ID: 1183364100

View in Genome Browser
Species Human (GRCh38)
Location 22:37398164-37398186
Sequence CGCCCACAGCTGCCTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 302}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183364100_1183364104 -5 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364104 22:37398182-37398204 GGGCGGTGGAGCTAGCGCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 100
1183364100_1183364108 15 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364108 22:37398202-37398224 AGGCCTGGGTAGACCGTGCCGGG 0: 1
1: 1
2: 1
3: 11
4: 117
1183364100_1183364105 0 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364105 22:37398187-37398209 GTGGAGCTAGCGCTCAGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 133
1183364100_1183364111 25 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364111 22:37398212-37398234 AGACCGTGCCGGGCACATGGAGG 0: 1
1: 0
2: 1
3: 14
4: 149
1183364100_1183364106 1 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364106 22:37398188-37398210 TGGAGCTAGCGCTCAGGCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1183364100_1183364107 14 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364107 22:37398201-37398223 CAGGCCTGGGTAGACCGTGCCGG 0: 1
1: 0
2: 1
3: 5
4: 131
1183364100_1183364110 22 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364110 22:37398209-37398231 GGTAGACCGTGCCGGGCACATGG 0: 1
1: 0
2: 1
3: 4
4: 65
1183364100_1183364112 26 Left 1183364100 22:37398164-37398186 CCAGAGCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1183364112 22:37398213-37398235 GACCGTGCCGGGCACATGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183364100 Original CRISPR CGCCCACAGCTGCCTGGCTC TGG (reversed) Intronic
900237084 1:1598063-1598085 CGCCCACCCCTGCGTGGCGCCGG - Exonic
900548569 1:3242113-3242135 AGCCCACAGGGGCCTGGCGCTGG - Intronic
901176285 1:7301854-7301876 AGCCCAGAGCAGCTTGGCTCAGG - Intronic
901473369 1:9472918-9472940 CTGCCACAGCTGCCTGGCCAGGG - Intergenic
901644341 1:10708673-10708695 AGCCCAGGGCTGCCGGGCTCAGG - Intronic
901727926 1:11256926-11256948 CACTCACAGCTGCATGTCTCCGG + Exonic
902210600 1:14901790-14901812 CCCCCACAGCTGCCTCTCTCTGG + Intronic
902451405 1:16499059-16499081 CGCCCGCCGCTGCCCGGCACCGG - Intergenic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
902518870 1:17004763-17004785 CCCCAACTGCCGCCTGGCTCCGG + Exonic
902883870 1:19390972-19390994 GGCCCGTAGCTGCGTGGCTCCGG - Intronic
903446969 1:23428706-23428728 CCAACACAGCTGCCTGGCTGGGG - Exonic
903745164 1:25581824-25581846 TGCCCCCTCCTGCCTGGCTCTGG - Intergenic
904464071 1:30697733-30697755 CGGCCAAATTTGCCTGGCTCTGG - Intergenic
905530194 1:38672153-38672175 CGGCCACAGCTGGTTGGCCCTGG - Intergenic
906495747 1:46302901-46302923 CCCGCACCGCGGCCTGGCTCGGG - Intronic
909395828 1:75169716-75169738 AGCCCACAGCTCCATTGCTCTGG + Intergenic
913138251 1:115913587-115913609 CTACTACAGCTGCCTGGCTGAGG + Intergenic
914936376 1:151984414-151984436 CACCCTCAGCTTCCTGGCTGTGG + Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
