ID: 1183367729

View in Genome Browser
Species Human (GRCh38)
Location 22:37416212-37416234
Sequence CTGCTTCAGGAGAACCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183367725_1183367729 3 Left 1183367725 22:37416186-37416208 CCTGTTTTTAGTAATTGAATGAA 0: 1
1: 0
2: 1
3: 27
4: 349
Right 1183367729 22:37416212-37416234 CTGCTTCAGGAGAACCCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 195
1183367724_1183367729 15 Left 1183367724 22:37416174-37416196 CCTGTGCAGCTTCCTGTTTTTAG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1183367729 22:37416212-37416234 CTGCTTCAGGAGAACCCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183367729 Original CRISPR CTGCTTCAGGAGAACCCCTG GGG Intronic
900120409 1:1046448-1046470 CTGGCTCAGGAGGAGCCCTGGGG - Exonic
900512119 1:3065677-3065699 GGGCTTCTGGGGAACCCCTGGGG + Intergenic
901327466 1:8376598-8376620 CTGATACAGGAGAAGCCCTCTGG + Intronic
902893611 1:19463395-19463417 CTGCTTCTGCAAAACACCTGTGG + Intronic
903028224 1:20444532-20444554 CTGGTTCAGGAGCCTCCCTGGGG - Intergenic
903563856 1:24249540-24249562 CTGCTACAGGACCAGCCCTGAGG + Intergenic
904731384 1:32594674-32594696 TCGCTTCAGGAGAACCCAGGAGG + Intronic
904758847 1:32786630-32786652 CTGCTTCAGGGGAAGGCTTGTGG + Intronic
905772060 1:40644782-40644804 CTGCCCCAGGAAAACCACTGTGG - Intronic
906746593 1:48226282-48226304 CCACTTCAGGAGAAGCCCAGGGG + Intronic
909489096 1:76206641-76206663 TCGCTTCAGGAGAACCCGGGAGG + Intronic
911233828 1:95388172-95388194 CTGCTACAGCAGAACCCATATGG + Intergenic
912677681 1:111700328-111700350 CTGCTTCTGGTGAACACCTCAGG + Intronic
913498827 1:119452094-119452116 CTACTTCAGCAGAAACCTTGAGG + Intergenic
913510063 1:119553307-119553329 CTACTTCAGGTGAAACCTTGAGG + Intergenic
913513881 1:119586434-119586456 CTGCTTCAGGTGAAACCTTGAGG + Intergenic
915400718 1:155619849-155619871 CTGAGTCAGGAGGATCCCTGGGG + Intergenic
918968532 1:191381969-191381991 ATTCTTCAGGAGAACACTTGTGG + Intergenic
920269329 1:204751543-204751565 GTGCTTCAGAAGACCCCCAGTGG + Intergenic
921485757 1:215713510-215713532 CTGCTTCAGGAGGTCACATGGGG - Intronic
922770678 1:228181298-228181320 CTGCTACAAGAGAATACCTGAGG - Exonic
923087092 1:230710188-230710210 CTGCTTCAGGTGCAGGCCTGGGG + Exonic
923907806 1:238404634-238404656 TTGCTGCAGCAGAACCACTGGGG - Intergenic
1063122790 10:3116306-3116328 CTGCAGGAGGAGAACCCGTGGGG - Intronic
1066342743 10:34551781-34551803 CTGCTTTAAGAGAACCTTTGGGG - Intronic
1069683256 10:70300204-70300226 TTGCTTCCCGAGAACGCCTGTGG - Exonic
1069828765 10:71270249-71270271 CTGATGCAGGAGAACCCAGGAGG + Intronic
1071547142 10:86537346-86537368 CTGCATCAGGAGACCCACTGCGG - Intergenic
