ID: 1183364015

View in Genome Browser
Species Human (GRCh38)
Location 22:37397740-37397762
Sequence CAATGTAAGAAGAAGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 236}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183364015_1183364029 27 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364029 22:37397790-37397812 GGGGAACGAGCTACCGGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1183364015_1183364024 8 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364024 22:37397771-37397793 AGCTTCCTAAGCACAAGGAGGGG 0: 1
1: 0
2: 2
3: 14
4: 180
1183364015_1183364023 7 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364023 22:37397770-37397792 GAGCTTCCTAAGCACAAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 185
1183364015_1183364022 6 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364022 22:37397769-37397791 GGAGCTTCCTAAGCACAAGGAGG No data
1183364015_1183364028 26 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364028 22:37397789-37397811 AGGGGAACGAGCTACCGGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1183364015_1183364021 3 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364021 22:37397766-37397788 CCAGGAGCTTCCTAAGCACAAGG 0: 1
1: 0
2: 6
3: 29
4: 284
1183364015_1183364027 22 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364027 22:37397785-37397807 AAGGAGGGGAACGAGCTACCGGG 0: 1
1: 0
2: 0
3: 7
4: 138
1183364015_1183364026 21 Left 1183364015 22:37397740-37397762 CCTGCCCACTTCTTCTTACATTG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1183364026 22:37397784-37397806 CAAGGAGGGGAACGAGCTACCGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183364015 Original CRISPR CAATGTAAGAAGAAGTGGGC AGG (reversed) Intronic
903855025 1:26332009-26332031 TAAATTAAGAAAAAGTGGGCTGG + Intronic
905325602 1:37149574-37149596 CAATGTCAGAGGAAATGGACTGG + Intergenic
905702052 1:40024454-40024476 CAAAGAAAGCAGAAGTGGCCAGG - Intergenic
907047991 1:51311708-51311730 CAACATGAGAAGAAGTGGTCTGG - Intronic
907340631 1:53733202-53733224 CACTGTAAAAATAAGTGTGCTGG + Intronic
909306949 1:74093648-74093670 GAATGTAAGAAGACCAGGGCTGG + Intronic
909591161 1:77351095-77351117 CAATAAAAGAATAACTGGGCCGG + Intronic
909635200 1:77809944-77809966 CACTGTAAGAAGAGGTATGCAGG + Intronic
915359312 1:155276644-155276666 GAATGGAAGAAGAATTGGCCTGG + Intronic
916224098 1:162472813-162472835 CAATGTAATAAAAACTCGGCCGG + Intergenic
916889486 1:169102638-169102660 CAATGGAAGACAAAGAGGGCTGG - Intergenic
917631217 1:176893284-176893306 TAAGGGAAGAAGAAGAGGGCTGG + Intronic
918979050 1:191531130-191531152 CAGTATTAAAAGAAGTGGGCTGG + Intergenic
919920150 1:202162527-202162549 CAGGGGAAGAAGGAGTGGGCAGG - Intergenic
920280251 1:204837960-204837982 TAATGAAAGAAGCAGTGTGCTGG - Intronic
922121052 1:222668974-222668996 CACTGTAAGAAGAGGTATGCAGG + Exonic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
923662360 1:235969270-235969292 CATTGTAAGAATATGTGGGGTGG + Intergenic
1066321455 10:34307481-34307503 TAATGTCAGCAGATGTGGGCAGG + Intronic
1066572526 10:36789172-36789194 CAATTAAAGAAAAATTGGGCCGG + Intergenic
1067984035 10:51121989-51122011 CAATACAAGAAGCAGAGGGCTGG - Intronic