920313444 1:205061756-205061778 CGCCCTCTGCTGTCTGGCACAGG + Intronic
920660526 1:207910853-207910875 CGCCCACAGCTGCTTCCCCCCGG - Intronic
924073205 1:240304808-240304830 CGTGCACAGCTGCCTGCCACAGG + Intronic
1063612681 10:7576420-7576442 CCCCCACACCTGGCTGGCACAGG + Intronic
1065833203 10:29633287-29633309 AGCACACATCTGCCTGGCACTGG + Intronic
1065839870 10:29693615-29693637 TGCACACAGCGGCTTGGCTCTGG - Intronic
1066658972 10:37721104-37721126 TCCCCACAGGAGCCTGGCTCTGG - Intergenic
1067177459 10:43960115-43960137 GGCCCCCAGCTGCTTGGCTGAGG + Intergenic
1069676838 10:70254824-70254846 TGCCCACCACTGCCTGGCTCTGG + Exonic
1071877196 10:89854136-89854158 CGCCCACCACAGCCGGGCTCAGG - Intergenic
1072661600 10:97366794-97366816 CCTCCACGGCAGCCTGGCTCAGG + Exonic
1074535867 10:114328385-114328407 CCTGCACAGCTGCCTGGCCCTGG - Intronic
1074778606 10:116784714-116784736 CGGCCCCAGCTGACTGGCTGAGG + Intergenic
1076024536 10:127100827-127100849 CTCCCACTGCAGCCTGACTCCGG - Intronic
1076747987 10:132523956-132523978 CACCCACAGCAGACTGGCCCCGG + Intergenic
1076889697 10:133277473-133277495 AGCCCACCGTGGCCTGGCTCCGG + Intergenic
1076995707 11:296579-296601 TGCCCACATCACCCTGGCTCTGG - Intergenic
1077514860 11:2995380-2995402 CGCCCCCAGCTAAGTGGCTCTGG + Intergenic
1077540293 11:3143405-3143427 CGCTCCCAGCAGCATGGCTCAGG + Intronic
1078520122 11:12056152-12056174 TGGCCTCAGCTGCCTGCCTCTGG - Intergenic
1078639999 11:13085442-13085464 GTCCCACAGCTGCCTGCCCCGGG - Intergenic
1078905956 11:15687999-15688021 ATCCCACAGCTGCCAGCCTCAGG + Intergenic
1079529051 11:21427032-21427054 CACCACCAGCTGCCTGGCTGTGG - Intronic
1080054079 11:27887156-27887178 CCTCTCCAGCTGCCTGGCTCAGG - Intergenic
1081691072 11:45079069-45079091 CCCCTGCAGCAGCCTGGCTCTGG - Intergenic
1083572893 11:63769360-63769382 CCCCCACCCCTGGCTGGCTCGGG - Intergenic
1084083186 11:66842691-66842713 CGCCCACAGCTGCAGGGTTTTGG + Intronic
1084559184 11:69893139-69893161 TGGCCACAGGTGCCAGGCTCGGG - Intergenic
1085254319 11:75163928-75163950 CGCCCACCTCTGCCTGCCTCCGG + Intronic
1085272444 11:75278308-75278330 CTCCACCAGCTGCCTGCCTCAGG - Intronic
1085444811 11:76593218-76593240 CGCCCTCAGCAGCTTGGATCTGG + Intergenic
1085465773 11:76722285-76722307 CACCCACTGCTGCCAGGCTCTGG + Intergenic
1085674859 11:78506977-78506999 CGTGCACAGCTGCCTCCCTCAGG - Intronic
1089098638 11:115940959-115940981 CATCAACAGCTGCCTGTCTCGGG + Intergenic
1089768556 11:120786101-120786123 CTCTCACTGCTGCCTTGCTCTGG + Intronic
1089966070 11:122655930-122655952 CGCCGCCTCCTGCCTGGCTCTGG + Exonic
1090014791 11:123076338-123076360 TGCCTATAACTGCCTGGCTCAGG - Intronic
1091305140 11:134531799-134531821 CGCCTACAGCGGCCTCACTCAGG + Intergenic
1091305769 11:134535250-134535272 ACCCCTCTGCTGCCTGGCTCCGG - Intergenic
1091488972 12:916545-916567 CACGCACGGCTGGCTGGCTCTGG + Intronic
1092187673 12:6493245-6493267 CGCCCACAGCTGCCTGGGTAAGG - Exonic
1096575783 12:52552084-52552106 TGGCCACAGCTGAGTGGCTCTGG - Intronic
1096725327 12:53556755-53556777 CACCCACAGCCCCCTGGCTTAGG - Intronic
