ID: 1183376762

View in Genome Browser
Species Human (GRCh38)
Location 22:37469816-37469838
Sequence TGGCAAGCCCAGGATCTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183376762_1183376766 -1 Left 1183376762 22:37469816-37469838 CCACTCAGATCCTGGGCTTGCCA 0: 1
1: 0
2: 0
3: 43
4: 214
Right 1183376766 22:37469838-37469860 AACCACCCGAAGGCCCTGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1183376762_1183376776 28 Left 1183376762 22:37469816-37469838 CCACTCAGATCCTGGGCTTGCCA 0: 1
1: 0
2: 0
3: 43
4: 214
Right 1183376776 22:37469867-37469889 CTATCACAAGACACTTGCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 98
1183376762_1183376775 27 Left 1183376762 22:37469816-37469838 CCACTCAGATCCTGGGCTTGCCA 0: 1
1: 0
2: 0
3: 43
4: 214
Right 1183376775 22:37469866-37469888 CCTATCACAAGACACTTGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1183376762_1183376767 0 Left 1183376762 22:37469816-37469838 CCACTCAGATCCTGGGCTTGCCA 0: 1
1: 0
2: 0
3: 43
4: 214
Right 1183376767 22:37469839-37469861 ACCACCCGAAGGCCCTGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183376762 Original CRISPR TGGCAAGCCCAGGATCTGAG TGG (reversed) Exonic
901441648 1:9281816-9281838 TGACATTCCCAGGAGCTGAGAGG + Intergenic
901659461 1:10789318-10789340 TGGCAGGCCCAGGGTTTGGGAGG - Intronic
901816998 1:11800017-11800039 TGGCAGGCCCAGGAGGGGAGTGG + Intronic
901910630 1:12454740-12454762 TGGAAGGCCCAGGAACTGGGTGG - Intronic
902415202 1:16234490-16234512 TGTCCAGCCCAGGATCTGATGGG - Intronic
902615957 1:17623657-17623679 TGGCAAGCCTGGGCTCAGAGTGG - Intronic
902821596 1:18946705-18946727 TGGCAAGCCCAGGCCCGGTGCGG - Intronic
902879927 1:19365177-19365199 TCTCAAGTCCAGGATGTGAGAGG - Intronic
902975661 1:20086367-20086389 TGGCAATCCCAAGATCTCAGTGG + Intronic
903327863 1:22581590-22581612 TGGAAACCCCAGGGCCTGAGTGG + Intronic
903945940 1:26962706-26962728 TGGGAAGCCAAGGATTTGGGAGG + Intergenic
904469093 1:30724859-30724881 TGGCAAGCTGAGGCTCAGAGAGG - Intergenic
905873446 1:41417828-41417850 TGTCAAGCCCAGCATGTGTGAGG + Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906041779 1:42793369-42793391 TGGGAAGACTAAGATCTGAGGGG + Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
906949386 1:50322221-50322243 TGGCAAGCCCTGGATCACACAGG + Intergenic
907947481 1:59148459-59148481 TTGCAAGCCCCAAATCTGAGAGG - Intergenic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
912551505 1:110488258-110488280 TGGCAGTCCCAGGACCTGTGGGG + Intergenic
913392681 1:118331964-118331986 TGGCAAGCCGAAAATCTGAAAGG + Intergenic
913960834 1:143337096-143337118 AGGGAAGCCCAGGGTCTGAGGGG - Intergenic
914055188 1:144162668-144162690 AGGGAAGCCCAGGGTCTGAGGGG - Intergenic
914123958 1:144803693-144803715 AGGGAAGCCCAGGGTCTGAGGGG + Intergenic
915167506 1:153956635-153956657 TGGCAACCCCAGTATCTCAGTGG + Intronic
916472359 1:165136877-165136899 TGGAAAGCCCAGGCTCTGGGTGG + Intergenic
916524624 1:165598116-165598138 TGGCACGCCCGGGACCTGCGTGG + Intergenic
918286882 1:183065342-183065364 TGGCAAGTCCAAAATCTGTGGGG + Intronic
918640121 1:186829606-186829628 TGGCAAGCCAAGTAACTTAGGGG - Intronic
920550499 1:206856672-206856694 TGGCCAGCCAAGGAGTTGAGTGG - Intergenic
