ID: 1183367180

View in Genome Browser
Species Human (GRCh38)
Location 22:37412938-37412960
Sequence CTGTGTCAAGGGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183367180_1183367194 28 Left 1183367180 22:37412938-37412960 CCCTCTCCCTTCCCTTGACACAG No data
Right 1183367194 22:37412989-37413011 CAAATCCCTGCTCTGCACCCTGG 0: 1
1: 0
2: 3
3: 40
4: 470
1183367180_1183367191 3 Left 1183367180 22:37412938-37412960 CCCTCTCCCTTCCCTTGACACAG No data
Right 1183367191 22:37412964-37412986 GGGCGGGGACCTCTGAGCATAGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183367180 Original CRISPR CTGTGTCAAGGGAAGGGAGA GGG (reversed) Intronic
No off target data available for this crispr