1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG + Intronic
1070006967 10:72433724-72433746 CAATGAAAGAAGTTGTAGGCTGG - Intronic
1070985310 10:80684609-80684631 CAATGTAAGAAGGACAGGGCTGG - Intergenic
1071178539 10:82956009-82956031 AAATGGAAGCAGAATTGGGCTGG - Intronic
1072965219 10:99966320-99966342 CAAAGGAAGAGGATGTGGGCAGG - Intronic
1073434284 10:103506855-103506877 AAAAGAAAGCAGAAGTGGGCCGG - Intronic
1073703832 10:105960022-105960044 CAATGTAATAAGGAATGTGCTGG - Intergenic
1074962418 10:118459262-118459284 CAATATAAGCAAAAGTGGACAGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1077744798 11:4890569-4890591 CAATTTCAGAAGAATTGGGAAGG + Intronic
1078080267 11:8199380-8199402 CAAGGTATGAACCAGTGGGCTGG - Intergenic
1078622044 11:12917206-12917228 CAATGTGAGAAGGATTCGGCTGG + Intronic
1078777151 11:14404064-14404086 CTATTTAAAAAGAAGAGGGCAGG - Intergenic
1079478561 11:20857523-20857545 AAATGTGAGAGGCAGTGGGCAGG + Intronic
1081242274 11:40721652-40721674 CAAAGTAAGAATGATTGGGCTGG + Intronic
1085413228 11:76303932-76303954 CACAGTAAGAAGATGTGGGCTGG + Intergenic
1085732540 11:79011833-79011855 AAAAGTAAGAAGAGATGGGCAGG - Intronic
1088300782 11:108356237-108356259 TCATGTAAGAAAAAGAGGGCTGG + Intronic
1089373099 11:117975511-117975533 AAATGTAAGAAATGGTGGGCTGG - Intergenic
1090020889 11:123127416-123127438 CATTATAAAAAGAGGTGGGCTGG - Intronic
1091952902 12:4609720-4609742 CAATGTAGGATGAAGTGGGAGGG + Intronic
1092987275 12:13857858-13857880 CGAAGGAAGAAGAAGTGGGTTGG - Intronic
1094565281 12:31592812-31592834 AAATATAAGAAGAATTGGCCGGG + Intergenic
1094727383 12:33133999-33134021 AAGGGTAAGAAGAAGAGGGCAGG + Intergenic
1095512863 12:42972983-42973005 AAATGAAAGAATAAGTGTGCAGG + Intergenic
1100401220 12:94231825-94231847 AAATGGAAGGAGAAGTGGTCAGG - Intronic
1101715345 12:107306768-107306790 AAAGGTAAGAAGAAATGGGATGG + Intergenic
1103006443 12:117424175-117424197 AAAAGTAGGAAGAAGTGGGGGGG + Intronic
1103773522 12:123347829-123347851 CTATAAAAGAAGAAATGGGCTGG - Intronic
1104190739 12:126479918-126479940 CAATTTAAGAGGAAGGGGGTCGG - Intergenic
1104609842 12:130219135-130219157 CAATGCAGGAAGAAGTGAGATGG + Intergenic
1106760859 13:32866231-32866253 CAATGTAAGAATAAATGTTCAGG + Intergenic
1107796788 13:44061250-44061272 CAAAGAACAAAGAAGTGGGCAGG + Intergenic
1108464881 13:50705460-50705482 CAATAGAAGAAGGATTGGGCCGG - Intronic
1109639053 13:65162943-65162965 GAATGGGAGAAGAACTGGGCTGG + Intergenic
1109674629 13:65659028-65659050 TAATGCAAGAATAAGTGTGCAGG - Intergenic
1111622765 13:90745679-90745701 CAATATAAAAAGAGGTGGTCAGG - Intergenic
1111681848 13:91451910-91451932 CATTTTAAGAAAATGTGGGCTGG - Intronic
1112661492 13:101514179-101514201 CATTGTATGAAGAAGTGTGTTGG + Intronic
1112696454 13:101954294-101954316 CAATGTATGAGGCACTGGGCGGG + Intronic
1113135310 13:107082389-107082411 CAATGTTAGAATAAGTGGGATGG + Intergenic
1113307103 13:109090534-109090556 GAATGCAAGAAGGGGTGGGCAGG + Intronic
1113322116 13:109244125-109244147 AAATGTAAAATGGAGTGGGCTGG + Intergenic
1114454000 14:22843867-22843889 CAAGGTGAGAAGAAGTGGGCTGG + Exonic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114833593 14:26176072-26176094 CAAAGTAAGAAGATGGGGGAAGG + Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115532293 14:34338570-34338592 CAAAGTGAAAAGAAGTGGGTGGG + Intronic