920712621 1:208309657-208309679 TGGGGAGCCCAGGGTCAGAGTGG + Intergenic
1065643880 10:27814463-27814485 TGGCAGGCCAAGGAACTGAGAGG - Intronic
1066700862 10:38126610-38126632 TGGCCATCCCCTGATCTGAGTGG - Intergenic
1067062303 10:43083716-43083738 TGGCGGGCCCAGCAGCTGAGGGG + Intronic
1069266609 10:66466225-66466247 TGGCAAGCCCAGAATATGCAGGG - Intronic
1070315080 10:75302609-75302631 TGGCTAACCCAGGATATGTGAGG + Intergenic
1072798535 10:98375286-98375308 TGCCAAGCCCAGGTGCTCAGTGG - Intergenic
1073107291 10:101039420-101039442 TGGCAATCCCTGGGCCTGAGTGG + Intronic
1073329650 10:102661761-102661783 TGACAATGACAGGATCTGAGTGG - Intergenic
1075296563 10:121281521-121281543 TGGCAAGTCCAAAATCTGTGGGG - Intergenic
1075785275 10:125045223-125045245 TGGCAGATCCAGGATCTGGGAGG - Intronic
1076819477 10:132931346-132931368 AGGAAAGCCCAGGCTCTGCGTGG - Intronic
1076819815 10:132932605-132932627 GGGGAAGCCCAGGCTCTGTGTGG - Intronic
1077467497 11:2740509-2740531 TGGCAGGCCCCGAATGTGAGCGG + Intronic
1078709288 11:13775472-13775494 TGGAAAGCTCAGGCCCTGAGAGG + Intergenic
1079536542 11:21522004-21522026 TTGCAAGCCATGGATCTGACAGG - Intronic
1081717243 11:45259124-45259146 TGGCAATCACAGCATCTCAGGGG + Intronic
1085412896 11:76302065-76302087 TGGCAAGTCCTGGATTTGAGGGG - Intergenic
1085650792 11:78266849-78266871 TGGCAAAAGCAGGTTCTGAGTGG + Intronic
1088044751 11:105435163-105435185 TGTAAAGCCCAGTATGTGAGAGG + Intergenic
1089132526 11:116223873-116223895 GAGCAAGCCCAGAATCTGACTGG + Intergenic
1089329613 11:117680401-117680423 TGGCCTAGCCAGGATCTGAGGGG - Intronic
1090837242 11:130462425-130462447 TGGCTAGCCCAGAATCTGAATGG - Intronic
1091045174 11:132318796-132318818 TTGCAAGGCCAGAATGTGAGGGG - Intronic
1095702567 12:45205427-45205449 TGGGTAGCCCAGGGTCTGGGAGG + Intergenic
1096783287 12:54003137-54003159 TTCCCAGCCCAGGAGCTGAGGGG + Exonic
1097063393 12:56302283-56302305 TGGAAAGCACAGGATCAAAGCGG + Intronic
1098437386 12:70482243-70482265 TGGGAAGCCCAGGGTCTCAAAGG - Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1101641796 12:106591036-106591058 TGGCAGAACCAGGATTTGAGCGG + Intronic
1102024522 12:109706603-109706625 TGGGAAGCTGAGGATCAGAGAGG + Intergenic
1102869792 12:116404973-116404995 TGGCAAGCCCAAAATCTGCAAGG + Intergenic
1103049790 12:117769039-117769061 TGGCAAGCTCAGGGTCAGACAGG + Intronic
1103981678 12:124740927-124740949 TGGGAAGCGCTGGATCTGGGTGG - Intergenic
1104268861 12:127263967-127263989 TGGCGAGCCAAGGCTCTGAGGGG - Intergenic
1112492629 13:99880958-99880980 CGGAAAGCCCAGGTTCAGAGAGG - Intronic
1117512411 14:56466273-56466295 TGGCCAGACCAAGATCTGCGTGG + Intergenic
1118565204 14:67132018-67132040 AAGTAAGCCCAGGATTTGAGTGG - Intronic
1119086489 14:71743977-71743999 TGGCAGGCCCAGGAGAGGAGGGG - Intergenic
1119595395 14:75928167-75928189 CGGCTAGGCCAGGATCTCAGAGG - Intronic
1119925151 14:78486593-78486615 AGACAAGCCCAGGCTCTCAGTGG - Intronic
1120658038 14:87219069-87219091 TGACAAGCCCAGGCTTTTAGTGG + Intergenic
1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG + Intergenic
1122620190 14:103052511-103052533 TGGCCAGCCCAAGGTGTGAGTGG - Intronic
1122725483 14:103748006-103748028 TGGCAAGTCCAGAATCTGTGAGG - Intronic
