ID: 1183368059

View in Genome Browser
Species Human (GRCh38)
Location 22:37417591-37417613
Sequence CCACCCAGCTTTCCTTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 290}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183368059_1183368070 3 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368070 22:37417617-37417639 GGGTGCCCACGGCTGGGGGCAGG 0: 1
1: 0
2: 6
3: 78
4: 714
1183368059_1183368066 -4 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368066 22:37417610-37417632 GTGGGAGGGGTGCCCACGGCTGG 0: 1
1: 0
2: 3
3: 23
4: 313
1183368059_1183368067 -3 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368067 22:37417611-37417633 TGGGAGGGGTGCCCACGGCTGGG 0: 1
1: 0
2: 4
3: 15
4: 258
1183368059_1183368075 10 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368075 22:37417624-37417646 CACGGCTGGGGGCAGGGGCCAGG 0: 1
1: 0
2: 10
3: 107
4: 1055
1183368059_1183368068 -2 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368068 22:37417612-37417634 GGGAGGGGTGCCCACGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 472
1183368059_1183368072 5 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368072 22:37417619-37417641 GTGCCCACGGCTGGGGGCAGGGG 0: 1
1: 0
2: 9
3: 95
4: 910
1183368059_1183368076 22 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368076 22:37417636-37417658 CAGGGGCCAGGCCCACAAGAAGG 0: 1
1: 0
2: 1
3: 32
4: 310
1183368059_1183368071 4 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368071 22:37417618-37417640 GGTGCCCACGGCTGGGGGCAGGG 0: 1
1: 0
2: 3
3: 48
4: 580
1183368059_1183368069 -1 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368069 22:37417613-37417635 GGAGGGGTGCCCACGGCTGGGGG 0: 1
1: 0
2: 1
3: 40
4: 316
1183368059_1183368065 -8 Left 1183368059 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1183368065 22:37417606-37417628 CTGGGTGGGAGGGGTGCCCACGG 0: 1
1: 1
2: 4
3: 59
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183368059 Original CRISPR CCACCCAGCTTTCCTTCCAC AGG (reversed) Intronic
900139493 1:1133609-1133631 CCTCCCAGCCTCCCTTCCACAGG + Intergenic
900623372 1:3597293-3597315 CCACCCTGCCGTCCTTCCTCGGG + Intronic
900665404 1:3811602-3811624 CCACCCAGCTTTCCAATCAAGGG + Intergenic
900833342 1:4980605-4980627 CCACCCAGCTGCCCCTCCTCAGG - Intergenic
901296723 1:8166400-8166422 CCACTCAGCTTTTCTTCCAGGGG + Intergenic
901409197 1:9071164-9071186 CCACCCACCTTGGCTTCCCCAGG - Intronic
901600763 1:10421801-10421823 GCACCCAGCCTTGCTGCCACTGG - Intergenic
902805675 1:18859807-18859829 CCACCCTCCTTTCCTCCCTCTGG - Intronic
903731779 1:25501790-25501812 ACTCCCAGCTTTGCCTCCACAGG + Intergenic
905234544 1:36536906-36536928 CCATCCAGTTTTCTTTCCACTGG - Intergenic
905644548 1:39616268-39616290 CCACCCACAGTTCCTGCCACGGG + Intergenic
907728622 1:57044250-57044272 CAACCCAGGTCACCTTCCACGGG - Intronic
908444275 1:64187066-64187088 CCACCCAGGTTTCCTTCCACTGG - Intergenic
912039628 1:105372080-105372102 CCACCCAGCTGTCCACCAACAGG + Intergenic
915487830 1:156234341-156234363 CCACCCACCCTTTCTCCCACAGG - Intronic