1073580527 10:104661405-104661427 CTGCTTCAGGAGAACAAGTTAGG - Intronic
1074088034 10:110223480-110223502 CTGTGTCAGGAGAACCCGGGAGG + Intronic
1075684515 10:124354251-124354273 CTGCTTCCCGAGACCCCCCGGGG + Intergenic
1075784258 10:125038181-125038203 CAGCTGCAGGGGAAGCCCTGTGG + Intronic
1076333756 10:129691415-129691437 CTGCTTCAGGACACTGCCTGGGG - Intronic
1076449074 10:130543834-130543856 CTGCTTCAGGAAACACACTGAGG + Intergenic
1076781388 10:132726688-132726710 CTGCTGCAGGGGAACCTCAGTGG - Intronic
1077020864 11:416684-416706 CTGCTTCAGGACAGGCGCTGGGG - Intronic
1077173137 11:1177219-1177241 CTGCTTCCCCAGAACCACTGTGG + Intronic
1077462666 11:2718376-2718398 CGGCTTCAGGAGGGGCCCTGAGG - Intronic
1078772416 11:14363418-14363440 CTGCTAAATGAGAACCTCTGAGG + Intronic
1081977290 11:47243770-47243792 CTGCCCCAAGAGAACCACTGGGG - Intronic
1082019791 11:47522428-47522450 CTGAGTCAGGAGAACCCGGGAGG + Intronic
1087652808 11:100887968-100887990 CCGCTTCTGGAGAACCCATCTGG + Intronic
1088583208 11:111334955-111334977 CTGGTTCAGGAGGACATCTGTGG - Intergenic
1091298090 11:134487475-134487497 CTGATTGAGGAGAACCCCACGGG - Intergenic
1092220964 12:6713313-6713335 CTGAGGCAGGAGATCCCCTGAGG - Intergenic
1093528864 12:20136662-20136684 CTGTGTCAGGAGATCCCCTCAGG - Intergenic
1094014235 12:25845380-25845402 CCTCTTCAGGAAAACCCCTCTGG - Intergenic
1097242301 12:57583809-57583831 CTGCTAGAGGAGAGCACCTGGGG - Intronic
1103589543 12:121981530-121981552 TTGCTTCAGAATAACCCATGGGG - Intronic
1107793637 13:44028342-44028364 CTGGCTCAGCAGGACCCCTGTGG + Intergenic
1112991059 13:105514491-105514513 CAGCCTCAGGAGAACAGCTGAGG - Intergenic
1113446991 13:110376833-110376855 CAGTCTCAGGAGAACACCTGAGG - Intronic
1113777149 13:112954315-112954337 CTGCTCCAGGACACCTCCTGGGG + Intronic
1113778279 13:112961417-112961439 CTGCTGCACGATTACCCCTGGGG - Intronic
1114566911 14:23639603-23639625 CTGCTCCAGGAGTCCCTCTGGGG - Intronic
1118149366 14:63173169-63173191 CAGCTTCAGAAGAAGCCGTGAGG + Intergenic
1118210771 14:63763893-63763915 TCGCTTCAGGTGAACCCTTGAGG - Intergenic
1119244587 14:73093207-73093229 CTGCTTCAGGGGAACATCTTTGG + Intronic
1119479789 14:74952083-74952105 CAGCCTCAGGAGCAGCCCTGGGG - Intronic
1122658014 14:103274551-103274573 CGGCTGCAGGAGAATCCCCGCGG - Intergenic
1123066502 14:105621957-105621979 CTGCTTCAGGTCCACCACTGAGG + Intergenic
1123070644 14:105641010-105641032 CTGCTTCAGGTCCACCACTGAGG + Intergenic
1123096946 14:105771346-105771368 CTGCTCCAGGAGCACCTCTGGGG - Intergenic
1124408155 15:29410422-29410444 CTGCCCCAGGAGCAGCCCTGGGG + Intronic