1115657525 14:35458308-35458330 CAATATAAAAAGATGTAGGCTGG - Intergenic
1116508482 14:45714790-45714812 CTATGTAAGAAGAAGCGAGGAGG - Intergenic
1117297186 14:54391193-54391215 CATTTTAAGAAGAGCTGGGCTGG - Intergenic
1117683834 14:58232708-58232730 CAATTTAAGAAAAAGTCAGCTGG - Intronic
1118425144 14:65652333-65652355 CAATATAAGAGGAAGTTGGCTGG + Intronic
1119179235 14:72593812-72593834 CATTCTAAGAAGAGGTGGGGTGG - Intergenic
1119704028 14:76773061-76773083 GAATGTGAGAAGGAGGGGGCAGG - Intronic
1122013553 14:98773752-98773774 CAATGTAGAAAGAGGTGGGAAGG - Intergenic
1122110740 14:99499332-99499354 CAGTGTAAAAAAAACTGGGCTGG - Intronic
1125130132 15:36274922-36274944 CAATTTAAAAAGAAGTGGTTTGG - Intergenic
1126968031 15:54077665-54077687 CAATTTGAGAAGTAGTTGGCCGG - Intronic
1127704134 15:61530666-61530688 AAATGTAAAAACAAATGGGCTGG - Intergenic
1127893364 15:63274394-63274416 CAATGCAAGAGGAAGTGGCTGGG - Intergenic
1130014946 15:80179482-80179504 CAATGTGAGAAGCTGTGGCCTGG + Intronic
1130168725 15:81489310-81489332 AGATTTAAAAAGAAGTGGGCAGG - Intergenic
1130220497 15:82015344-82015366 CCTTCTAAGAAGCAGTGGGCTGG - Intergenic
1134284789 16:12851306-12851328 ATATGTAATAAGAAGTGTGCTGG - Intergenic
1134455556 16:14392858-14392880 TACTGTAAGAAGAATGGGGCCGG + Intergenic
1139514316 16:67444398-67444420 AAAGGTAAGCAGCAGTGGGCAGG + Intronic
1139630959 16:68231653-68231675 CAGTGTAGGAAGGAGTGGGCCGG + Exonic
1140025077 16:71280832-71280854 CAATAAAAGAATAAGGGGGCAGG + Intergenic
1141911712 16:87064671-87064693 GAAAGTAAGCAGAAGCGGGCTGG - Intergenic
1141929799 16:87194440-87194462 CACAGAAATAAGAAGTGGGCTGG + Intronic
1144161879 17:12568130-12568152 CAATGCAAGAAGGAATAGGCAGG + Intergenic
1145873782 17:28299943-28299965 AAATGTAACACAAAGTGGGCCGG + Intergenic
1147011221 17:37450014-37450036 CACTGGAAGAAGAAGTGTCCTGG + Intronic
1147853474 17:43460165-43460187 CTATTTTAGAAGCAGTGGGCAGG - Intergenic
1148200455 17:45746725-45746747 CAAGGAAAGAAGAAGTGTGGTGG - Intergenic
1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG + Intronic
1150714013 17:67556179-67556201 CAATGTGAAAAGAAGGGTGCTGG + Intronic
1151225665 17:72646405-72646427 CTATGTAAGAAGGAGTAGGCTGG + Exonic
1151689694 17:75674590-75674612 CAATTTAAAAAAATGTGGGCTGG - Intronic
1152001923 17:77651910-77651932 CAATGTATGAGGAAAGGGGCAGG + Intergenic
1152528171 17:80901630-80901652 AAATGAAAGAAGAAATTGGCTGG - Intronic
1153708718 18:7775199-7775221 AAATGTAGGAAGGAGAGGGCAGG - Intronic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1162207571 19:9067224-9067246 GAATTAAAGAATAAGTGGGCTGG + Intergenic
1165694013 19:37886537-37886559 CATTGGAAGAAGAGGTGGACAGG - Exonic
1166229444 19:41417345-41417367 CCATGTGAGAAGGACTGGGCAGG - Intronic
926294681 2:11560402-11560424 CAAAGAAATAAGAAGCGGGCCGG + Intronic
926438120 2:12858208-12858230 TAATGTGATAAGAAGTGGCCAGG + Intergenic
927410815 2:22824230-22824252 CAATTTGAGAAGAAGGGGGAAGG + Intergenic
929874380 2:45784355-45784377 CAAAAAAGGAAGAAGTGGGCTGG + Intronic
932289797 2:70567177-70567199 CAAGATAAAAAGAAGTGGGAAGG - Intergenic
934885369 2:98019989-98020011 AAATGTAAGGAGAGGTGGGGTGG - Intergenic