915736543 1:158088973-158088995 CCACCCTGCTTCCCGTGCACAGG - Intronic
917579825 1:176364575-176364597 CCTGGCAGCTTTCTTTCCACTGG + Intergenic
919683270 1:200456583-200456605 TCAACCAGCTTTCCATCCAGGGG + Intergenic
919979308 1:202632473-202632495 CTACGCAGCCTTTCTTCCACTGG - Intronic
920281519 1:204847118-204847140 CCACCCATGTGTCCTCCCACTGG - Intronic
921178074 1:212610097-212610119 CTCACCAGCTTTCTTTCCACTGG + Intronic
921833844 1:219758104-219758126 TCACCCAGCTTTCCTAACAGAGG + Intronic
1062950929 10:1502639-1502661 CCACTCAGACTTCCGTCCACAGG - Intronic
1064268856 10:13847535-13847557 CCTCCCTTCCTTCCTTCCACTGG + Intronic
1065208660 10:23381544-23381566 CCACCCACCTTTCTATCCACAGG - Intergenic
1067508418 10:46875885-46875907 CCACCCATCTTTCCTCCTCCAGG - Intergenic
1067577869 10:47419380-47419402 CCACCCTACTTACCTTCCTCAGG - Intergenic
1067653831 10:48175964-48175986 CCACCCATCTTTCCTCCTCCAGG + Intronic
1067940837 10:50654293-50654315 CCATCCTGCTTTCTTTCCATGGG - Intergenic
1068226079 10:54108494-54108516 CCAGCCAGCCTTCCCACCACAGG + Intronic
1071070792 10:81691100-81691122 CAACCCAGCTGTCCTTCAATGGG - Intergenic
1073303972 10:102488393-102488415 CCACCCTGCTGTCCTTGCCCAGG + Intronic
1074083393 10:110186163-110186185 CAACCCAGATGTCCTTCAACAGG - Intergenic
1074851470 10:117442772-117442794 CCTCCCAGCTTCCCATCCAGTGG - Intergenic
1075347841 10:121697314-121697336 CCACACAGCTCTCCTCCCAGGGG + Intergenic
1075539480 10:123300119-123300141 CAACCCAGCTTTCTGTCCCCTGG - Intergenic
1075652115 10:124134352-124134374 ACATCCACCTTTCCATCCACAGG + Intergenic
1076010781 10:126986326-126986348 CCAGTCAGGGTTCCTTCCACAGG + Intronic
1076817710 10:132922949-132922971 GCGCCCAGGTTTCCTTCCAGGGG - Intronic
1077185410 11:1233511-1233533 CCACCCACCTTTCCTGGCAGGGG - Intronic
1077231612 11:1460302-1460324 CCACCCTGCTTGCCGCCCACCGG + Intronic
1078355378 11:10628495-10628517 CCACCCAGCCTTCCTGACCCTGG + Intronic
1078367246 11:10716944-10716966 CCACCCCGGTTTCCAGCCACGGG + Intergenic
1080415645 11:32067689-32067711 CCACCCAGCTGTCCTGCTAAAGG - Intronic
1080605867 11:33864554-33864576 CCACCCAGCCTCCCTTCCGAGGG + Intronic
1082206529 11:49442047-49442069 CCCCACATCTTTCCTTCCAAGGG - Intergenic
1082883467 11:58060471-58060493 CCTCCCAGCTTTCCTTAGGCAGG - Intronic
1083635530 11:64118718-64118740 CCACGCAGCTCTCCCGCCACTGG + Exonic
1083714892 11:64569553-64569575 CAGCCCAGCTTTCCTTCCCCTGG + Intronic
1083812868 11:65115454-65115476 CCACCCTGCTGTCTTTCCCCAGG + Exonic
1084586589 11:70066034-70066056 CCACAGAGCTTACCTTCCAGCGG - Intergenic
1085741895 11:79084462-79084484 CAACCCAGATATCCTTCAACAGG + Intronic
1085806400 11:79640880-79640902 TCTCTCAGCTTTCCTTCCATTGG - Intergenic
1086146387 11:83556828-83556850 CATCCCAGCTTGCCTTCCACTGG - Intronic
1086415591 11:86586240-86586262 CAACCCAGCTTGGGTTCCACAGG - Intronic
1087784963 11:102344168-102344190 CCACCCAGATGTCCATCCATAGG + Intergenic
1089114931 11:116086979-116087001 CCAGCCAGCTTTCCCTGAACAGG - Intergenic
1089369660 11:117946456-117946478 CCACCCAGCCGTGCTTCCCCAGG - Intergenic