1097261097 12:57720705-57720727 TTCCCCCAGCTGCCTGGCCCAGG + Intronic
1101226591 12:102694008-102694030 CCCCCACAGCGCGCTGGCTCTGG - Intergenic
1101467042 12:104958823-104958845 CGCCTACACCTGCCTGGCACGGG - Intergenic
1101775443 12:107789145-107789167 CTCCCTCAGATGCCTGGCTAAGG + Intergenic
1102457033 12:113077335-113077357 CGCCCACCCTTGCCTGGCTGTGG + Intronic
1103083890 12:118046607-118046629 TGTCCAGACCTGCCTGGCTCTGG + Intronic
1103896730 12:124278111-124278133 AGGCCACACTTGCCTGGCTCAGG - Intronic
1104789533 12:131473058-131473080 AGCCCACAGCTGCCCTGCCCAGG - Intergenic
1104820709 12:131675761-131675783 AGCCCACACCTGCCTCGCTGAGG - Intergenic
1104898005 12:132173661-132173683 CCCGCACACCTGCCTGGGTCCGG - Intergenic
1104965373 12:132506690-132506712 CGTCCACAGCTGCCTGGGATGGG + Intronic
1107869558 13:44734571-44734593 AAACCACAGCTGCCTGGCTTGGG + Intergenic
1108845669 13:54676709-54676731 CCTCCACAGCTGCCGGGCCCAGG - Intergenic
1109818290 13:67617296-67617318 AGCCCACAGATGCCTGGCATAGG - Intergenic
1113448451 13:110388264-110388286 TGCCGGCAGCTGCCTGGCTGCGG - Intronic
1113697584 13:112357075-112357097 CGCCGAGAGCTGCCTTGCACTGG - Intergenic
1113898036 13:113778001-113778023 AGCCCACAGCTGCCTGTGCCAGG + Intronic
1113969463 13:114177363-114177385 CACCCACAGCTGCCACCCTCAGG - Intergenic
1114696427 14:24631352-24631374 GGCCCCCAGCTGCCAAGCTCTGG + Intronic
1115376400 14:32681758-32681780 CAGCCACAGCTTCTTGGCTCAGG + Intronic
1117910877 14:60637534-60637556 CGTCCACAGCTGCAGGGGTCCGG - Intergenic
1118617843 14:67587150-67587172 TTCCCACAGCTGGCAGGCTCCGG - Exonic
1118775111 14:68969006-68969028 CACCCAAAGGTGCCTGGCTGGGG - Intronic
1121253066 14:92513839-92513861 CGCCCGCATGTCCCTGGCTCTGG - Exonic
1121505334 14:94472871-94472893 TCCTCAAAGCTGCCTGGCTCTGG - Intronic
1122113981 14:99518581-99518603 CGCCCCCTGCTGTCTGGCGCGGG - Intronic
1122178766 14:99939577-99939599 CCCCCACGGCTCCCTTGCTCCGG + Intronic
1123031850 14:105455719-105455741 AGCCCACAGCTGCCTGGAGGAGG - Intronic
1124029972 15:26001598-26001620 GGCCCTCAGCGGCCTGGTTCAGG + Intergenic
1124221891 15:27856452-27856474 CCCCCACAGCTTCCTGCCACAGG - Intronic
1124251824 15:28111711-28111733 AGCGCTCTGCTGCCTGGCTCAGG + Exonic
1124940070 15:34209897-34209919 CGCCCGCAGCTGCCCTGCCCTGG - Intronic
1125424826 15:39538148-39538170 CGCCTCCAGCAACCTGGCTCAGG - Intergenic
1127051633 15:55089914-55089936 TGCCCACAGCTGCCTGCCCCGGG + Intergenic
1127284956 15:57524423-57524445 TGCCCACACCTGGCTGACTCAGG + Intronic
1128308440 15:66615292-66615314 CCCCCTCCTCTGCCTGGCTCCGG - Intronic
1128382349 15:67122341-67122363 CACCCACAGCTGACAGGGTCTGG - Intronic
1128740306 15:70079106-70079128 TGACCACAGCTGGGTGGCTCAGG + Intronic
1128747652 15:70125659-70125681 AGACCACAGATGCCTGGCACAGG - Intergenic
1129170920 15:73807367-73807389 CGCCCACACCTCCCAGGCTCAGG - Intergenic
1129453008 15:75661204-75661226 TGCCCACCGCATCCTGGCTCCGG - Exonic
1129699501 15:77759429-77759451 TGCCCACAGCTTGCTGCCTCAGG - Intronic
1130785518 15:87091643-87091665 CGCCTACAGTGGGCTGGCTCTGG + Intergenic