936075352 2:109398210-109398232 CCATATCAGAAGACGTGGGCTGG - Intronic
937201952 2:120209593-120209615 CAAGGGGATAAGAAGTGGGCAGG + Intergenic
938386382 2:130870154-130870176 CCATGGAAGAAACAGTGGGCAGG - Intronic
938661226 2:133489082-133489104 CAATCTCAGAAAAAGTCGGCAGG + Intronic
940671492 2:156674905-156674927 CAATTTAAGAAAATCTGGGCTGG + Intergenic
941055464 2:160782987-160783009 AAATGCACTAAGAAGTGGGCAGG + Intergenic
942600358 2:177634682-177634704 GAGTGTAAGAATAAGTCGGCCGG - Intronic
942821899 2:180124661-180124683 CCAGGTAAGAAGAAGTGGTATGG - Intergenic
943202321 2:184844177-184844199 CAATTTAAGAAGAAATGGGGGGG - Intronic
944229591 2:197379232-197379254 CAATGGGAGATGAAGTGGCCCGG - Intergenic
947661105 2:231869134-231869156 CATAGTAAGAACAAGTGGGCCGG + Intergenic
1168832496 20:854352-854374 CTATGTAGGAAGAAGGGAGCTGG + Intronic
1170272098 20:14538679-14538701 CAATGTACGAAGGAGTGAGTGGG - Intronic
1179938348 21:44620071-44620093 GAATGTAAAAAGCAGTGGGACGG + Intronic
1183124094 22:35758734-35758756 CAAGGTATGTTGAAGTGGGCAGG - Intronic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
950055882 3:10024091-10024113 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
952219454 3:31310229-31310251 CAAAGTAAGAAGAAATAGGCTGG - Intergenic
953947481 3:47162607-47162629 CAATGTGAGAAGATGTGGCAAGG + Intronic
954330781 3:49889154-49889176 CAAGGGAAGAAGGACTGGGCAGG - Intronic
955906610 3:63814375-63814397 AAATGTGAGAAGCAGTGGGTGGG - Intergenic
956722618 3:72131698-72131720 CAATGCAAGAAGAGGAGGGGAGG + Intergenic
956894907 3:73649604-73649626 AAATGAAAGAAGAAGTGGGTAGG - Intergenic
957501420 3:81062911-81062933 CAAGGTAAAAATATGTGGGCTGG - Intergenic
961717612 3:128869506-128869528 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
962439861 3:135403549-135403571 CACTGTAATGAGCAGTGGGCTGG - Intergenic
962526339 3:136241168-136241190 CAAAATCTGAAGAAGTGGGCTGG + Intergenic
962590320 3:136883215-136883237 ACATGTAATAAGAAGTAGGCTGG - Intronic
962663647 3:137631469-137631491 CACTGTATGTAGAAGTGGCCAGG + Intergenic
962681078 3:137801064-137801086 CAATGGAAGAGGAAGAGGGTTGG + Intergenic
963145618 3:141990759-141990781 CAATTTAAGATGGACTGGGCTGG + Intronic
963166739 3:142211951-142211973 GAATGTAAGGAGGAATGGGCTGG - Intronic
963174043 3:142280246-142280268 AAATGGGAGAAGAAGTGGGAAGG - Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
964415035 3:156438314-156438336 CAATGCAAGAAGCAAGGGGCAGG + Intronic
965484135 3:169257923-169257945 CAGTGTAAGAAAAAGTAGCCGGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
966996428 3:185284781-185284803 AAATGTGATAAAAAGTGGGCAGG + Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
971770404 4:30888172-30888194 CATTTTAAAAAGAAATGGGCCGG - Intronic
972035287 4:34512324-34512346 CTAAGTAGGAAGGAGTGGGCGGG + Intergenic
975083209 4:70305368-70305390 CAATGTAACAAGAAGTAGATAGG + Intergenic
976202036 4:82588482-82588504 AAAGGTCAGAAGAAGTGAGCTGG + Intergenic
980185738 4:129458754-129458776 AAATGTAAGAGGAAATGGGAAGG + Intergenic
983128653 4:163986559-163986581 TAAAGAAAGAAGAAGTTGGCCGG - Intronic
983337173 4:166411756-166411778 CAAGCTATGAAGAAGTGGGAAGG - Intergenic
984203855 4:176762236-176762258 CAATGTAAGAATATGGGGGGAGG + Intronic