1090743813 11:129691421-129691443 ACATCCAGCTCTCCTTCCAGAGG + Intergenic
1091136588 11:133196386-133196408 CCACCCAGCGATCCTTTCAGAGG + Intronic
1091311123 11:134575985-134576007 ACACCGAGCCTTCCTTCCCCTGG - Intergenic
1091311138 11:134576046-134576068 ACACCGAGCCTTCCTTCCCCTGG - Intergenic
1091589112 12:1832931-1832953 GCACCCAGCTTTGCATCCCCAGG + Intronic
1092305612 12:7297669-7297691 CCACTTAGATTCCCTTCCACTGG + Intergenic
1093801685 12:23381390-23381412 CAACCCAGCAATCCTTCTACTGG + Intergenic
1094253835 12:28399353-28399375 CCACCATGATTTCCTCCCACTGG + Intronic
1094496171 12:30990708-30990730 CCAGCCTGCTCTCCTCCCACTGG + Intronic
1095405254 12:41860903-41860925 CTACCCTCCTTTCCTTCCAGTGG + Intergenic
1096084694 12:48857715-48857737 CCCCACAGCTTTCCTTCCTCTGG + Exonic
1097650036 12:62286446-62286468 CCAAACTGCTTTCTTTCCACAGG - Intronic
1098165707 12:67695393-67695415 ACACCTAGCTTTCCTTACAGAGG - Intergenic
1101751531 12:107586307-107586329 TCCCCCATCTTTCCCTCCACAGG + Intronic
1102001282 12:109559430-109559452 CCAGCCAGCTTTTGTACCACTGG + Intronic
1102222019 12:111201213-111201235 CCACCCACCTTCCCCTCCGCTGG + Intronic
1102301994 12:111777828-111777850 GCACCCTTCTTTCTTTCCACGGG - Intronic
1102525365 12:113508855-113508877 CCAGTGAGCTTTCCTTCAACTGG + Intergenic
1102823146 12:115924933-115924955 CCACCCAGCAGCCCTCCCACTGG - Intergenic
1106108400 13:26755620-26755642 CCACCCTGCTTCCCTGCCCCAGG + Exonic
1106153689 13:27131937-27131959 CCTCCCAACTCTCCTTCCACAGG + Intronic
1106773472 13:32985402-32985424 CCACACAGCTGTCCCTCCACAGG - Intergenic
1109683281 13:65781802-65781824 ATACCCAGCTTTCTTTTCACTGG - Intergenic
1110430031 13:75412997-75413019 CCACACAGCTTACCTTCCAGTGG + Intronic
1110574620 13:77041195-77041217 CCACCCAGATTTCCCTTCAGGGG - Intergenic
1112574720 13:100625491-100625513 TAACCCATCTTTCCTTCCACAGG + Intronic
1113630566 13:111880309-111880331 CCACCCAGGTCTGCTCCCACAGG + Intergenic
1113676261 13:112209783-112209805 GCACCCTGCCTGCCTTCCACAGG - Intergenic
1113869575 13:113550627-113550649 GCACCCAGCCTTCCTCCCTCTGG - Intronic
1113911862 13:113845476-113845498 CCACACAGCTCCCCTTGCACTGG - Intronic
1119795906 14:77397140-77397162 CAACCCAGATGTCCTTCAACAGG + Intronic
1120398330 14:83996175-83996197 CCACCCAGTCTTCCTTGCCCAGG + Intergenic
1120856208 14:89214656-89214678 CTACCCAAGTTTCCTTTCACTGG + Intronic
1121171870 14:91861444-91861466 GGACCCAGCTTTGCTTTCACTGG + Intronic
1121454109 14:94027412-94027434 CCACCCAGCCCTCACTCCACAGG - Intronic
1121687251 14:95845697-95845719 CCACCCTGCTTTCCCTGCATAGG - Intergenic
1122169482 14:99860145-99860167 CCATCCTGCAATCCTTCCACCGG + Intronic
1122677892 14:103432429-103432451 CCTCCCTCCCTTCCTTCCACTGG + Intronic
1123016263 14:105377123-105377145 CCAGGCAGCTTTCCTTTCATAGG + Intronic
1124232172 15:27955135-27955157 GTACCCAGCTTTCTTTCCTCAGG - Intronic
1124494906 15:30180429-30180451 CTACACAGCCTTTCTTCCACTGG - Intergenic
1124748661 15:32358216-32358238 CTACACAGCCTTTCTTCCACTGG + Intergenic
1125412156 15:39416767-39416789 CCTCCCCCTTTTCCTTCCACAGG + Intergenic