1126282153 15:46966167-46966189 ATGTTTCATCAGAACCCCTGGGG + Intergenic
1126456304 15:48865801-48865823 CTGCTTGAAGAGGACCCCTGGGG - Intronic
1126720041 15:51568948-51568970 CTGCTTCAGCTCAACCTCTGCGG - Intronic
1128062466 15:64743560-64743582 CAGCTACAGGAGACCCCCAGGGG + Intronic
1129570670 15:76680869-76680891 TTGCTTCAGAAGAACACCTGAGG - Intronic
1132315107 15:100884092-100884114 CAGCATCAGAAGAACCCCCGTGG - Intronic
1132666287 16:1082735-1082757 CTGCCTCGTGAGCACCCCTGGGG - Intergenic
1132958409 16:2608833-2608855 ATGCTTCAGGTGAACCACGGGGG - Intergenic
1132971021 16:2688929-2688951 ATGCTTCAGGTGAACCACGGGGG - Intronic
1133105578 16:3506599-3506621 CTGAGACAGGAGAACCCCCGAGG - Intronic
1133148412 16:3807985-3808007 CTGTCTCACAAGAACCCCTGTGG - Intronic
1133385640 16:5367991-5368013 TTGCTTAAGAAGAACCCCCGTGG - Intergenic
1135037391 16:19089608-19089630 CTGCTGCAGGAGTAGCCATGTGG - Intergenic
1135585885 16:23670541-23670563 TTTTTTCAGGAGAACCGCTGAGG - Exonic
1136393779 16:29981921-29981943 CACCTTCAGGAGAACCTCTGAGG - Exonic
1136514049 16:30757106-30757128 CTGCTTCCTGGGAATCCCTGGGG - Exonic
1139465705 16:67152988-67153010 GTCCTTCAGGACATCCCCTGGGG + Intergenic
1143521148 17:7445132-7445154 CAGCATCAGCAGAGCCCCTGGGG - Exonic
1144750160 17:17642877-17642899 CTGCTTCTGGAGGAGCCCAGTGG - Intergenic
1144871531 17:18374923-18374945 CTGAGGCAGGAGAACCCATGAGG + Intergenic
1147904784 17:43815927-43815949 CTGCTCCAGAAGGACTCCTGGGG + Intronic
1148862521 17:50612138-50612160 CTGCTGTAGGAGAACCTCTGGGG - Intronic
1150788069 17:68178596-68178618 CTGAGGCAGGAGAACCCCGGAGG + Intergenic
1152757415 17:82092778-82092800 CTGCTCCTGGATATCCCCTGAGG + Exonic
1152776663 17:82206140-82206162 CTCTTTCAGGAGAACCAGTGGGG + Intronic
1156465665 18:37346744-37346766 CTGCTTGTGCAGAAGCCCTGGGG + Intronic
1160535792 18:79590643-79590665 CTGCTTCTGGAGCACGCCCGGGG + Intergenic
1161196890 19:2991846-2991868 CTCCATCAGGATAACCCTTGAGG - Exonic
1161978673 19:7619631-7619653 CTGCTCCAGCCGAACCTCTGTGG + Exonic
1163233321 19:16017892-16017914 TTGGTTCTGGAGAACCCCAGAGG - Intergenic
1163808750 19:19417109-19417131 CTGCTTCGGCAGATACCCTGTGG + Intronic
1164537634 19:29098233-29098255 TTGTTTCAGGAGCACTCCTGTGG + Intergenic
1164796821 19:31040236-31040258 CTGCTCCAGAAGAGTCCCTGAGG - Intergenic
1167597629 19:50435815-50435837 CTTCTTCAGGAAAACGCCGGTGG - Exonic
1168271893 19:55254634-55254656 CTGTTTCTGGAGGCCCCCTGAGG - Intronic
925744310 2:7031607-7031629 CTCCTTCAGGAGAGCCTCTGAGG + Intronic
926208115 2:10848203-10848225 CGGCTTCAGGAGAGCTCCTGGGG + Intronic
928451444 2:31381817-31381839 CTGCTGCAGGCAAACCCCTGAGG + Intronic
928608210 2:32963716-32963738 CTCCTACAACAGAACCCCTGTGG + Intronic
931700452 2:64904838-64904860 CTCTTTCAGAAGAGCCCCTGTGG + Intergenic
932592126 2:73073914-73073936 CTTCTTCAGGAGAGGGCCTGTGG - Exonic
936648961 2:114404481-114404503 CTGCTGAAAGAGAAACCCTGAGG + Intergenic
937210980 2:120270722-120270744 CTGCTTCGGGAGAACACCAAGGG - Intronic
938526876 2:132142325-132142347 CTGCATCAAGGGAACCACTGGGG - Intergenic
942691632 2:178591283-178591305 CTGCTTAAGGAGAGACACTGGGG - Exonic
945953046 2:216058153-216058175 CTGCTGCAAGAGAAACTCTGGGG - Intronic
946436008 2:219654910-219654932 CTGCTTCTGGTGAAGCCCTCAGG + Intergenic
946807605 2:223486676-223486698 CTGCTTGAGGGGCACCCCTGGGG - Intergenic
948710434 2:239821819-239821841 CTACCTCAGGAGAACAGCTGGGG + Intergenic
948983123 2:241505155-241505177 CTGCTTCTGCAGATCACCTGAGG - Intronic
1172240851 20:33411585-33411607 TTGCTTTAAGAGAATCCCTGTGG - Intronic
1172723730 20:37019487-37019509 CTTCTTCAGGAAAATCCCTCAGG - Intronic
1173223550 20:41148073-41148095 CTGCTTCAGCAGAACCCACTAGG - Intronic
1174983687 20:55425114-55425136 CTATTTCAGGCGAACCTCTGGGG + Intergenic
1175170080 20:57074225-57074247 CTGATTCCGGAGCTCCCCTGTGG + Intergenic
1175281515 20:57807031-57807053 CTGTGCCAGGAGAAACCCTGAGG - Intergenic
1175287264 20:57845215-57845237 CTGGCTAAGGAAAACCCCTGAGG + Intergenic
1175825017 20:61931999-61932021 CTGCTTCCTGAGGGCCCCTGGGG - Intronic
1176203254 20:63873825-63873847 CTGCCCCAGGCGCACCCCTGGGG + Intronic
1179503335 21:41823433-41823455 CTCCGGCAGGAGAACACCTGTGG + Exonic
1179568168 21:42261979-42262001 CTGCTTCTCGAGAGACCCTGGGG - Intronic
1181498008 22:23298959-23298981 CTGCTGCAACAGACCCCCTGGGG + Intronic
1181498793 22:23303579-23303601 CTGCTGCAAGAGACCCCCTGGGG - Intronic
1182526586 22:30924151-30924173 CTGCTTCAGAATAACCCATATGG - Intergenic
1183367729 22:37416212-37416234 CTGCTTCAGGAGAACCCCTGGGG + Intronic
1183408520 22:37641770-37641792 CTCCTTCAGGAAACCCTCTGAGG - Intronic
1183680562 22:39326474-39326496 CCCCTTGAGGAGGACCCCTGGGG - Intergenic
1184640373 22:45867198-45867220 CTGGTGCTGGAGAACCGCTGGGG + Intergenic
1185153256 22:49178505-49178527 CAGCCTCAGGAGGGCCCCTGGGG + Intergenic
949387327 3:3517618-3517640 CTGCTTCTGGTGAAGCCCTCAGG - Intergenic
949870475 3:8583717-8583739 CTGCTTCTGGACCAGCCCTGGGG + Intergenic
950574820 3:13825919-13825941 CTGCTTCCAGAGAACCCCACCGG + Intronic
950728904 3:14939223-14939245 CTGCCACAGGAGAAGCCTTGAGG + Intergenic
957515875 3:81250360-81250382 CTCCTTAATGAGAAACCCTGGGG + Intergenic
958809270 3:98840960-98840982 TTGCTTCAGCAGAATCCCTGAGG - Intronic
959736430 3:109664883-109664905 CTGCTTCAGCACACCCTCTGTGG - Intergenic
960041812 3:113157746-113157768 ATCATTCAGGAGAACTCCTGTGG + Intergenic
960247304 3:115413884-115413906 CTCCTTCATGAGAAACTCTGGGG + Intergenic
960537435 3:118828833-118828855 GGGCTTGAGGAGAACCCTTGAGG + Intergenic
963587477 3:147210859-147210881 CTGTTTCAAGAGACACCCTGTGG + Intergenic
963768742 3:149367058-149367080 CTGTTTTAGTACAACCCCTGAGG + Intergenic
965429403 3:168567933-168567955 CTACTTCAGGAAGCCCCCTGGGG - Intergenic
965515749 3:169619434-169619456 CTGCTTCATGAGCACCCAGGAGG - Intronic
967083802 3:186075745-186075767 CTGCTTCTGGATAGCCCCTAAGG - Intronic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
970162322 4:13201373-13201395 CTGCCTCATGAGAAACTCTGAGG + Intergenic
970252119 4:14127441-14127463 CTGCTTCATGACAAGCCTTGAGG - Intergenic
971005786 4:22373223-22373245 CTGCGTGAGGAGAGCCCCTGAGG + Intronic
971236579 4:24847947-24847969 CTGGTTCAGGAGCACACCTCAGG + Intronic
972042151 4:34616189-34616211 CTACTTGAGGACAACCCCTAAGG + Intergenic
973603475 4:52564244-52564266 CTCCTTCATGAGAACTTCTGTGG + Intergenic
978063816 4:104371387-104371409 CTGCTTCAGGTGAAGGCCTCAGG + Intergenic
978192973 4:105937211-105937233 CTTGTTTAGGAGAACCCCGGAGG - Intronic
980659441 4:135838511-135838533 CTGCTTCAAGATATTCCCTGTGG - Intergenic
981175528 4:141678525-141678547 CTGCTTCAGAAAAATCCATGGGG - Intronic
981549333 4:145927575-145927597 CCACTACAGGAGAACCCCTTAGG - Intronic
985784326 5:1886212-1886234 GTGCTTCAGGAGTTACCCTGGGG + Intronic
986770312 5:10966789-10966811 CAGCATGATGAGAACCCCTGGGG - Intergenic
986812122 5:11371478-11371500 CTACTTCAGGAGTATCCATGAGG + Intronic
987101516 5:14595189-14595211 CTGCTTCAGGAGAAAGTCAGTGG + Intronic
989114127 5:37935483-37935505 CTACTTCAGAAGAACCACTGGGG - Intergenic
989323698 5:40165678-40165700 CTGCCCCAGGAGTAGCCCTGAGG - Intergenic
992750028 5:79853285-79853307 CTGCTACAGAAACACCCCTGGGG + Intergenic
995873517 5:116766812-116766834 ATGCTGCAGGAGGACTCCTGTGG + Intergenic
996330298 5:122321026-122321048 ATGCTTCAGGAGAAAATCTGGGG - Intronic
997273056 5:132557612-132557634 CTGCTTCAGGCAAACTCCTAAGG - Intronic
999287793 5:150404617-150404639 CAGCTTCAGGAGAGCCCCGAGGG + Intronic
999438514 5:151582785-151582807 CTGTTTCAGGAGGACTGCTGTGG + Intergenic
999683561 5:154082179-154082201 CTGGTTCAGGAGATGCCCGGAGG - Intronic
1007389935 6:41545352-41545374 GTACTTCATGAGGACCCCTGAGG + Intergenic
1007408769 6:41649621-41649643 CAGCCTCAGGGGAACCCCTTGGG + Exonic
1009679656 6:66875244-66875266 CTGCTTCAGCTGACCCTCTGTGG + Intergenic
1011127036 6:84019048-84019070 CTGGCTCAGGAGAACACATGAGG + Intergenic
1012006200 6:93716194-93716216 CTGCTTCAGCTTAGCCCCTGAGG + Intergenic
1012143857 6:95656844-95656866 CTCCTTCAGTACAGCCCCTGAGG - Intergenic
1013531250 6:111020760-111020782 CTGATGCAGGAGAACCCGGGAGG + Intronic
1016157720 6:140833482-140833504 CTGCTTCAGAATCACCCCTGGGG - Intergenic
1017058278 6:150457052-150457074 CTGCTACAGCAAAACCCCTCAGG + Intergenic
1018114725 6:160572175-160572197 CTGCTTCAGGTCACCCTCTGTGG + Intronic
1018851800 6:167645711-167645733 ATGATTCGGGAGAACGCCTGAGG - Intergenic
1019597921 7:1866927-1866949 CTACTGCAGGAGGACCGCTGTGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023078427 7:36505562-36505584 CTCCTGCAAGAGAAACCCTGGGG - Intergenic
1024486783 7:49928493-49928515 CTCCTTCAGGACCACCCCTGTGG + Intronic
1026290160 7:68998874-68998896 CTGGTTCAACAGAAGCCCTGAGG - Intergenic
1030341420 7:108384903-108384925 CAGCTTCACGATAACCCATGAGG - Intronic
1034214953 7:149398114-149398136 CTGTTTCTGCAGAAACCCTGTGG - Intergenic
1036759027 8:11494256-11494278 CTGCTCCAGGAAAACTCGTGAGG - Exonic
1037820857 8:22133890-22133912 CTGCTGCTGGAGAAGTCCTGGGG - Intergenic
1039061536 8:33575575-33575597 GTGCCTCATGAGAACCTCTGTGG - Intergenic
1043341333 8:79243536-79243558 CTGCCTCAGGATAACCCATTGGG - Intergenic
1045273442 8:100680974-100680996 CTGCTTCAGGAGCCCCCTGGGGG + Intergenic
1049807789 8:144548667-144548689 CAGCTCCAGGAGAGCCCCAGAGG - Intronic
1051651785 9:19333536-19333558 TTGCTCCTGGAGAACCACTGAGG + Intronic
1051694016 9:19749052-19749074 CTGATTCATGAGAACCTCAGGGG - Intronic
1051889520 9:21927961-21927983 CAGTTTCATCAGAACCCCTGTGG - Intronic
1052221387 9:26027729-26027751 CTGCTTTAAGTGAACACCTGAGG + Intergenic
1052828169 9:33192592-33192614 CTGCCTCTGTAGACCCCCTGGGG - Intergenic
1055087171 9:72326127-72326149 CTGCTTCAGAAGAACCCTCAGGG - Intergenic
1055636238 9:78282020-78282042 CTCCTTCAGGAGTCCTCCTGAGG - Intergenic
1057556101 9:96088881-96088903 ATTCCTCACGAGAACCCCTGGGG + Intergenic
1061041905 9:128145340-128145362 CTCCCTCTGGTGAACCCCTGGGG - Intergenic
1062522204 9:136962762-136962784 CCACCTCAGGAGAGCCCCTGGGG - Intergenic
1062569820 9:137179891-137179913 CTGCTTCAGGGGGACCCCTGTGG - Intronic
1188830040 X:34885237-34885259 CTGGTTCTGGAGAAGCTCTGGGG - Intergenic
1192068985 X:67917598-67917620 CTACATCAGGGGAAACCCTGTGG - Intergenic
1194165182 X:90506655-90506677 CTGCTTTAGGAGAAACCCCAAGG - Intergenic
1194474144 X:94336759-94336781 CTTCTTCAGGAGAATCATTGAGG - Intergenic
1195221054 X:102745827-102745849 CTGCCTCAGGAGGACCCCCGCGG - Intronic
1196183056 X:112715983-112716005 CACCATCAGGAGAACCACTGGGG + Intergenic
1200511444 Y:4084464-4084486 CTGCTTTAGGAGAAACCCCAAGG - Intergenic