1131248291 15:90814642-90814664 ACCCCACAGCTGCCTTGCTCTGG + Intronic
1132398054 15:101489028-101489050 CGCGGACACCTGCCGGGCTCCGG - Intronic
1132805103 16:1771655-1771677 CCCCCACGGCTGCCGGGTTCCGG - Exonic
1132882829 16:2170030-2170052 GGGCCACAGGTGCCTGCCTCTGG - Intronic
1136277362 16:29186932-29186954 CGCCCCCAGCACCCTGGCTCCGG + Intergenic
1136552708 16:30990097-30990119 GGCCCACAGCTGCCCATCTCTGG - Exonic
1138423037 16:56912257-56912279 TGGCCACAGCTGCCCAGCTCTGG - Intronic
1139846475 16:69924916-69924938 CGCCCAGAGCTTCCTGGCTGGGG - Intronic
1140737057 16:77907795-77907817 AGACCACAACTGCCTAGCTCAGG - Intronic
1141531806 16:84651414-84651436 CTCCCCCAGTAGCCTGGCTCTGG - Intronic
1141711062 16:85699216-85699238 GGCCCACAGCAACCTGGCTGAGG - Intronic
1141750952 16:85957479-85957501 CACCCACCGCTGCTTGGCTGGGG + Intergenic
1141851641 16:86650197-86650219 CTCCCACAGCTGCTGGGCTTTGG + Intergenic
1142120603 16:88384730-88384752 TGCCCAGAGCTGCCAGCCTCGGG - Intergenic
1142425699 16:90001218-90001240 CACCCACAGGTGCATGGCTGAGG + Intergenic
1142617645 17:1145790-1145812 AGCCCGGAGCTGCGTGGCTCTGG - Intronic
1142716634 17:1750679-1750701 CAGCCACAGCTGTCTGGCCCGGG - Intronic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1146275441 17:31513002-31513024 CGCCCACCCAAGCCTGGCTCTGG - Intronic
1146398413 17:32486462-32486484 CGCCCGCAGCTGCCGGCCGCGGG - Intergenic
1146793459 17:35765749-35765771 CACACACAGCTGCCTAGCCCTGG + Intronic
1146884809 17:36463935-36463957 CTCTCCCAGCTGCCTGGCCCGGG + Intergenic
1147240606 17:39088098-39088120 CTCCCTCCTCTGCCTGGCTCAGG + Intronic
1148335912 17:46841435-46841457 CGCCCAGAGGTGCCTGGGACAGG - Intronic
1148460250 17:47835657-47835679 CCCCTACAGCTTCCTGTCTCTGG + Exonic
1148734041 17:49854609-49854631 TGCCCAAAGGTGCCTGGCTGAGG + Intergenic
1150484488 17:65534238-65534260 CCCCCAGAGCTGCCTGACTCTGG - Intronic
1150974977 17:70075169-70075191 CTGCCACAGCTGACTGGCTATGG + Intronic
1151213639 17:72562640-72562662 CGCCCATTCCTGCCTGGCCCCGG - Intergenic
1151334437 17:73431755-73431777 CCCCCACAGGCCCCTGGCTCTGG + Intronic
1152542268 17:80982277-80982299 GACCCACGGCTGCCTGGCCCAGG - Intergenic
1152552423 17:81036199-81036221 CCCCGGCAGCTGCCGGGCTCAGG - Intronic
1152723335 17:81933450-81933472 CGCCCAGGGCTGACTGGCACTGG - Intronic
1152756815 17:82090456-82090478 CGCCGACGGCTGCCTGTCCCAGG - Exonic
1152821412 17:82439573-82439595 CGCCCCCAGCAGCCTGACGCAGG - Intronic
1154011787 18:10580585-10580607 CTCCCACAGTGGCCTGGCCCAGG - Intergenic
1157312082 18:46560143-46560165 AGCCCACCGCTGGCTGGCCCGGG - Intronic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1157495919 18:48157378-48157400 CGCCCACAGTTAGCAGGCTCTGG - Intronic
1157675173 18:49563086-49563108 CCCCCAGAGCTGACTGACTCTGG - Intronic
1158694906 18:59695775-59695797 TGCCCACACCTGACTGTCTCTGG - Intronic
1159946916 18:74450760-74450782 TGGCCACAGCTGCCAGGTTCCGG + Intronic
1160452003 18:78972744-78972766 CGCCCAGAGATGCCTGGCCTGGG - Intergenic
1160751161 19:735318-735340 GGCCCACAGGTGCCTGTGTCCGG + Intronic
