ID: 1183375457

View in Genome Browser
Species Human (GRCh38)
Location 22:37462216-37462238
Sequence GCACCCTGGGATCTGATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183375457_1183375461 9 Left 1183375457 22:37462216-37462238 CCCAGTATCAGATCCCAGGGTGC 0: 1
1: 0
2: 0
3: 2
4: 124
Right 1183375461 22:37462248-37462270 TCCACCTTATTGTCCGTGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 59
1183375457_1183375464 21 Left 1183375457 22:37462216-37462238 CCCAGTATCAGATCCCAGGGTGC 0: 1
1: 0
2: 0
3: 2
4: 124
Right 1183375464 22:37462260-37462282 TCCGTGTCTGGCACTGTAACTGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183375457 Original CRISPR GCACCCTGGGATCTGATACT GGG (reversed) Intergenic
901629591 1:10641655-10641677 TCCCCCTGGGATCTGGCACTAGG - Intronic
902894955 1:19473180-19473202 GCACCCTGGAGTCTGATCCAAGG - Intronic
903017521 1:20370811-20370833 GGCCCCTGGGCTCTAATACTGGG - Intergenic
905631351 1:39520731-39520753 GCAACCTGGGCTCTGGGACTTGG + Intronic
905666405 1:39765440-39765462 GCAACCTGGGCTCTGGGACTTGG - Intronic
905749452 1:40449931-40449953 GCTCGCAGGGATCGGATACTGGG + Intergenic
906648123 1:47490775-47490797 GAACCCTGGACTCTGATTCTGGG + Intergenic
907183433 1:52590470-52590492 TCACCCAGGGATCTGAAGCTGGG + Intergenic
907610633 1:55866465-55866487 GCATCTTGGCATCTGATTCTTGG + Intergenic
916168796 1:161985520-161985542 TCACCCTGGGATCAGACATTTGG - Intronic
916254793 1:162775887-162775909 GTAACCTGGGATCTGAAAATAGG + Intronic
920532635 1:206715045-206715067 GCATCCTGGGATGTAATTCTGGG + Intronic
920846576 1:209598304-209598326 GCACCCTGGCCTCTGATAACTGG + Intronic
921934960 1:220787390-220787412 GAGCCCTGGGGTCTGATGCTGGG - Intronic
1063822836 10:9856787-9856809 CCACCCTGAGATCTGAAAATGGG + Intergenic
1066041156 10:31549016-31549038 GCAGCGTGGGATCTGCTTCTGGG - Intergenic
1066127233 10:32353188-32353210 GCACTCTGGAATCAGATACCAGG - Intronic
1069579079 10:69552881-69552903 GCTCCCAGGGATCTGGTCCTGGG + Intergenic
1071560685 10:86644929-86644951 GCACCCTGGCAGCTGCTTCTTGG + Intergenic
1077073852 11:690882-690904 CCACCCTGGCATCTGCCACTTGG + Intronic
1079154361 11:17930698-17930720 GAACCCTGTCATCTGATTCTAGG - Intronic
1081018165 11:37908177-37908199 GGACCCTGGGATCTGACAATTGG - Intergenic
1081099733 11:38986756-38986778 GCACCCTGGGGACTTAGACTGGG - Intergenic
1081547584 11:44082814-44082836 CCACACTGGGATCTGAACCTTGG + Intronic
1082577911 11:54832702-54832724 GCAGCTTGGGATCTGAAAATGGG - Intergenic
1086901255 11:92370367-92370389 ACAACCTCGGATCTCATACTTGG - Intronic
1090090519 11:123693087-123693109 CTACCCTGGGACCTGATAATGGG + Intergenic
1091421336 12:343263-343285 GCACCCTGGAAGCTCAAACTGGG + Intronic
1092140226 12:6178656-6178678 GCTCCCTGAGGTCTGAGACTGGG + Intergenic
1096077498 12:48814627-48814649 GCAGCCTGGGGTCTCCTACTGGG + Intronic
1096536407 12:52277961-52277983 GGCCCCTGGTCTCTGATACTGGG - Intronic
1105622641 13:22083641-22083663 GCACCCTGGGAAATGTTAATTGG - Intergenic
1106660148 13:31790956-31790978 GCAGCCAGGGGTCTGATACCAGG + Intronic
1110600085 13:77363139-77363161 GAATCCTGGGATCTGACTCTAGG + Intergenic
1111649045 13:91066629-91066651 AGACCCTGAGATCTGACACTTGG + Intergenic