984455751 4:179965985-179966007 GAATGGAAGAAAAAGTGGGCTGG + Intergenic
987257345 5:16169609-16169631 TGATGTAAGAAGAGGTGGACTGG - Intronic
988606418 5:32682364-32682386 AAATGTAGAAAGAAGTGGCCTGG + Intergenic
988816083 5:34836387-34836409 CACCTTAAGAAAAAGTGGGCTGG - Intergenic
988937656 5:36104335-36104357 AGATGTAAAAAGAAGGGGGCAGG + Intronic
989193574 5:38694220-38694242 CAATCTACGAAGGAGAGGGCTGG + Intergenic
990383791 5:55239809-55239831 CTATTTTAGAAGAATTGGGCCGG + Intergenic
993705479 5:91165011-91165033 CAATATAAGACGAAGGGGGTAGG - Intergenic
997179306 5:131811893-131811915 TACTTTAAGAAGAAGTTGGCCGG - Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997332029 5:133071034-133071056 AAATACAGGAAGAAGTGGGCAGG - Intronic
998049008 5:139015664-139015686 CAAGGCAGGAAGAAGTGGGTAGG + Intronic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1000289676 5:159858735-159858757 CAATGACAGAAGAAGGTGGCAGG + Intergenic
1000652349 5:163832693-163832715 CACTGTAAGAAGAATTGTCCTGG - Intergenic
1001346874 5:170910568-170910590 TAATATAAAAAGAAGTGGGTAGG - Intronic
1001445587 5:171780231-171780253 CAATGTGAGAATGAGTTGGCGGG - Intergenic
1001567699 5:172711190-172711212 CACTGTAAGAAAGAGTGTGCAGG - Intergenic
1002335395 5:178474272-178474294 CAAGGAAAGAAGAACTAGGCGGG - Intronic
1003328424 6:5110019-5110041 CACTTTAAAAAGAAGGGGGCAGG - Intronic
1003680142 6:8244789-8244811 GAACGAAAGAATAAGTGGGCTGG - Intergenic
1004788744 6:18999396-18999418 CAATGTAAGAAGATGGATGCTGG - Intergenic
1005322902 6:24672847-24672869 CTATCGAAGAAGAGGTGGGCAGG - Intronic
1005904179 6:30246487-30246509 CAATATAAGAAAAAATAGGCTGG - Intergenic
1008975556 6:57421693-57421715 CAACATAAGAGGAAGTGGGATGG - Intronic
1009400741 6:63253017-63253039 AAATGTAAGAGAAACTGGGCAGG - Intergenic
1009698933 6:67149108-67149130 CAATGAAAGATGAGGTGGGGTGG + Intergenic
1010547146 6:77172808-77172830 CCCTGTAAGCAGATGTGGGCAGG + Intergenic
1010853785 6:80812422-80812444 CAAAGTAATTAGAGGTGGGCAGG + Intergenic
1010888409 6:81272664-81272686 CAATGCAGGAAGAAGTAGGTGGG - Intergenic
1012306401 6:97663377-97663399 CTCTGTGAGAAGATGTGGGCTGG + Intergenic
1012358145 6:98341873-98341895 CAATTTAACAAGAAGTGAGCAGG - Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1015897934 6:138035019-138035041 CAATCTGAGAAGATGTGGGCAGG - Intergenic
1016105227 6:140153881-140153903 CCATGAAAGGAGAAGTGAGCTGG + Intergenic
1016668545 6:146673025-146673047 CTATATAAGAAAAACTGGGCTGG - Intronic
1016772405 6:147866428-147866450 CAATGTAATGAAAAGTGGGACGG + Intergenic
1017760564 6:157564946-157564968 CAAAGTAAGAATATTTGGGCCGG + Intronic
1018546197 6:164939024-164939046 CAATGTTATAAGAGGTGGGAGGG + Intergenic
1018946515 6:168350228-168350250 CAATTCAAGAAGAGGTGGGTGGG + Intergenic
1020986884 7:15147160-15147182 CAACCTTAGAAGAAGTGGGAGGG + Intergenic
1020991821 7:15207482-15207504 CAATGTAAATAGAAGTGTGTCGG - Intronic
1021290001 7:18831599-18831621 GAAAGTAAGAATATGTGGGCTGG - Intronic
1021593995 7:22295145-22295167 CTATGAAAAAAGAAGTGGGATGG + Intronic
1021888657 7:25165641-25165663 CAATGTAAGAAAATGCGGCCAGG - Intronic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1028713965 7:93942635-93942657 CAATGTAACACAAAGTTGGCAGG - Intergenic