1128505834 15:68272036-68272058 CCACCCACCTCTCCTTCCTCCGG + Intergenic
1128690742 15:69723168-69723190 GCAGTCACCTTTCCTTCCACGGG + Intergenic
1130209162 15:81907477-81907499 CCAACCAGGTTCCCTTCCAGGGG + Intergenic
1130249442 15:82288075-82288097 CAACCCAGATGTCTTTCCACTGG + Intergenic
1131453195 15:92563048-92563070 TCCCCCATCTTTCCTTCCCCAGG - Intergenic
1132282587 15:100633133-100633155 GGACGCAGCTTTCCTCCCACAGG - Intronic
1132566403 16:625534-625556 CCATCCAGCCTGCCTTCCCCGGG - Intronic
1133159172 16:3898348-3898370 CCACCCAGGTGTTCTTCCATGGG + Intergenic
1133514419 16:6494582-6494604 CAACCCAGATATCCTTCAACAGG - Intronic
1135157479 16:20065309-20065331 CCACTCAGCTTTCCAGCCAGTGG - Intronic
1137726555 16:50660586-50660608 CCTCCCTGATTTCATTCCACAGG - Intergenic
1138100937 16:54251957-54251979 CCACCCAGCATTCTTCCCGCTGG - Intronic
1141737963 16:85867748-85867770 CTCCCCAGCCTTCCTTCCAAAGG + Intergenic
1142804687 17:2365193-2365215 CCACCTACCCCTCCTTCCACAGG + Exonic
1143728426 17:8865899-8865921 CCACCAAGCTTCCCTGCCCCTGG - Intronic
1144574501 17:16420364-16420386 CCCCCCAGCCATCCTTCCAGTGG - Intronic
1147250302 17:39149297-39149319 GCTCCCAGCTGCCCTTCCACTGG + Intronic
1147360874 17:39928798-39928820 ACACCTACCTTTCCTTCCCCAGG + Intergenic
1148463384 17:47850763-47850785 CCGCCCAGTTTTCCCTCCATCGG + Intronic
1148773470 17:50079924-50079946 CCACCCAGCTAGGCTTCAACCGG - Intronic
1148852825 17:50562930-50562952 CCCTCCACCTTTCCTTCCCCCGG - Intronic
1151494460 17:74451108-74451130 GCTCCCTGCTTCCCTTCCACTGG - Intronic
1151788794 17:76290626-76290648 CCACCCAGCTCTGCTTCCCAAGG + Intronic
1151816625 17:76474369-76474391 CCACCGAGCAGTCCTTCCGCTGG + Exonic
1152123794 17:78434378-78434400 CAGCCCAGCTTTCCTTGCAGCGG - Intronic
1152276446 17:79360585-79360607 CCAGCCAGGTATCCCTCCACGGG - Intronic
1152368657 17:79871580-79871602 CAACCCCTCTTTCCTTCCAGTGG - Intergenic
1152523184 17:80872453-80872475 CCACCCAGCTGTCCCAGCACTGG + Intronic
1153143301 18:2000001-2000023 TCACCCAGCTTTACTATCACTGG - Intergenic
1153960447 18:10135701-10135723 CCCCCCAGCTTTCCTTTAGCTGG - Intergenic
1155031399 18:21987984-21988006 CAACCCAGATGTCCTTCAACAGG + Intergenic
1156216384 18:35002338-35002360 CCACCCAGGTATCTTTCAACAGG - Intronic
1156346000 18:36257703-36257725 TCACCCAGCTCTCATGCCACAGG + Intronic
1156370594 18:36468544-36468566 GCACTCACCTTCCCTTCCACTGG - Intronic
1158069120 18:53449904-53449926 TCACCCCTCTTTCCATCCACTGG + Intronic
1159453510 18:68632347-68632369 CAACCCAGATTTCCTTCAACTGG + Intergenic
1160536320 18:79596255-79596277 TCACACAGCTTTCCTCTCACTGG + Intergenic
1161282982 19:3455847-3455869 CCACCCCCCTTTCCCTGCACCGG + Intronic
1161479224 19:4502374-4502396 CCGCCCAGCTCTCCTGCCACTGG - Exonic
1161600982 19:5182560-5182582 CCACCCAGGTACCCTTCAACAGG - Intronic
1162137950 19:8567752-8567774 CCACGAAGCTGTCCTTCCCCAGG + Intronic
1162752428 19:12836924-12836946 CCAGCCAGTTTTCTATCCACAGG - Intronic
1163530923 19:17848344-17848366 CCAGCCAGGTTTCCTTCCCTGGG - Intergenic
1163649539 19:18509355-18509377 CAACCCAGCTTACCCTCCTCAGG + Intronic