1111931292 13:94515571-94515593 GCATCATGGGTTCTGATACAAGG + Intergenic
1115707703 14:36015163-36015185 AGACCCTGGGATCTGACAATTGG - Intergenic
1117528971 14:56640163-56640185 GCAGCCTGAGATCTGAGAATGGG + Intronic
1118777814 14:68984543-68984565 CCACCCTGTGAAATGATACTGGG + Intergenic
1119757377 14:77128597-77128619 GCTCCCTGAGATCAGGTACTGGG + Intronic
1120017766 14:79493444-79493466 GCATCCTGGAATCTTCTACTGGG + Intronic
1121817505 14:96939892-96939914 GCCCACTGGGCTCTGATCCTCGG - Intergenic
1124232792 15:27959986-27960008 GAAGCCTGGGAACTGATACATGG - Intronic
1129170602 15:73805271-73805293 GGACCCAGGGATCTGAGAATGGG + Intergenic
1129452242 15:75657579-75657601 GCACCCTTGGGTCGGATGCTGGG + Exonic
1129465783 15:75723524-75723546 ACACCCTGGGATAGGATTCTGGG + Intergenic
1134442623 16:14308278-14308300 GCAGCCTGGGATATCACACTGGG - Intergenic
1135623363 16:23974908-23974930 TCTCCCTGGGATTTGATTCTTGG - Intronic
1141381021 16:83577148-83577170 GCACCATGTGACCTGATGCTTGG - Intronic
1142507461 17:373973-373995 CCACTCCGGGATCTGAAACTTGG - Intronic
1143251230 17:5524725-5524747 GAATCCTGGGATCTGGTCCTAGG - Intronic
1152934984 17:83131430-83131452 GGACCCTGGGGTCTGAAGCTTGG - Intergenic
1155172205 18:23275361-23275383 GCAGCCTTGGACCTGAAACTGGG + Intronic
1158680033 18:59559002-59559024 GGACCCCGGGATCTGACAATTGG + Intronic
1159551951 18:69904428-69904450 GCAGCCTGGGCTCTGAAGCTGGG - Intronic
1160049388 18:75418063-75418085 GCCCACTGGTATCTGAAACTTGG + Exonic
1161036536 19:2088079-2088101 GCACCCCGGGGACTCATACTGGG + Intronic
1166399294 19:42466173-42466195 GCAGCCTGGGATGTGAAACGGGG + Intergenic
1166567185 19:43772364-43772386 CCACTCTGGGATTTGAGACTGGG + Intronic
1167163671 19:47783591-47783613 GCACACTGGGAGCTGGTACTTGG - Intronic
925017173 2:538948-538970 TCACCCTGGGGTCTGGTACCAGG - Intergenic
926208060 2:10847945-10847967 GCACTCTGGGACCTGAGACCAGG + Intronic
927114636 2:19888311-19888333 GCACCCTGGAATTAGATGCTGGG + Intergenic
928462666 2:31489558-31489580 GCATCCTGGAAGCTGAAACTGGG + Intergenic
931665959 2:64609581-64609603 CCACCCTGGGATCTGAGCCCGGG + Intergenic
937065972 2:119018011-119018033 GGACCCTGGGATTTGCTATTGGG - Intergenic
937316505 2:120935178-120935200 GCCCCCTGGGATGAGATGCTGGG + Intronic
940760597 2:157734483-157734505 GCACCCAGAGAGCTGATCCTTGG + Intergenic
945641413 2:212435792-212435814 GAACCCTGGGATCAAATCCTAGG - Intronic
946167251 2:217871835-217871857 CCATCCAGGGATCTGAAACTCGG + Intronic
946740577 2:222797081-222797103 GCACCCTGGGGCCTGATTATTGG - Intergenic
947736793 2:232459342-232459364 GCGCCCTGGGAGCTGAGCCTGGG + Exonic
1172206557 20:33166832-33166854 GCACCCTGGGCTATGTTCCTGGG + Intronic
1174401139 20:50276594-50276616 GCTCCCTGGGGTGTGAGACTGGG + Intergenic
1175860147 20:62145793-62145815 GTACCCAGGGATCTTTTACTGGG + Intronic
1176381792 21:6117464-6117486 GCACCCTGGGTGCGGGTACTGGG - Intronic
1179741680 21:43420775-43420797 GCACCCTGGGTGCGGGTACTGGG + Intronic
1181034975 22:20165515-20165537 GCAGCCTGGGATCTGCAGCTGGG + Intergenic
1182165053 22:28164312-28164334 GCAACCTGAGATCTGAGAATGGG + Intronic
1182819534 22:33203409-33203431 CCACCCTGTGTTCAGATACTGGG + Intronic
1183375457 22:37462216-37462238 GCACCCTGGGATCTGATACTGGG - Intergenic
953085814 3:39665905-39665927 GCACCATGGTATCTGTTGCTAGG + Intergenic
953760303 3:45681622-45681644 GGACCCTGGTATTTGATAATGGG + Exonic
961629851 3:128288557-128288579 GCACCCTGGGCCCTGAGATTTGG + Intronic
962193206 3:133332897-133332919 ACCCTCAGGGATCTGATACTTGG - Intronic
965113090 3:164451858-164451880 GCACACAGGGATGAGATACTGGG + Intergenic
967569870 3:191016093-191016115 GCAGCCTGGAAGCTCATACTGGG - Intergenic
968359649 3:198138122-198138144 GCCTCCTGGGAGCTGCTACTGGG + Intergenic
969056895 4:4407869-4407891 GCACCCTGGGCCCTGGTGCTGGG + Intronic
969480637 4:7445213-7445235 GCACCCTTGCAACAGATACTTGG + Intronic
973832277 4:54773702-54773724 CCAGCCTGGGAACAGATACTTGG - Intergenic
977436190 4:96998151-96998173 GATCCATGGGATCTGAGACTTGG + Intergenic
981315364 4:143336090-143336112 GCACCCTGGGATCTGTAGTTCGG - Intergenic
983877749 4:172896776-172896798 GCACCCTCTGAGCTGAGACTGGG - Intronic
989109809 5:37896411-37896433 GCACCCTGGGTGCTGTGACTGGG + Intergenic
992977097 5:82131853-82131875 GCATCCTGGCATCTGCTTCTGGG + Intronic
998461162 5:142311227-142311249 GCACCCTGGGAACTGGGTCTTGG - Exonic
998594114 5:143510210-143510232 GAACCCAGAGTTCTGATACTAGG - Intergenic
999776755 5:154818061-154818083 GAACCCTGAGATGTGATGCTGGG + Intergenic
1004035159 6:11916685-11916707 GCATCCTGGGAACTGGTACATGG - Intergenic
1004270692 6:14192680-14192702 GCAGCCTGAGATCTGTTCCTGGG - Intergenic
1004492750 6:16131209-16131231 GCACACTGTAATCTGACACTAGG - Intronic
1011044584 6:83067676-83067698 GCACTCTGGGAGCTGTCACTAGG + Exonic
1015553966 6:134441592-134441614 GCAGCCTGGTTTCTGATCCTAGG + Intergenic
1016887374 6:148970715-148970737 GCAGCCTGGGCACTGACACTTGG - Intronic
1017184561 6:151588019-151588041 GGAGCCTGGGACATGATACTTGG + Intronic
1019260342 7:78528-78550 GCCTCCTGGGAGCTGCTACTGGG - Intergenic
1027591437 7:80124060-80124082 TCATTCTGGGATCTGAAACTAGG + Intergenic
1032405644 7:131653515-131653537 GCACCCTGGGATCTGAAGGCTGG + Intergenic
1032841039 7:135713906-135713928 GAACCCTGGGAGCAGATACCTGG + Intronic
1034259469 7:149745775-149745797 GCACTCTGGGGGCTCATACTGGG + Intergenic
1034262426 7:149765241-149765263 GCACCACGGGATCGGATCCTGGG + Exonic
1034780056 7:153871123-153871145 GCAGCTTGGGATCTGAGAATGGG - Intergenic
1036219817 8:6911976-6911998 GCACCCTGGGCTCTGAACCCAGG - Intergenic
1039065592 8:33604815-33604837 GCACCCTGAAATCTGCTGCTGGG + Intergenic
1045940836 8:107736265-107736287 GCAGCCTGGTTTCTGATACATGG + Intergenic
1046872107 8:119215178-119215200 GCCTCCTGAGATCTGGTACTAGG + Intronic
1052998314 9:34563584-34563606 TCATCTTGGGATCTGATTCTAGG + Intronic
1053363326 9:37505023-37505045 GGACCCTGAGATGTGAGACTGGG - Intergenic
1055676522 9:78668134-78668156 GATGCCTGGGCTCTGATACTGGG + Intergenic
1062744356 9:138201943-138201965 GCCTCCTGGGAGCTGCTACTGGG + Intergenic
1187791023 X:22950446-22950468 GCACACTGGGAGCTGGAACTTGG + Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1190509702 X:51162779-51162801 GCAGCCTGTGATCTGATAACAGG - Intergenic
1194002083 X:88443082-88443104 TCAGCCTGGGATTTGATACAGGG - Intergenic
1198005041 X:132484598-132484620 GCATCCTGGAGTCTGATAGTTGG - Intronic
1198314434 X:135451977-135451999 GCTCCCTGGGCCCTGAGACTGGG + Intergenic