1029710556 7:102296752-102296774 GAATGTAAGTAGAAGCGTGCAGG + Intronic
1030397042 7:108999004-108999026 CAATGGGAGAAGAAGTGGAAAGG - Intergenic
1030576891 7:111298868-111298890 CAATGCAAGAAGAAGAATGCAGG + Intronic
1031660113 7:124413364-124413386 CAATGCAGGAAGAAGTGCTCTGG - Intergenic
1032412522 7:131707556-131707578 AAGAGTAAGAAGAGGTGGGCTGG - Intergenic
1034533874 7:151714651-151714673 TAAATTAAGAATAAGTGGGCCGG + Intronic
1036694827 8:10967624-10967646 CAAGGTAACAAGAGGTGGGGAGG + Intronic
1038717935 8:30008787-30008809 CCATGTAAGAAGTAGAGGACTGG + Intergenic
1038981287 8:32762166-32762188 CAATCTATGAAAAAGTAGGCAGG + Intronic
1039513597 8:38111680-38111702 AAATCTAAGAAGAAATGGGCCGG - Intronic
1039661835 8:39476737-39476759 CATTGTAGGGAGAATTGGGCAGG - Intergenic
1039954687 8:42197878-42197900 CAATGCAAAACCAAGTGGGCTGG + Intronic
1042695610 8:71551586-71551608 TAATGTAATAAGAAATTGGCTGG - Intronic
1042898127 8:73693175-73693197 TAATTTAAAAAAAAGTGGGCTGG + Intronic
1043449636 8:80353571-80353593 CAAAATAAGATGAAATGGGCCGG - Intergenic
1048373929 8:133805304-133805326 TAATGTAAGAAGAAACAGGCAGG - Intergenic
1049631513 8:143660996-143661018 CATTGTAAGAAACTGTGGGCTGG - Intergenic
1049678625 8:143905016-143905038 GCATGTAAGTAAAAGTGGGCAGG + Intergenic
1051390617 9:16559334-16559356 CAATGGAAGAAGAATTGGCTTGG - Intronic
1051873760 9:21768940-21768962 CAATGTGAGAAGGACTCGGCTGG + Intergenic
1052332645 9:27285436-27285458 CAATGAAAGAAAAACTAGGCCGG - Intronic
1053042741 9:34888758-34888780 CAGTATAAGAAGCAGTGGCCAGG - Intergenic
1053151266 9:35744722-35744744 CAATGTGAGTGGAAGGGGGCAGG + Intronic
1055022541 9:71685580-71685602 CAATGTGAGAGGAAGTGTGTTGG - Intronic
1057500492 9:95593822-95593844 CTATGTCAGAAGCTGTGGGCTGG + Intergenic
1058427147 9:104884937-104884959 TACGGTAAGATGAAGTGGGCTGG + Intronic
1058479414 9:105375961-105375983 TAATGTAAAGAGAAATGGGCGGG - Intronic
1059020205 9:110568224-110568246 TTATGGAAGAAGAAGTGAGCTGG - Intronic
1060755421 9:126208878-126208900 CAATTTAAGAAAAAGAGAGCAGG + Intergenic
1061768389 9:132897685-132897707 CAATGTAAGAAGGACTGAGAAGG + Intronic
1062304947 9:135900395-135900417 CACTCTAAGAAAAAGAGGGCCGG + Intronic
1187372585 X:18722830-18722852 CCATGTAAGAAGGGGTGGTCAGG + Intronic
1187847411 X:23555073-23555095 TGAAGTAAGAAGATGTGGGCTGG - Intergenic
1187997671 X:24946199-24946221 CAAGGTAAGTAGAAGAGGACAGG - Intronic
1190425039 X:50327966-50327988 CAATGTGAGAACAACTTGGCTGG + Intronic
1191150167 X:57211937-57211959 AAATTTAAAAATAAGTGGGCTGG + Intergenic
1192467481 X:71367499-71367521 GAATGTAAGAAGCACTTGGCAGG + Exonic
1193378345 X:80788265-80788287 CAATTTAAAAAGATGGGGGCAGG + Intronic
1194697641 X:97074576-97074598 CCATTTAAGAAAAAGTTGGCAGG + Intronic
1195890642 X:109689699-109689721 CAATTTTAAAAGAAGTTGGCTGG - Intronic
1196153710 X:112404180-112404202 CAATGTCATAAGAAGTGGTGGGG - Intergenic
1196804206 X:119570377-119570399 CAATTTAAAGAAAAGTGGGCTGG - Intergenic
1196821823 X:119707695-119707717 AAATGTAAAAAGAAGGGAGCAGG - Intergenic
1198720390 X:139611969-139611991 AAAGGGAAGAAGAAGTGGGCAGG + Intronic
1200492582 Y:3845747-3845769 CAATGTCAGAAGACTTGGGTGGG + Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic