165 1:30643054-30643076 CAGCTTCACCCCAGGGCTGGAGG - Intergenic
905013911 1:34764217-34764239 CAGGTGCCCCCAATGGCAGGAGG + Intronic
905293984 1:36942661-36942683 CAGCTGTAGGCAAGGGTTGGGGG - Intronic
911475499 1:98367577-98367599 CAGCTGTGCCCAGGGGCATGGGG + Intergenic
911804274 1:102185910-102185932 CAGCTGAAACAAAAGGCAGGAGG + Intergenic
912513598 1:110204451-110204473 CAGGTTTGCCCCAGGGCAGGTGG + Intergenic
913112729 1:115671044-115671066 CAGCTGTAGCCGCTGGCAGGAGG - Intronic
913164260 1:116170375-116170397 CAGTTCTTCCTAAGGGCAGGAGG + Intergenic
914196590 1:145451035-145451057 CAGCTGCTCCCCAGGGCAGCAGG + Intergenic
915491058 1:156250294-156250316 CTGCTGTCTCCAGGGGCAGGTGG - Exonic
916250699 1:162735019-162735041 CAGCTGGACTCAACTGCAGGAGG + Intronic
917848917 1:179043381-179043403 CAGCTGTACCCAGGAACACGGGG + Intronic
919920975 1:202166264-202166286 CAGCAGTGCCCAAAGCCAGGTGG + Intergenic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
923147645 1:231209327-231209349 CTGCTGTCCCCAAAGCCAGGAGG + Intronic
923684823 1:236146659-236146681 GATGTGTACCCAAGGGCAGCCGG - Intronic
1067729725 10:48801568-48801590 CAGCTGTCCCAAATGGCAGCTGG + Intronic
1071771071 10:88729078-88729100 CAGCTGGAGGCAAGGGCAAGAGG - Intronic
1073285490 10:102385075-102385097 CAGCTGGGCCCCAGTGCAGGGGG - Intergenic
1073295337 10:102435267-102435289 AAGCAGTACCAAAGGGCAGTGGG - Intergenic
1074167841 10:110901239-110901261 CAGCTGTACCCAAGCCTGGGTGG + Intronic
1074275400 10:111996961-111996983 CAGCTGTGCCTATGGGAAGGGGG - Intergenic
1075067941 10:119302358-119302380 CAGAGGAGCCCAAGGGCAGGGGG + Intronic
1075195954 10:120359327-120359349 CACCTGTACCCTAGGGCGCGGGG - Intergenic
1075728219 10:124621385-124621407 CAGCCGAACCCAAGAGCTGGTGG - Exonic
1076470852 10:130716928-130716950 CAGCTGTCCCCAGGGCAAGGAGG - Intergenic
1077299202 11:1839413-1839435 CAGCTGTCCCCGAGGGAGGGTGG - Intronic
1077394110 11:2312746-2312768 CAGCTGCCCCAAAGGGCTGGGGG - Intronic
1077541008 11:3146504-3146526 CAGCCGTGCCCACAGGCAGGGGG - Intronic
1077541042 11:3146653-3146675 CAGCTGTGCCTGAGTGCAGGGGG + Intronic
1078987889 11:16612805-16612827 CAGCTCTGCACAAGGGCAGCTGG + Intronic
1079673930 11:23202163-23202185 CAGCTGCACCCAGGAGCAAGGGG - Intergenic
1080758288 11:35223465-35223487 CAGCTGTCCCTAAGAGCAGCTGG + Intronic
1081044224 11:38251172-38251194 CAGCTGTACCCGGGAGCATGGGG + Intergenic
1083823114 11:65183461-65183483 CAGCAGTCCCCTGGGGCAGGAGG - Exonic
1083891459 11:65597865-65597887 CAGATGACCCCCAGGGCAGGAGG + Exonic
1084706555 11:70819337-70819359 CAGCTGTACCCATGAGAATGTGG + Intronic
1086703128 11:89922509-89922531 CAACAGTACCCATGGGCAGAGGG - Intergenic
1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG + Intergenic
1087898198 11:103611077-103611099 CAGCTGGCACCAAGGGAAGGCGG - Intergenic
1088243216 11:107792122-107792144 CATCTGTACCCAAAGGCCTGTGG + Exonic
1088679024 11:112222878-112222900 CTGCTGTCTCCAGGGGCAGGTGG - Intronic
1088738966 11:112751402-112751424 CAGCAGTAGCCAGGGCCAGGGGG - Intergenic
1088754300 11:112872905-112872927 CAGTTGTGCCCAAGGCCAGGAGG - Intergenic
1089376518 11:117998961-117998983 CAGCTGTCCCCCAGCACAGGGGG - Exonic
1089702457 11:120253828-120253850 AAGATGTACCCAGGGTCAGGTGG - Intronic
1090012512 11:123057828-123057850 AAGCTGTACCAGAGTGCAGGAGG - Exonic
1091895433 12:4099407-4099429 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
1092617353 12:10227245-10227267 ATGCTGTACCCACGGGCAGGTGG - Intergenic
1093984754 12:25517989-25518011 CAGATCTACCCAAGGTGAGGAGG - Intronic
1095651273 12:44612629-44612651 CAGCAGAACCCAAAGGTAGGTGG - Intronic
1095858403 12:46887279-46887301 AAGCTTTTCCTAAGGGCAGGGGG + Intergenic
1100608325 12:96170003-96170025 CAGATGTGGCCAAGGGCTGGAGG + Intergenic
1102057942 12:109910793-109910815 CAGGTGTATCCGAGGGCATGTGG + Intronic
1102250714 12:111385564-111385586 AAGCTGGACCCAAGTGCAGGAGG + Intergenic
1102257731 12:111425794-111425816 CAGCGGTGCCCAGGGGAAGGAGG - Intronic
1102803298 12:115756439-115756461 CAGATCTGCCCAGGGGCAGGAGG - Intergenic
1105503645 13:20992234-20992256 CAGCAGCACGCAAGGGTAGGTGG + Intronic
1106350436 13:28924438-28924460 CATCTGTACTCAAGAGCGGGAGG - Intronic
1107396167 13:40020114-40020136 CAGTTGTTCCCTAGGGCATGGGG - Intergenic
1108417137 13:50209175-50209197 CAGGCGTCCCCAGGGGCAGGGGG + Intronic
1109834624 13:67840947-67840969 CAGCTGTAGGCCAGGGCTGGTGG + Intergenic
1112264643 13:97912313-97912335 CAGCTGTTCTCCAGGGCTGGAGG - Intergenic
1112274176 13:98001027-98001049 CAGCTGCCCTCCAGGGCAGGTGG - Intronic
1113363429 13:109653059-109653081 CACCTGAACCCAAGGACATGGGG + Intergenic
1115416975 14:33146791-33146813 GAGGTTTACCGAAGGGCAGGAGG + Intronic
1116266032 14:42691593-42691615 CAACTGTCCCCACGGGTAGGTGG + Intergenic
1117342934 14:54807306-54807328 CACCTGTGCAAAAGGGCAGGTGG - Intergenic
1118318944 14:64742193-64742215 CAGCAGTACCCAGGGGGAGCTGG + Exonic
1119106015 14:71924558-71924580 CAGTGGTTACCAAGGGCAGGTGG - Intergenic
1123476968 15:20597350-20597372 AAGCTGCAGCCAGGGGCAGGTGG + Intergenic
1123641043 15:22403014-22403036 AAGCTGCAGCCAGGGGCAGGTGG - Intergenic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1123821658 15:24036508-24036530 CAGCTGTACAGAAGGGTAAGAGG - Intergenic
1124154393 15:27212735-27212757 CAGTTGTTGCCAAGGTCAGGGGG - Intronic
1124156984 15:27234610-27234632 CACCAGTACCCAGGAGCAGGTGG - Intronic
1124862812 15:33459356-33459378 CAGCTCTACCCCAGGGCAAAAGG - Intronic
1125301039 15:38253105-38253127 CAGCAGCACCGAGGGGCAGGAGG - Exonic
1125957229 15:43798967-43798989 CAGCTGTGCCCGCGGGCTGGTGG + Exonic
1126350669 15:47742057-47742079 CAACAGGAGCCAAGGGCAGGAGG + Intronic
1128504524 15:68257137-68257159 CAGCGGTGCCCAGGGGCTGGAGG + Intronic
1129119481 15:73387298-73387320 CATCTGTACCCAAGGCCAAATGG + Intergenic
1129160132 15:73742775-73742797 AAGCTCCACCCAAGGGCTGGTGG + Intronic
1129977468 15:79834190-79834212 CTGCTGTACCCAATGGCTGGAGG + Intronic
1131207847 15:90466604-90466626 CAGCTGTCCACAAGGGGGGGGGG - Intronic
1131951202 15:97683613-97683635 CAGTTGAACCCAGGAGCAGGAGG + Intergenic
1133235097 16:4384057-4384079 TCGCTGTAGCCAGGGGCAGGAGG - Intronic
1134054030 16:11157870-11157892 CAGCAATACCCGAGGGCAGGCGG - Intronic
1134110843 16:11514597-11514619 CAGCTGGGACCAAGGGGAGGAGG + Intronic
1135166777 16:20146193-20146215 CACCTGTTCCCAAAGGGAGGTGG - Intergenic
1135891462 16:26361153-26361175 CACTTGAACCCAGGGGCAGGAGG - Intergenic
1137444201 16:48522046-48522068 CAGCTTTACCCAGGGGCAGATGG + Intergenic
1137602210 16:49764000-49764022 CTGCTGGCCCCACGGGCAGGAGG + Intronic
1140266972 16:73429264-73429286 CAGCTGTCCCCTTGGGCATGGGG - Intergenic
1140348992 16:74243587-74243609 CAGCTGCAGACAAGTGCAGGTGG + Intergenic
1140768295 16:78180364-78180386 CAGCTGTACCCAAGAGTTGGGGG + Intronic
1140768306 16:78180413-78180435 CAGCTGCACCCAAGAGTAGGGGG + Intronic
1140768372 16:78180752-78180774 CAGCTGTACACGAGAGTAGGGGG + Intronic
1141689636 16:85588865-85588887 CAGCTGCCCCCCAGGGCAGTAGG - Intergenic
1141818442 16:86428974-86428996 CAGCTGAACCTAAGGAGAGGTGG + Intergenic
1142048133 16:87939167-87939189 CAGCAGTACCCGTGGGCTGGGGG + Intergenic
1142178879 16:88657645-88657667 CAGCTGTGACCCCGGGCAGGTGG - Intronic
1143265101 17:5630698-5630720 CAGCTGTCCCCCAGGGAAGTAGG + Intergenic
1144890901 17:18493834-18493856 CAGCTATTGCAAAGGGCAGGAGG + Intronic
1145141323 17:20450484-20450506 CAGCTATTGCAAAGGGCAGGAGG - Intronic
1146366719 17:32234558-32234580 CAGCTCTGCTCAAGTGCAGGAGG - Intronic
1148695233 17:49554884-49554906 CATCTGTACCCAGGAACAGGAGG + Intergenic
1151875242 17:76864261-76864283 CAGCAGGACCCAGGGGCAGGGGG + Intergenic
1152688357 17:81706024-81706046 CAGCACCACCCGAGGGCAGGGGG - Intronic
1155103764 18:22640479-22640501 CAGCACTGCCCAAGGCCAGGTGG + Intergenic
1160364528 18:78313023-78313045 CTGCTCTGCCCAGGGGCAGGTGG - Intergenic
1160681930 19:415821-415843 GACCTGTCCCCCAGGGCAGGGGG + Intergenic
1161390755 19:4019178-4019200 CAGCTGACCCCGAGGGCAGAAGG + Intronic
1161798660 19:6402970-6402992 CAGCTGTTCCCACATGCAGGTGG + Intergenic
1163106038 19:15123574-15123596 CACCTGGGCCCAAGGACAGGTGG + Exonic
1163536825 19:17881756-17881778 CACCTGTGACCAAGGGCAGGTGG - Intronic
1164785700 19:30928681-30928703 CAGCTGAACAGAAGGACAGGAGG - Intergenic
1165893770 19:39129794-39129816 CACCTGCCCCCAAGGGCAGTTGG - Intronic
1165933985 19:39377983-39378005 CAGACGTGCCCAAGGGCAAGGGG - Intronic
1166231519 19:41427763-41427785 CGGCTGCACCCATGGCCAGGAGG + Intronic
1166711490 19:44940556-44940578 CAGCTGCACCCCAGGGCACATGG - Intergenic
1167022481 19:46888426-46888448 CACCGTTACCCAAGGGCATGAGG - Intergenic
1167323525 19:48810863-48810885 CAGCGGAACCCCAGGGCGGGAGG + Intronic
1168037349 19:53730531-53730553 CAGAGATACACAAGGGCAGGTGG - Intergenic
1168294092 19:55370324-55370346 CAGGGGTTCCCCAGGGCAGGGGG + Exonic
925179577 2:1808346-1808368 CTGGTGTTCCTAAGGGCAGGGGG - Intronic
926250514 2:11153232-11153254 CAGCTGACCCCCAGAGCAGGCGG + Intergenic
929572124 2:43029250-43029272 CAGGAGGACCCAAGGCCAGGAGG + Intergenic
932165347 2:69500492-69500514 CAGCTGTGCCCTTGGGCAGGTGG + Intronic
937118200 2:119424489-119424511 AAGCTGTGACCAAGGGCTGGGGG - Intergenic
937246884 2:120499345-120499367 CTGCTGTACCCCAGGGCAAGGGG + Intergenic
938107737 2:128544773-128544795 CTGCTGTAACCAAGGCCAGGGGG - Intergenic
938236311 2:129709526-129709548 CAGCAGCAGCCAAGGGCTGGGGG + Intergenic
938308316 2:130268999-130269021 CAGTTGTCCCCAAGGTCAGGTGG - Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
938447013 2:131387837-131387859 CAGTTGTCCCCAAGGTCAGGTGG + Intergenic
939671812 2:145022193-145022215 CAGCTGAACTCCAGGGAAGGTGG - Intergenic
940711298 2:157165732-157165754 CAGCTGTACCCAAGAGCTCAGGG + Intergenic
943123530 2:183767996-183768018 CTGGTGTACACAAGAGCAGGGGG - Intergenic
946230277 2:218286985-218287007 CAGCTGTGCCCTGGGGTAGGAGG - Intronic
947294133 2:228612326-228612348 GAGCTGTACCTAAGGAAAGGAGG + Intergenic
948552045 2:238779123-238779145 CAGCTGCACCCAGGGACAGCAGG + Intergenic
948884220 2:240874897-240874919 CAGCTGGGCCCAAGGGCCAGCGG + Intronic
1173546801 20:43903958-43903980 CCTCTGTACCCAAGAGCAAGGGG - Intergenic
1173564821 20:44031149-44031171 AAGTGGTACACAAGGGCAGGTGG + Intronic
1174038486 20:47682865-47682887 CAGATGTACCCCAGGGCCAGCGG - Intronic
1175268749 20:57719013-57719035 CCTCTGTAACCATGGGCAGGTGG + Intergenic
1175621378 20:60450378-60450400 CAGCTGAAACAAAAGGCAGGAGG - Intergenic
1175716903 20:61261042-61261064 CAGCTGCACACAGGGGCAAGTGG - Intronic
1175766309 20:61595132-61595154 CAGGTGGACCCAAGGGTGGGAGG - Intronic
1175886950 20:62297460-62297482 CATCTGAACACAAGGTCAGGAGG + Intergenic
1176132942 20:63503967-63503989 CACCTTTACCGAGGGGCAGGAGG - Intergenic
1179629983 21:42671250-42671272 CAGACGTACACAAGAGCAGGAGG - Intronic
1180975100 22:19843924-19843946 CAGCTATACCCTAGGGGAGCAGG - Intronic
1181050028 22:20234114-20234136 TAGCTGTGCCCAGGGGCATGGGG - Intergenic
1181547328 22:23609547-23609569 CAGGTGTACCCCTGGTCAGGGGG - Intronic
1181721263 22:24776400-24776422 CTGGTTTACCCAAGGGCATGTGG + Intergenic
1182062121 22:27405943-27405965 GAGCTATGCCCAAGGGCATGCGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182473968 22:30565809-30565831 CAGCTTTGCCCATGGGCAGAGGG + Intronic
1183360921 22:37383086-37383108 CAGCTGTACCCAAGGGCAGGAGG - Intronic
1183483499 22:38077395-38077417 CACCTGGATCCAAGTGCAGGAGG + Intergenic
1183506531 22:38212336-38212358 CATCTGTCTCCAAGGGGAGGGGG - Intronic
1183678499 22:39313120-39313142 CGGCTGGAGCCAAAGGCAGGCGG + Intronic
1183696707 22:39427850-39427872 GAGCTGTCCCAAGGGGCAGGGGG + Intronic
1183774662 22:39956057-39956079 CAGCTGAAGGCCAGGGCAGGAGG + Intronic
1184244220 22:43227734-43227756 CAGCTGCACCCCAGGCTAGGGGG + Intronic
1184444022 22:44536660-44536682 CATCTCTGTCCAAGGGCAGGAGG + Intergenic
1184555907 22:45233005-45233027 CAGGTGGATCCAAGGACAGGTGG + Intronic
1184654747 22:45935449-45935471 CTGCTGTCCCCCAGGGCAGGCGG - Intronic
1185346807 22:50313981-50314003 CAGGTGCAGCCAAGGGCATGGGG - Intronic
951114508 3:18844253-18844275 CAGCTTTACCACAGGGCTGGGGG + Intergenic
951680811 3:25292721-25292743 CAGCTGTCCCCACTGGCAAGTGG + Intronic
952494369 3:33902937-33902959 CAGCTGTACCCAGGAGAGGGTGG + Intergenic
952711126 3:36433032-36433054 CAGCAGAGCCCCAGGGCAGGAGG + Intronic
953564148 3:44016695-44016717 CAGATATACACAATGGCAGGTGG - Intergenic
953768390 3:45761077-45761099 CAGCAGCAGCAAAGGGCAGGTGG - Intronic
953988822 3:47467745-47467767 CACATGTACCCAAGGGCCAGTGG - Intronic
954432170 3:50476607-50476629 CTCCTGTTCCCAAGGCCAGGTGG + Intronic
954980473 3:54741034-54741056 CAGCTGTGCCCAAGGCCAAGTGG + Intronic
959564760 3:107823118-107823140 TAGATGTACTCAAGGGCAGATGG - Intergenic
960931186 3:122852671-122852693 GGGCTGTACCTAAGAGCAGGAGG - Intronic
961388366 3:126537268-126537290 CAGCTGTGCCAAAGGCCTGGCGG + Intronic
961528685 3:127526213-127526235 CAGCTGTAATCAAGGGGATGAGG - Intergenic
961675240 3:128560955-128560977 CAGCTGCACCCACGGGGAAGTGG - Intergenic
962689724 3:137882121-137882143 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
964527430 3:157630279-157630301 TAGCTGTAGCCAAGAGAAGGAGG + Intronic
967082402 3:186062298-186062320 AAGATGTGCCCAAGGGCACGTGG - Intronic
967805648 3:193712501-193712523 CAGCTGTAACCATGGGATGGGGG - Intergenic
968047270 3:195631360-195631382 CAGCCTCACCCAAGGGCAGTTGG + Intergenic
968307343 3:197658564-197658586 CAGCCTCACCCAAGGGCAGTTGG - Intergenic
968785913 4:2622339-2622361 CAGGAGTCCCCAAGGGCAGAGGG + Intronic
969057714 4:4412547-4412569 CAGCTTTGGCCAAGGGCAGCTGG - Intronic
969593777 4:8136780-8136802 CAGCTGGACCCGAGGCCACGTGG - Intronic
970299567 4:14667174-14667196 CACCTTTACCTAAGGGCAGACGG + Intergenic
970911261 4:21278736-21278758 GAGATGTCCCCAAGGGCAGAGGG + Intronic
974048274 4:56915472-56915494 CAGCTGATCACAAGGTCAGGAGG - Intronic
979171969 4:117611286-117611308 AAGCTGTACCCAATGCCAAGAGG + Intergenic
981511663 4:145565072-145565094 TACCTGTAACCCAGGGCAGGTGG + Intergenic
981637782 4:146899909-146899931 CAGCTGTGCCCAGGGGCAGGTGG - Intronic
981888908 4:149713593-149713615 CAGCTGAAAGTAAGGGCAGGGGG - Intergenic
985636251 5:1037267-1037289 CAGGAGTCCCCAGGGGCAGGAGG + Intronic
985681442 5:1257925-1257947 GGGCTGTACCAAAGGGCAGTCGG - Intronic
986649952 5:9953484-9953506 CAGATGTACCAAAAGGGAGGAGG + Intergenic
987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG + Intergenic
989712118 5:44411685-44411707 CAGCTATCCTCTAGGGCAGGAGG + Intergenic
992153170 5:73926492-73926514 CAGGTGAACCAAAGGGTAGGGGG - Intronic
995322756 5:110855748-110855770 CATCTATACGCAATGGCAGGGGG - Intergenic
997387181 5:133482777-133482799 CAGCTGTACAAATTGGCAGGAGG + Intronic
998176066 5:139902872-139902894 TAGCTCTTCCCAAGGACAGGTGG - Intronic
998847775 5:146327558-146327580 CAGCTTTAGCAAAGGGAAGGAGG - Intronic
999637710 5:153640088-153640110 CATATGTAACCAAGGGCAGGGGG - Intronic
1001241897 5:170077661-170077683 CAGCTGTAGCCTGGGGAAGGTGG - Intronic
1001706575 5:173745329-173745351 CAGCTGCACCCAGAGCCAGGTGG + Intergenic
1001848961 5:174946299-174946321 CACCTGTACCCCAGGGCTGGTGG + Intergenic
1002087548 5:176785403-176785425 CACCTCTCCCCGAGGGCAGGGGG - Intergenic
1003405387 6:5823507-5823529 CAAATGTCCCCAGGGGCAGGAGG + Intergenic
1004614895 6:17280861-17280883 CAGCTGTTCCCAACAGCTGGGGG + Intergenic
1005265447 6:24107615-24107637 CAGCTGCAGCCATGGGCAGTGGG - Intergenic
1007093581 6:39199766-39199788 CAGCTCCACCCAAGTGCTGGTGG + Intronic
1007293147 6:40802055-40802077 CAGCTGGCCCCAGGGGCAGTGGG - Intergenic
1007717373 6:43865116-43865138 CAGCTGTTCCCTCGGGAAGGTGG + Intergenic
1009865350 6:69391331-69391353 CAGCTGTCCCCTTAGGCAGGGGG + Intergenic
1011514811 6:88142169-88142191 CAGCTGTCACCAAGGGCATGTGG + Exonic
1011751371 6:90458488-90458510 CTGCTGTACTCAGGGGCCGGTGG - Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1019472617 7:1229603-1229625 CAGCTGGGCCCAAGCGCAGGAGG + Intergenic
1019524341 7:1474026-1474048 GAGCTGGTCCCCAGGGCAGGTGG + Intronic
1019599575 7:1874589-1874611 CAGCATTACCCAGAGGCAGGTGG + Intronic
1020026283 7:4902338-4902360 CAGGTCTGGCCAAGGGCAGGAGG + Intergenic
1022972396 7:35530071-35530093 CAGCTGTATCCAATGACAGGTGG - Intergenic
1023802739 7:43849166-43849188 CAGCTGTACCCACTGACAGCTGG + Intergenic
1023843070 7:44107526-44107548 CAGCTGGCCCCAAGGCCAGGCGG - Intronic
1024709037 7:51995291-51995313 CAGCTGTACTCTGGGGAAGGAGG + Intergenic
1024732211 7:52265089-52265111 CAGCTGTAGCCATGGCCAAGCGG + Intergenic
1025256732 7:57388902-57388924 CAGCTGCAGCCAAGGGGAAGAGG - Intergenic
1026769730 7:73187989-73188011 CAGATGTCCCCACGGGCAGGTGG + Intergenic
1027010598 7:74741371-74741393 CAGATGTCCCCACGGGCAGGTGG + Intronic
1027077444 7:75204669-75204691 CAGATGTCCCCACGGGCAGGTGG - Intergenic
1027269670 7:76512705-76512727 CAGCAGTAGCCGGGGGCAGGGGG - Intronic
1028928380 7:96385835-96385857 CAGCTGGGACCTAGGGCAGGAGG - Intergenic
1028949587 7:96619870-96619892 GAACTTTGCCCAAGGGCAGGGGG + Intronic
1032812286 7:135432581-135432603 CAGCTGTGCCCAAGGTAAAGAGG - Intronic
1035684528 8:1513441-1513463 CAGCTGTTCCCAGGGAAAGGCGG - Intronic
1040626150 8:49151791-49151813 CACCTGCATCCAAGAGCAGGAGG + Intergenic
1043113301 8:76215821-76215843 CAGCTGTACTCCAGGGAAGATGG - Intergenic
1047544052 8:125797963-125797985 CAGCTGTGCCCAGGAGCATGGGG + Intergenic
1048036653 8:130683592-130683614 CACCTGAACCCAGGGGCCGGAGG - Intergenic
1049433704 8:142576714-142576736 CACCAGGACCCATGGGCAGGTGG + Intergenic
1051440191 9:17075148-17075170 CACATGTACCCAAGAGGAGGAGG + Intergenic
1051877412 9:21806729-21806751 CAGCATCAGCCAAGGGCAGGTGG + Intronic
1051945159 9:22560226-22560248 GAGCTGAAACAAAGGGCAGGAGG + Intergenic
1053174726 9:35914531-35914553 CTATTGTCCCCAAGGGCAGGAGG + Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1055513295 9:77015604-77015626 CAGCTGTGCCCAGGGCGAGGAGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056580859 9:87887336-87887358 CGACTGGACACAAGGGCAGGGGG + Exonic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057931372 9:99196357-99196379 CATCTGCACTCAAAGGCAGGAGG + Intergenic
1059281396 9:113136952-113136974 CAGCTGCAGCCCAGGGCGGGAGG + Intergenic
1059809432 9:117839343-117839365 CACCTGTTGCTAAGGGCAGGTGG - Intergenic
1060531036 9:124347099-124347121 CACCTCTATCCAGGGGCAGGAGG + Intronic
1060533239 9:124361404-124361426 CAGCTGTACCCGAGTGCTTGAGG + Intronic
1060992355 9:127856411-127856433 CACCTGTGACCCAGGGCAGGTGG - Intergenic
1061995681 9:134181587-134181609 CAGCAGGACCCGTGGGCAGGTGG - Intergenic
1062166390 9:135109782-135109804 CAGGTGTGGCCAAGGGCAGAGGG + Intronic
1062275317 9:135727692-135727714 GAGCAGTACCCAGGGGCTGGGGG - Intronic
1062385020 9:136305846-136305868 CCGCTGTCCCCCAGGGCAGGTGG - Intronic
1062577365 9:137214952-137214974 CAGTTCTGCCCAAGGCCAGGAGG + Exonic
1062698142 9:137885799-137885821 CAGCTGCTCCCCAGGGCAGCAGG - Intronic
1187106863 X:16252240-16252262 CAGGTGTAACCAGGGGCACGAGG + Intergenic
1187274381 X:17805389-17805411 CTGCAGTCCCCAAGGACAGGAGG - Intronic
1188107628 X:26163314-26163336 AAGCTGTACCACAAGGCAGGAGG - Intergenic
1188111019 X:26196543-26196565 AAGCTGTACCACAAGGCAGGAGG - Intergenic
1195242676 X:102968334-102968356 GAGCTATACCCAGGGGCAAGAGG + Intergenic
1195709906 X:107765371-107765393 CAGCTGCACCCAAGGCCAGTGGG - Intronic
1196980081 X:121203173-121203195 AAGCTGTACCAGAGTGCAGGAGG - Intergenic
1197249890 X:124204588-124204610 AAGCTGTACCAGAGTGCAGGAGG - Intronic
1198112553 X:133514480-133514502 AAGATGTACCCAAGGCCAAGAGG + Intergenic
1199614664 X:149647362-149647384 CAGCTGTGCCCAGGGGAGGGGGG - Intergenic
1200139109 X:153889096-153889118 CAGTGGTGGCCAAGGGCAGGGGG - Intronic