1160918458 19:1508535-1508557 CGACCTCAACTGCCTGGCTGAGG - Exonic
1160922201 19:1526269-1526291 CGGGCACAGCTGCCCGGCCCCGG - Intronic
1161212371 19:3074113-3074135 CGCCCCCAGCTGCCGGCCTTGGG + Intergenic
1161332470 19:3694861-3694883 CGCCCAACGCAGCCCGGCTCTGG + Intronic
1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG + Intronic
1161723305 19:5915303-5915325 TGCTCACAGCTGCCAGGCACTGG - Exonic
1161723467 19:5915909-5915931 CGCCCAGAGCTCCCAGCCTCGGG - Exonic
1162768750 19:12936780-12936802 AGCCCACAGGTGCCTGACACAGG + Intergenic
1164608854 19:29618677-29618699 CACCCACAGCTGCCTAGAGCCGG - Intergenic
1164711098 19:30357739-30357761 CGCCCACAGCTGGGAGGCTCAGG - Intronic
1165165264 19:33849555-33849577 GCCCCACAGCTGCCTGCCTATGG + Intergenic
1165543242 19:36509760-36509782 AGCCCTCACCTGCCTTGCTCAGG + Intergenic
1166037941 19:40182809-40182831 CTCACAGAGCTGCTTGGCTCTGG - Intergenic
1166375779 19:42326061-42326083 CGGCCACTGCTGACAGGCTCTGG - Intronic
1167375428 19:49108386-49108408 CGGCGACGGCTACCTGGCTCCGG + Exonic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
925023169 2:587765-587787 CAGACCCAGCTGCCTGGCTCAGG + Intergenic
925164958 2:1710342-1710364 AGCCCCCAGCGGCCTGGGTCTGG - Intronic
927645866 2:24876643-24876665 CGGCCACACCTGCCTGGCCCTGG - Intronic
928116355 2:28547688-28547710 TGCCCACAGGTGCTGGGCTCTGG - Intronic
928455797 2:31420328-31420350 CACGGACACCTGCCTGGCTCTGG + Intergenic
929596474 2:43179309-43179331 GGCCCTCAGCGGCCTGGCTGGGG + Intergenic
929876629 2:45801788-45801810 CACCCACAGCAGCCTGCTTCAGG - Intronic
933772789 2:85754585-85754607 GGCCCCCAGGTGCCTGGCTCTGG - Exonic
935396893 2:102619323-102619345 CACCCACAGTTCGCTGGCTCTGG + Intergenic
936086599 2:109473729-109473751 CACCCACTCCTGCCTGCCTCAGG + Intronic
936108751 2:109647923-109647945 TGCCCACTGAGGCCTGGCTCTGG + Intergenic
938548979 2:132361862-132361884 CGCTCACCGCTGCCTGGTGCTGG - Intergenic
938766153 2:134461770-134461792 GGCCCACTTCAGCCTGGCTCCGG + Intronic
941619356 2:167758829-167758851 GGACCACAGCTGACTGGGTCAGG - Intergenic
942454454 2:176128835-176128857 CGCCTGCAGCTGCCTGGAACCGG + Intergenic
943006864 2:182395647-182395669 CTTGCACAGCAGCCTGGCTCTGG - Intronic
944711086 2:202335841-202335863 AGCCCAGAGCCCCCTGGCTCTGG - Intergenic
946180180 2:217944146-217944168 GGCCCACTGCTGGCTGGCTCCGG - Intronic
947351742 2:229253488-229253510 GGCCCACAGCTTCCAGGTTCTGG - Intronic
947537083 2:230946837-230946859 CAGCCACAGCTGCCTTGCCCTGG - Intronic
948600164 2:239103338-239103360 GGGCCACAGCTGCCAGGGTCTGG + Intronic
948909204 2:240994559-240994581 GGCCCTCAGGTGCCTGGGTCCGG + Intergenic
1168881602 20:1210957-1210979 CCCCCACCCCTGACTGGCTCTGG + Intergenic
1169116505 20:3069651-3069673 TGCAGAGAGCTGCCTGGCTCAGG - Intergenic
1170093432 20:12617693-12617715 AGCCCACAGATGGCTTGCTCAGG - Intergenic
1170159721 20:13298938-13298960 CGCTCACAGCTGTCTGTGTCTGG - Exonic
1170641639 20:18159304-18159326 GGCTCACACCTGCTTGGCTCTGG - Intronic
1171121051 20:22568929-22568951 CGGCCCCGGCTGCCTGGCCCCGG + Intergenic
1172095693 20:32459008-32459030 TGCCCCCGGCTGCCTGGCTGGGG + Intronic
1173790303 20:45823917-45823939 CGGGCACTGGTGCCTGGCTCCGG - Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175211146 20:57356816-57356838 CGCCCACTGCAGCTTGGCACCGG - Intronic
1175928594 20:62482677-62482699 CTCCCCCAGCTGCCTGGGCCAGG - Intergenic
1175976718 20:62714181-62714203 TGCCCACAGCTGCGTGGCGTGGG - Intronic
1177072173 21:16524215-16524237 TTCCCACAGCTTCCTGCCTCTGG - Intergenic
1179035102 21:37752788-37752810 CATCCACACCAGCCTGGCTCTGG - Intronic
1179783689 21:43718425-43718447 CATCCACAGGTGCCTGGGTCTGG - Intergenic
1180150804 21:45946396-45946418 CGCCAACAGCTCCCTGTCACGGG + Intergenic
1182080724 22:27526918-27526940 CTGCCACAGCCGCCTGCCTCAGG + Intergenic
1182356507 22:29724601-29724623 CGCCCACAGAGGCCGGGTTCAGG - Intronic
1183364100 22:37398164-37398186 CGCCCACAGCTGCCTGGCTCTGG - Intronic
1183510291 22:38230638-38230660 CCCCAGCAGCTGCCTAGCTCAGG - Intronic
1184610897 22:45602413-45602435 AGCCCAGAACGGCCTGGCTCTGG - Intergenic
1184663291 22:45975445-45975467 CGCCCAGACCTGCAGGGCTCAGG + Intronic
1185379929 22:50503651-50503673 CGCCAACAGCACCCTGGCCCAGG - Exonic
1185384150 22:50524111-50524133 GGCCCACAGCTGCCTGGCGCAGG + Exonic
950260992 3:11543421-11543443 AGCCCTCAGCTGCCTGTGTCTGG + Intronic
950524695 3:13517042-13517064 CGCACACAGCTGCCTGGTGTGGG + Intergenic
950531915 3:13557142-13557164 CAGCCACAGCTGACTGGCCCAGG - Intronic
950549557 3:13657967-13657989 GCCCCAGAGCTGCGTGGCTCCGG + Intergenic
953485670 3:43292643-43292665 TGCCTACAGCTGGCTGGCTTAGG - Intronic
953880287 3:46687796-46687818 CCCACACAGTGGCCTGGCTCTGG + Intronic
954215514 3:49122233-49122255 CATCCACATCTGCCAGGCTCCGG + Exonic
954370949 3:50169353-50169375 AGCCCAAAGCGGCCTGGCACAGG - Intronic
954805438 3:53217289-53217311 AGCCCAAAGCTGCCTGTCCCAGG - Intergenic
961332242 3:126149426-126149448 AGCCCACAGCTGAGTGGCTCTGG - Intronic
961356602 3:126343557-126343579 CGCCAACCGCTGCCTTTCTCGGG - Exonic
962351115 3:134656406-134656428 CACCCACAGCAGACTGGCTTTGG - Intronic
962429641 3:135307332-135307354 CTTCCCCAGCTGCCTGGCTCTGG + Intergenic
965956761 3:174379498-174379520 GTCCAACAGCTGCTTGGCTCAGG + Intergenic
967089145 3:186120254-186120276 TGCCCACATCTACCTGGCACTGG - Intronic
968981292 4:3851114-3851136 CTCCCACAACTGCCTGACCCAGG + Intergenic
969638017 4:8380638-8380660 GGTCCACATCTGCCTGTCTCTGG - Intronic
970186162 4:13455660-13455682 TTCACACAGCTGCCTTGCTCCGG - Intronic
977176569 4:93827433-93827455 CGCCCAGCGCGCCCTGGCTCTGG - Intergenic
985581201 5:696080-696102 CGCCCACCCCTGCCTGGGTTTGG + Intergenic
985595826 5:787412-787434 CGCCCACCCCTGCCTGGGTTTGG + Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985945312 5:3177639-3177661 CACCCACAGGGGCATGGCTCTGG - Intergenic
990548822 5:56851743-56851765 CTTCCACAGCTGCCTGGTCCAGG - Intronic
991638055 5:68725987-68726009 CCCCCACAGCTGACTGGATATGG + Intergenic
992323441 5:75636811-75636833 TGCCCCCAGCTGTCTGGCTTGGG + Intronic
996516972 5:124381557-124381579 TGCACACAGCTGCCTGCCACAGG - Intergenic
999489813 5:152039020-152039042 TGCCCACAGCAGCCTTGCTGAGG + Intergenic
1001171327 5:169422200-169422222 CCCCCAAAGCTGTCTGACTCAGG + Intergenic
1001441460 5:171746821-171746843 CGGCCACAGCTGACTGGACCAGG + Intergenic
1002096614 5:176834987-176835009 CTCCCACAGCCACCTGGCACAGG - Intronic
1002676950 5:180924591-180924613 CACCCACATCTGCCTGTCTGAGG + Intronic
1002679492 5:180949808-180949830 CTCCCACTGCAGACTGGCTCTGG - Intronic
1002685360 5:181005238-181005260 CTCCCACTGCAGACTGGCTCCGG - Intronic
1003973251 6:11319217-11319239 TGTTCACAGCTGCCTGGCCCAGG + Intronic
1004443057 6:15672094-15672116 CGCCCACTCTTGCCTTGCTCTGG - Intergenic
1005973773 6:30781521-30781543 CAGCGCCAGCTGCCTGGCTCTGG + Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006577714 6:35058308-35058330 GGACCACAGCTGCCCGGCTGGGG + Intronic
1006805743 6:36787920-36787942 CACCCAGACCTGCCTTGCTCTGG - Intronic
1007631777 6:43276833-43276855 CTCACCCAGCTGCCTGGCTAAGG - Intronic
1007726064 6:43916332-43916354 CTCCTACAGCTCCCTGACTCAGG + Intergenic
1011938380 6:92811509-92811531 TGCCCACAGCTGCCAAGTTCAGG + Intergenic
1013582622 6:111551218-111551240 AGCCCTCAGCTGGCTGGCCCTGG + Intergenic
1015581505 6:134730221-134730243 CGCCCCCTCCTGCCTGGCTCTGG - Intergenic
1018478592 6:164167896-164167918 GGCCCACAGCTGCCTCACTCAGG - Intergenic
1019144458 6:169967600-169967622 GGCACACAGCAGCCTGGCCCAGG - Intergenic
1019559833 7:1650547-1650569 CAGCCTCATCTGCCTGGCTCGGG - Intergenic
1020245301 7:6424679-6424701 AGCCCACAGCTGCTCGGCTGGGG - Intronic
1020973322 7:14975759-14975781 TGCCAACATCTGCCTGGCTTTGG + Intergenic
1022530169 7:31061902-31061924 AACCCACAGGTGCCTGGCCCGGG - Intronic
1024996254 7:55275093-55275115 CCCACCCAGCTGCCTCGCTCAGG + Intergenic
1026840508 7:73667989-73668011 CGCCCCGGGCTGCCGGGCTCCGG - Exonic
1029448789 7:100629206-100629228 GGCCCACCGCTGCCTAGCCCAGG + Intronic
1032501684 7:132404448-132404470 TGCCCACTGCCCCCTGGCTCTGG - Intronic
1032854846 7:135825535-135825557 AGCCCACAGCTGCCCGGCCTTGG - Intergenic
1034271495 7:149805451-149805473 CTCCCAAAGCTGCCTTGCCCCGG + Intergenic
1034415668 7:150963173-150963195 CGCCCAGTGCTGGCTGCCTCGGG - Intronic
1035121571 7:156572835-156572857 CGCCCACAGCCTCCTCCCTCTGG + Intergenic
1035278604 7:157763438-157763460 AGGCCACACCAGCCTGGCTCAGG - Intronic
1035281444 7:157780947-157780969 GGCCTGGAGCTGCCTGGCTCAGG - Intronic
1035325135 7:158061077-158061099 CGGACAAAGCCGCCTGGCTCAGG - Intronic
1035573928 8:692513-692535 CTCCCACAGCTGCTGGGCTCCGG + Exonic
1035649016 8:1250351-1250373 CTGCCACAGCTGCATGGGTCAGG + Intergenic
1037748530 8:21664904-21664926 CCCCCAGAGCTGTCTTGCTCAGG + Intergenic
1038259737 8:25982390-25982412 GGGCCACAGCTCCCTGGCTGGGG - Intronic
1039453281 8:37692762-37692784 TCCCCACAGCAGCCTGGTTCTGG + Intergenic
1042567205 8:70124130-70124152 TGCCCTGAGCTGCCTGCCTCTGG - Intronic
1043414650 8:80034272-80034294 AGCACACAGATGCCTGGATCTGG + Intronic
1044309421 8:90676505-90676527 CTTCTGCAGCTGCCTGGCTCTGG + Intronic
1045181841 8:99792591-99792613 CTCCCACAGCTCCCTGCCCCAGG - Intronic
1045856418 8:106770080-106770102 CGCCCACTGCTGCCAACCTCGGG + Exonic
1047265971 8:123309580-123309602 CGTGCACAGCTGCCTGTCACAGG + Intergenic
1048252913 8:132882074-132882096 TGCCCACAGCAGCCTGGCAGGGG - Intronic
1048311342 8:133324650-133324672 TCCCCACAGTAGCCTGGCTCTGG - Intergenic
1048342286 8:133549483-133549505 CGGCCACAGGTGCCAGGCTGTGG - Intronic
1048415864 8:134227103-134227125 CACCCAGAGCTGCCTGGCTTGGG - Intergenic
1049150994 8:141035457-141035479 CGCTCCCCACTGCCTGGCTCTGG + Intergenic
1049621291 8:143599460-143599482 GGCCTACAAGTGCCTGGCTCCGG + Exonic
1049637086 8:143694859-143694881 TGCCCACAGCCGTCTGGCTCAGG + Exonic
1049660402 8:143817250-143817272 TGCCCTCAGCTGCCTGGCCCTGG - Intronic
1050131796 9:2420583-2420605 CGTACAAAGCCGCCTGGCTCTGG + Intergenic
1051638428 9:19202587-19202609 GACCCACAGCTGCCTGACCCAGG - Intergenic
1053470474 9:38342711-38342733 AGCACACAGCTTCCTGCCTCAGG + Intergenic
1053751918 9:41266048-41266070 CGCTCACCGCTGCCTGGTGCTGG + Intergenic
1054257441 9:62830378-62830400 CGCTCACCGCTGCCTGGTGCTGG + Intergenic
1054333875 9:63785344-63785366 CGCTCACCGCTGCCTGGTGCTGG - Intergenic
1056765847 9:89443913-89443935 GGCCCAGGGCTGCCTGACTCTGG - Intronic
1056836124 9:89957064-89957086 CGTCAACAGGTGCCTGGCCCTGG - Intergenic
1057210194 9:93196962-93196984 GGCCCACAGATGCCTGGGTGTGG - Intronic
1057231989 9:93326821-93326843 CGCACCCAGCTCCCCGGCTCTGG - Intronic
1057515155 9:95714378-95714400 GGCGCAGAGCTGCCTGGCCCTGG - Intergenic
1058001866 9:99874067-99874089 GGACCACAGCTGACTGGATCAGG - Intergenic
1060182172 9:121541842-121541864 CCCCACCAGCTCCCTGGCTCTGG - Intergenic
1060219447 9:121756654-121756676 TGCAGACAGCTGCCTGGGTCAGG + Intronic
1060302522 9:122383586-122383608 GGCCCACAGCCATCTGGCTCTGG - Exonic
1060599437 9:124868519-124868541 CGCCCCCAACTGCCTGGCCAAGG + Exonic
1060802982 9:126556622-126556644 CCCCCACCACTTCCTGGCTCTGG + Intergenic
1060891851 9:127194051-127194073 CGCCCCTAACTCCCTGGCTCTGG + Intronic
1061057730 9:128233246-128233268 CAGCCACATCTGCCCGGCTCTGG - Intronic
1061403495 9:130381340-130381362 CCCCCATAGATGCCAGGCTCTGG + Intronic
1061575597 9:131503828-131503850 CGGCCACAGCTACCTGACCCTGG - Intronic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1062560045 9:137137474-137137496 CCCACGCAGCTGCCAGGCTCTGG + Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1189035367 X:37489649-37489671 TCACCACAGCTGACTGGCTCTGG + Intronic
1189295548 X:39915120-39915142 TGACCACAGCTGCCTCACTCTGG - Intergenic
1190058159 X:47194089-47194111 CCCCGACAGCAGCGTGGCTCAGG - Intronic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1192056932 X:67782760-67782782 GGCCCTCAGCTGCCTGCCCCTGG - Intergenic
1196669018 X:118346316-118346338 CGCCCTCAGTTGCCGGGCTTCGG - Exonic
1199722288 X:150550613-150550635 CTCCCACACCTGGCTGTCTCAGG - Intergenic
1199927227 X:152480382-152480404 CGCCAACCGCAGCCTGGCTGAGG + Intergenic
1200108293 X:153726218-153726240 CGCTCACGGCTGCCTGCCCCCGG - Intronic
1202143293 Y:21751607-21751629 CACACACAGCTGTCTTGCTCAGG - Intergenic