1163741811 19:19018905-19018927 CCACCCAGCTGGCCTACCACTGG + Intronic
1164614490 19:29658502-29658524 CCACCCATTTTCCCTTCCAGAGG + Intergenic
1164737200 19:30550542-30550564 CCTTCCTGCCTTCCTTCCACAGG - Intronic
1164876363 19:31693531-31693553 CCTGACTGCTTTCCTTCCACGGG - Intergenic
1165591358 19:36972733-36972755 CCACCCAGGGTACCCTCCACAGG - Intronic
1166730929 19:45058732-45058754 CCGCCCAGCCCTCCTTCCTCTGG + Intronic
925118116 2:1397631-1397653 CCTCCCAGCTCTGCCTCCACAGG - Intronic
926794341 2:16606592-16606614 CTGCCCAGCTTTCATTCCACAGG + Intronic
927493096 2:23533364-23533386 CATCCCAGCTTTCTTTCCAAAGG - Intronic
928072378 2:28230194-28230216 ATACCCAGATTTTCTTCCACTGG + Intronic
928117572 2:28557949-28557971 CCACCCAGGTTTGCTTCATCTGG + Intronic
929298940 2:40279566-40279588 CCAACCAACTTTCATTGCACAGG + Intronic
929994542 2:46817187-46817209 CTACCCAGCTTTCCCTCACCAGG + Intronic
931424634 2:62159514-62159536 CAGCCCAGATGTCCTTCCACAGG + Intergenic
931430162 2:62202901-62202923 GCCCCCAGCTTTCCTGCCTCTGG + Intronic
932134102 2:69213651-69213673 CCACCAAGCTGTGCTTCCACAGG - Intronic
932430124 2:71669066-71669088 CCACCTAGATTTCCTACCAAAGG - Intronic
932549112 2:72748748-72748770 CCACCCTGCTTTTATTCCTCTGG - Intronic
934166184 2:89296383-89296405 CCACCCAGTTCTCCTTGCCCTGG + Intergenic
934201091 2:89886073-89886095 CCACCCAGTTCTCCTTGCCCTGG - Intergenic
936046436 2:109191660-109191682 CCACCCAGCTATACTGCCATGGG - Intronic
937910137 2:127071589-127071611 CCACTCAGCTTTCCTGGCTCTGG - Intronic
938415693 2:131101959-131101981 GCACCCAGCCTTCTTTCCCCTGG + Intergenic
943059237 2:183021114-183021136 CCACCCAGCAATTCTTTCACAGG + Intronic
943801394 2:192062394-192062416 CAACCCAGATATCCTTCAACAGG - Intronic
944501381 2:200363855-200363877 CCTCCCAGTTTTCCTTCCTCTGG - Intronic
946161041 2:217836209-217836231 ACACCCTGCTTTCCTCCCAGGGG - Exonic
946477708 2:220024659-220024681 CCATCCAGCCCTCCTTCCACAGG - Intergenic
947003594 2:225486151-225486173 CCACCAAGCCTTCCTTCTCCTGG + Intronic
948004408 2:234595469-234595491 TATCCCAGCTTTCCTTCCATCGG - Intergenic
948374869 2:237514806-237514828 TCCCCCATCTTTCCTTCCACTGG + Intronic
948436137 2:237955836-237955858 CCACCCAACTCTCCTGCCCCGGG + Intergenic
948475657 2:238217363-238217385 CCACCCATCATTCTCTCCACAGG - Intergenic
948981008 2:241494753-241494775 CTGCCCAGCATTCCTTCCAACGG + Exonic
1170649132 20:18223945-18223967 ACACCCAGCTTGCCTGCTACAGG + Intergenic
1170876542 20:20254962-20254984 CCTCCCAGCTCTCTTTCCAGAGG + Intronic
1171182521 20:23101240-23101262 CAACCCAATTATCCTTCCACAGG + Intergenic
1172056835 20:32159935-32159957 CCACCCTGCTCCCCTTCCCCTGG - Intronic
1172096555 20:32463362-32463384 CCACCCTGCTTTCATCACACTGG - Intronic
1172613411 20:36267690-36267712 CCACCCAGCTCCCCTCCCACAGG + Intronic
1173408099 20:42784679-42784701 TCACCCAGCTTTGGTTCAACTGG - Intronic
1173860860 20:46282749-46282771 CCACCCACCCTTCCCTCCCCCGG - Intronic
1173895819 20:46550026-46550048 ACACCCAGGTGGCCTTCCACAGG + Intronic
1174167828 20:48597897-48597919 CCACCCTGCTGACCTCCCACTGG + Intergenic
1174818531 20:53707851-53707873 CCACCCACCTTCCTTCCCACTGG - Intergenic
1176197636 20:63844690-63844712 ACACCCACCCTTCCTTCCTCAGG - Intergenic
1178594509 21:33940939-33940961 ACACCCAGTGTTCTTTCCACTGG + Intergenic
1179617683 21:42592705-42592727 CCAGCAAGCTTTCCGGCCACTGG - Intergenic
1179911797 21:44454891-44454913 CCACCCTGCGTTCCTTCCTTGGG + Intergenic
1181327243 22:22059264-22059286 CCACCCAGCTTCCCTAGCCCAGG + Intergenic
1181646005 22:24232190-24232212 CCAGCCAGCTCTTCTTCAACGGG - Exonic
1182085617 22:27559230-27559252 CCACCCAGGTGCCCTTCAACAGG + Intergenic
1182423566 22:30260249-30260271 CTTCCCAGCTTTTCCTCCACAGG + Intergenic
1182522132 22:30890706-30890728 CCACCCACCTGTCCACCCACAGG + Exonic
1183368059 22:37417591-37417613 CCACCCAGCTTTCCTTCCACAGG - Intronic
1184334896 22:43847424-43847446 GCACCCAGCACTCCTCCCACTGG + Intronic
1185063667 22:48620224-48620246 CCAGCCACCTCTCCCTCCACAGG + Intronic
949239970 3:1859406-1859428 CCTCCAAGCTTTCCTACCCCTGG + Intergenic
950440580 3:13007941-13007963 TCACCAAGCTCTCCTCCCACAGG - Intronic
952385705 3:32840223-32840245 CCACCCCCCTTCCCTTCCAAAGG + Intronic
955119160 3:56038560-56038582 TGACCCAGCTATCCTTCCACTGG + Intronic
955327535 3:58020884-58020906 GCAGTCAGCTTTCCTTCAACAGG + Intronic
955769495 3:62373621-62373643 CCCCCCCCCTTTCCTTCCACCGG - Intronic
956275116 3:67491268-67491290 CTACCCTGCTTTCTCTCCACAGG - Intronic
959509303 3:107191757-107191779 CAACCCAGATGTCCTTCAACAGG + Intergenic
961098077 3:124174782-124174804 AGACACAGCTTTCCTTCCTCTGG - Intronic
961689225 3:128656401-128656423 ACACCCAGCATTCCTTTCCCTGG - Intronic
962594413 3:136925737-136925759 CCACCCAGATGTCCTTCAACAGG - Intronic
964646548 3:158964279-158964301 CCTTCCACCTTTCCTCCCACTGG - Intronic
965266379 3:166549063-166549085 CAACCCAGCATTCCTACTACTGG + Intergenic
965609851 3:170532369-170532391 CCTCCCTGCTTTTCTTCCTCTGG + Intronic
965880467 3:173382514-173382536 CCAACCAGCTTTGTTTACACTGG - Intergenic
966842058 3:184097976-184097998 CCATCCATCTTTCTATCCACAGG + Intronic
966847224 3:184140058-184140080 CCACTCCACTTCCCTTCCACAGG + Exonic
968441208 4:625411-625433 ACTCCCAGCCTTCATTCCACAGG + Intergenic
968496811 4:922894-922916 CAGCCCAGATGTCCTTCCACGGG + Intronic
969038035 4:4271834-4271856 CCACCCAGGTGTCCCTCCACAGG + Intronic
969193173 4:5540420-5540442 CGACCCAGATTTCCATCAACAGG + Intergenic
971673254 4:29591771-29591793 CCATCAAGCTTTCATTCCAGTGG - Intergenic
974451143 4:62061859-62061881 CAACCCAAATTTCCTTCAACTGG - Intronic
975392877 4:73839664-73839686 CCTCCCATCTTTCCTTCCTTTGG + Intronic
975884559 4:78949282-78949304 CAACCCAGATGTCCTTCAACAGG - Intergenic
976318958 4:83689639-83689661 CCACCCATATGTCCTTCAACAGG - Intergenic
979663131 4:123281682-123281704 CCACCAAGATGTCCTTCAACAGG + Intronic
981340057 4:143611326-143611348 GCTCCCAGCTGTCCTCCCACTGG + Exonic
982367707 4:154598348-154598370 TCACCCAGATTTTCTTCTACTGG - Intergenic
983523817 4:168739281-168739303 CCATCCAGCAATCCTACCACCGG - Intronic
983749797 4:171252882-171252904 CCACCAAGATTTCCTTCAATGGG - Intergenic
984995980 4:185430509-185430531 CCACCCAATTCTTCTTCCACAGG - Intronic
987634781 5:20526076-20526098 CCTCCCAGCCTCCCTTGCACTGG - Intronic
987945406 5:24601756-24601778 CATTCAAGCTTTCCTTCCACTGG - Intronic
991013425 5:61907781-61907803 CAACCCAGCAATCCTACCACTGG + Intergenic
991496804 5:67234879-67234901 CCACCAAGTGTCCCTTCCACCGG - Intergenic
993901324 5:93585600-93585622 CGTCCCAGCTTTCCTTCTCCCGG + Intronic
993903202 5:93597855-93597877 CCACCCAGCTTTGCATTCAGGGG + Intergenic
995368193 5:111387541-111387563 CCACACAGCTGTTCTTCCTCTGG + Intronic
995996537 5:118307286-118307308 CCACACATCTTTGCTTCCAAAGG - Intergenic
996771276 5:127088478-127088500 CCACCCAGATTCCCCTCCCCTGG - Intergenic
997596291 5:135109330-135109352 CTACCCAGAGTTCCTTCCATGGG + Intronic
1002088218 5:176789141-176789163 CCAGCCTTCTTGCCTTCCACCGG + Intergenic
1002629092 5:180557142-180557164 CCACCCAGATTTCCTTCAGCAGG - Intronic
1004301049 6:14457516-14457538 CCACTCAGGTTAGCTTCCACCGG + Intergenic
1005080190 6:21949308-21949330 ACAACCTGCATTCCTTCCACAGG - Intergenic
1005352690 6:24951908-24951930 CCACCCTGCTTACCTTCCGCTGG + Intronic
1006607695 6:35270493-35270515 CCACTCAGTCATCCTTCCACAGG + Intronic
1008237784 6:49070818-49070840 CCTTCCTCCTTTCCTTCCACTGG + Intergenic
1009244113 6:61213784-61213806 CCACTCAGAGTTCCTTCCATTGG + Intergenic
1009974204 6:70655569-70655591 CCACTCAGCTCTTCTGCCACAGG - Intergenic
1010269085 6:73901023-73901045 CCACACTGCTACCCTTCCACTGG - Intergenic
1010955538 6:82087085-82087107 CCACCCAGCTTAACTTCCCTAGG + Intergenic
1014787070 6:125631333-125631355 CCACGCAGCCTGCCTCCCACTGG + Intergenic
1015705673 6:136085034-136085056 CCACCCAGCTCTCCTGCAAGTGG - Intronic
1018377378 6:163226198-163226220 CCAATCCGCTTTCCTTCCCCAGG - Intronic
1019129721 6:169864775-169864797 CCACCCAGCTGTGACTCCACCGG - Intergenic
1020436052 7:8163699-8163721 GCACACACTTTTCCTTCCACTGG - Intronic
1020954754 7:14726914-14726936 CCACAGAGCTTTCATTCCAGGGG + Intronic
1021171350 7:17401770-17401792 GCACCCAGCTTCCTTTCCAAAGG + Intergenic
1022261963 7:28714443-28714465 CCACCCTGCTGTCCTTTCTCAGG - Intronic
1022581323 7:31557887-31557909 GCACAGAGCTTTCCTTCCAGGGG - Intronic
1023659950 7:42460911-42460933 CCTCCCAGCCTTCCTCGCACTGG - Intergenic
1024287294 7:47769592-47769614 CCACCTTGGTTTCCTTGCACAGG + Intronic
1025716829 7:63965190-63965212 CCATACAGCTTTACATCCACTGG - Intergenic
1026210159 7:68296882-68296904 CCTCCCAGCTTCCCTTGCAGTGG - Intergenic
1027056251 7:75051907-75051929 CCACCCAGTTTTTGTTCCAGAGG - Intronic
1027335983 7:77151208-77151230 CCACCCACATGGCCTTCCACAGG + Intronic
1027603808 7:80274111-80274133 CCAACCAGCTTTCCTTTCCGAGG + Intergenic
1027971910 7:85094520-85094542 CTTCCTAGCTTTCCTCCCACTGG + Intronic
1028153633 7:87405111-87405133 TAACCCAGCTATCCTTCAACAGG + Intronic
1028205337 7:88010387-88010409 CCAACCTGCTTACCTTCCAGTGG - Intronic
1028437999 7:90827349-90827371 CAACCAAGATGTCCTTCCACAGG - Intronic
1028669293 7:93382792-93382814 CAACCCAGCTGTCCATCAACAGG + Intergenic
1029779805 7:102719888-102719910 CCACCCACATGGCCTTCCACAGG - Intergenic
1030492891 7:110260796-110260818 CCACCCAAGTCTCCTTCAACAGG + Intergenic
1031590258 7:123582239-123582261 TCACACATCCTTCCTTCCACAGG - Intronic
1032507359 7:132445754-132445776 CCACCCTGCCTTCCATCCACAGG - Intronic
1034326410 7:150237817-150237839 CCAAGCATATTTCCTTCCACTGG + Intergenic
1034766804 7:153731439-153731461 CCAAGCATATTTCCTTCCACTGG - Intergenic
1035058530 7:156052326-156052348 GCACCCACCTGTCCATCCACAGG + Intergenic
1035377516 7:158415311-158415333 CCCTCCTGCTTTCCTTCCTCAGG + Intronic
1035650380 8:1259647-1259669 CAGCCCAGCTCTGCTTCCACAGG + Intergenic
1037875458 8:22544966-22544988 TTACCCAGCTTTCCTTGCCCAGG + Intronic
1038321480 8:26531289-26531311 CCCCCGAGCTGCCCTTCCACAGG - Intronic
1041781882 8:61585770-61585792 CCACACAGCCTTCCCTCCTCTGG - Intronic
1042586626 8:70346694-70346716 CCTCCCTGCCTCCCTTCCACTGG - Intronic
1044844618 8:96367883-96367905 CAACCCAGATGTCCTTCAACAGG - Intergenic
1045681070 8:104660798-104660820 ATACCCAGCTTTCTTTCCAATGG - Intronic
1045903972 8:107320557-107320579 CTACCATGCTTTCCTTCCAGTGG + Intronic
1047082294 8:121476384-121476406 CAACCCAGCTATCCTACTACTGG - Intergenic
1048386075 8:133913703-133913725 CGGCCCAGCTTTGCTTTCACAGG - Intergenic
1054965595 9:71023576-71023598 CAACCCAGATGTCCTTCAACAGG + Intronic
1055488377 9:76779552-76779574 CCACAATGCTGTCCTTCCACAGG - Intronic
1056736405 9:89213708-89213730 CAACCCAGGTGTCCTTCAACAGG + Intergenic
1056743440 9:89279925-89279947 GCTTCCAGCTTCCCTTCCACTGG - Intergenic
1056972925 9:91223468-91223490 CAACCCAGGTATCCTTCCAGGGG - Intronic
1057576046 9:96243783-96243805 GCACTCTGCTTCCCTTCCACAGG - Intronic
1058315532 9:103560776-103560798 GCACACAGATTTCCTTCAACTGG - Intergenic
1061327971 9:129875491-129875513 CCACCCTGCTCTCCCACCACAGG - Intronic
1061400760 9:130367085-130367107 CCAACCAGCATTCCTGCCCCAGG - Intronic
1186921932 X:14291843-14291865 CCAAGCAGCATTCCTGCCACTGG - Intergenic
1187284592 X:17892697-17892719 CAACCCAGATGTCCTACCACAGG + Intergenic
1187604093 X:20864248-20864270 TAACCCAGCTTTCCTTCTCCAGG + Intergenic
1188698353 X:33226311-33226333 CAACCCAGATGTCCTTCAACAGG + Intronic
1189134896 X:38538413-38538435 CCACATTGCTTTGCTTCCACTGG - Intronic
1191726855 X:64290855-64290877 CAACCCAGATGTCCTTCAACAGG - Intronic
1191826743 X:65374509-65374531 CCACCAAGCATCCCTCCCACAGG + Intronic
1192569303 X:72189824-72189846 CAACCCAGCTGTCCTTCAACAGG - Intronic
1192581804 X:72289150-72289172 CCACCCAGATATGCTTCCATGGG - Intronic
1194115328 X:89889164-89889186 CCACCCCTCTTTCCACCCACTGG - Intergenic
1195711183 X:107775099-107775121 CCATCCTGCTCTTCTTCCACAGG - Exonic
1196770905 X:119292392-119292414 CCAACCTGCTCTACTTCCACGGG - Intergenic
1198274141 X:135085590-135085612 CCACCCCTCCTTCATTCCACAGG - Intergenic
1198817324 X:140605995-140606017 CAACCCAGATGTCCTTCAACAGG - Intergenic
1199418428 X:147614553-147614575 CCACCCACCTTGCCTACTACCGG + Intergenic
1200468120 Y:3546303-3546325 CCACCCCTCTTTCCACCCACTGG - Intergenic
1200760116 Y:7029954-7029976 GCACCCAAATGTCCTTCCACAGG - Intronic
1201322804 Y:12718941-12718963 TCACCCAACTGTCCTTCAACAGG - Intronic