1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1123709993 15:22980210-22980232 TGGCCGGCCCAGGTTCCGAGGGG + Intronic
1124418154 15:29491191-29491213 GGGCTAGCCCAAGATCTGGGTGG - Intronic
1124479307 15:30063993-30064015 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1125731399 15:41894455-41894477 AGCCAAGCCCAGGGTCTGTGAGG - Intergenic
1126795453 15:52257364-52257386 TTGCAAGCTCAAGAACTGAGAGG + Intronic
1127385088 15:58460588-58460610 TGGGAAACCCAGGCTCTGATGGG + Intronic
1128306106 15:66600013-66600035 TGGAATGCCCGGGCTCTGAGTGG + Intronic
1128646006 15:69379473-69379495 TGGCAAGCCCTGCATGTCAGGGG - Intronic
1128682483 15:69662008-69662030 AGGCAATCCCAGGGTCTGTGGGG + Intergenic
1130483911 15:84387095-84387117 TGGCAAGGGCAGGGACTGAGCGG - Intergenic
1132204657 15:99978078-99978100 CGGGAAGCACAGGATCTGCGGGG - Intronic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1135425260 16:22329577-22329599 TGGCAGGCTGAGGATCTAAGGGG + Intronic
1135993284 16:27230324-27230346 TGGGAAGCCCTGTGTCTGAGAGG + Intronic
1141862006 16:86723838-86723860 TGTTAAGCCCTTGATCTGAGTGG - Intergenic
1141898916 16:86977446-86977468 TGGTCAGCCCAGGATGAGAGGGG + Intergenic
1142624895 17:1185754-1185776 AGGCCACCCCAGGATCTGACAGG - Intronic
1143120439 17:4603226-4603248 TGGCAAGACCTGGTTCGGAGAGG + Intronic
1144101715 17:11947738-11947760 TGGCCAGCCCAGAATCTGGGAGG + Intronic
1144140117 17:12340140-12340162 TGGAAAGCCCAGCATGTGTGTGG - Intergenic
1146267928 17:31465312-31465334 TGACTAGCCCAGGATGTGGGTGG + Intronic
1148161337 17:45451843-45451865 TGTGAAGGCCAGGCTCTGAGGGG - Intronic
1148180231 17:45600252-45600274 TGGCAGGCCTAGGACCTCAGCGG - Intergenic
1148268667 17:46245643-46245665 TGGCAGGCCTAGGACCTCAGCGG + Intergenic
1151189174 17:72385476-72385498 TGACAATCACAGGATCTGGGTGG - Intergenic
1152276527 17:79361221-79361243 TGGCAAGCCGAGGATGGGATTGG - Intronic
1152581597 17:81167765-81167787 TGGCCAGCCAAGGTTCTAAGGGG + Intergenic
1155964039 18:32019317-32019339 TGGCGAGCCCTGGCTCTGGGCGG - Intronic
1156000718 18:32381188-32381210 TGGCAAGCCCAAGAACTAAAAGG + Intronic
1157615749 18:48986879-48986901 TGTCATGCCCAGGGACTGAGTGG + Intergenic
1158016290 18:52788454-52788476 TAGCAAGCCTAGTATCTAAGTGG + Intronic
1160754376 19:750047-750069 TGGGGAGCCCAGCATCTGTGGGG - Intergenic
1161298577 19:3532102-3532124 GGGGAAGCCCAGGCTCTGGGCGG - Intronic
1161558710 19:4958612-4958634 TGGGAAGCTCAGCATCGGAGGGG + Intronic
1161821382 19:6533063-6533085 TGTCAAGCCCCAGCTCTGAGAGG - Intronic
1162043321 19:7983469-7983491 TGGCAAGGGCAGGACCAGAGGGG + Intronic
1162554553 19:11378651-11378673 AGGGAAGCCCAGGCACTGAGGGG + Intronic
1163323960 19:16591290-16591312 TGTCACGCCTAGGATCTCAGAGG + Intronic
1163722224 19:18903705-18903727 TGGCTGGCTCAGGGTCTGAGTGG + Intronic
1163792271 19:19314574-19314596 GGGCAGGCCCAGGAACTGAGGGG - Intronic
1165938336 19:39403016-39403038 TGGGACGCCCGAGATCTGAGGGG + Intergenic
1166267781 19:41695771-41695793 TTGCAGGCTCAGGATCTGAGGGG - Intronic
1166341134 19:42137900-42137922 TGGCAATTCCAGGATCAGAAAGG + Intronic
1166411010 19:42555435-42555457 TTGCAGGCTCAGGATCTGAGAGG - Intronic
1166487715 19:43227794-43227816 TTGCAAGTCCAGGATCCCAGAGG - Intronic
1168257572 19:55175084-55175106 TGGAAAGCCTATGATCTGATTGG + Intronic
1168283063 19:55316247-55316269 TGGCTTGCGCAGGCTCTGAGAGG - Intronic
1202694670 1_KI270712v1_random:115345-115367 AGGGAAGCCCAGGGTCTGAGGGG - Intergenic
926232132 2:11012292-11012314 TGGCAAGCCCAGGCTAGCAGAGG - Intergenic
929086855 2:38176527-38176549 TGGCCAGAGCAGGCTCTGAGAGG + Intergenic
929484059 2:42339267-42339289 TGGCACCACCAGGAGCTGAGGGG + Intronic
929922007 2:46179414-46179436 AGGCAGGCCCAGTCTCTGAGAGG + Intronic
933359062 2:81254301-81254323 AGACAAGCCCAGGACCTGATGGG - Intergenic
934242141 2:90279604-90279626 TGGGAATCCAAGGACCTGAGAGG - Intergenic
934275842 2:91572391-91572413 AGGGAAGCCCAGGGTCTGAGGGG - Intergenic
935406691 2:102717515-102717537 TGGCAACCCCAGCATCTAAGTGG + Exonic
935720174 2:105972890-105972912 TGGCATGCCCTGGCTTTGAGAGG + Intergenic
935742808 2:106165665-106165687 TGGCAGGCCCATGACCTCAGGGG - Intronic
935745826 2:106189538-106189560 TGGCCTGCCCAGGAGCTGAGCGG - Intronic
936348730 2:111696400-111696422 TGGCAAGCCCAAAATCTGCAAGG + Intergenic
938291427 2:130152797-130152819 TGGCCAGCCCAGGTTCTGTGAGG + Exonic
938465117 2:131520162-131520184 TGGCCAGCCCAGGTTCTGTGAGG - Intergenic
940513107 2:154644136-154644158 TTGCTATCTCAGGATCTGAGTGG + Intergenic
942714854 2:178880665-178880687 TGGGAAACTGAGGATCTGAGGGG - Intronic
945918734 2:215732589-215732611 TGGCAAGACCAGGTTATGGGAGG + Intergenic
946559920 2:220901291-220901313 CCCCAATCCCAGGATCTGAGTGG + Intergenic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
947875078 2:233462438-233462460 TGGCAAGCCCAGAACCACAGAGG + Exonic
948001755 2:234573573-234573595 GGGGAAGCTCAGGACCTGAGGGG - Intergenic
1169033796 20:2433278-2433300 ACACAGGCCCAGGATCTGAGGGG + Intergenic
1170479543 20:16752553-16752575 TGGAAAGGCCAGGAAGTGAGAGG - Intronic
1170930856 20:20768481-20768503 TGGCTAGCCCAAGTTCTGGGTGG + Intergenic
1171247464 20:23623509-23623531 TGGCAAGTCCAGGATTTGTCAGG - Intergenic
1172078059 20:32314903-32314925 AGGCAAGAGCAGGCTCTGAGTGG - Intronic
1173619298 20:44424329-44424351 GGGGAAGCCAAGGAGCTGAGGGG - Intronic
1173654263 20:44688975-44688997 TGGCAATTCCAGGAGCTGGGAGG + Intergenic
1173736533 20:45365611-45365633 GGAAAAGCCCAGGATCTGAGGGG - Exonic
1176033078 20:63023236-63023258 TGCCAAGCCCTGGACCTGCGTGG + Intergenic
1178153705 21:29826591-29826613 TGGCAAGCCCAAAATCTGCAGGG - Intronic
1178917292 21:36713331-36713353 TGGCAAGCCAAGGGTTTGATGGG + Intronic
1179241302 21:39595338-39595360 TGGCAAGTCCAAGATCTGCAGGG - Intronic
1180847764 22:18993701-18993723 TAGCAAACTAAGGATCTGAGAGG + Intergenic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1183264795 22:36818526-36818548 TGGGAAGTCCTGGAGCTGAGAGG - Intronic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1183550430 22:38479808-38479830 AGGCAAGCCCAGGGTCTGGAGGG - Intronic
1184156544 22:42671258-42671280 TGGCAAGCACAGTACCTGACGGG - Intergenic
1184444385 22:44538974-44538996 TGGAAAGGCCAGGATCTGCCTGG - Intergenic
949735932 3:7171624-7171646 TGGCAAGGTCAGCATCTTAGAGG + Intronic
950691972 3:14666230-14666252 TGGTCAGCCCAGGACCTGGGTGG + Intronic
950849776 3:16051383-16051405 TGGCAGGCCCAGGGTGTGAGCGG + Intergenic
951966332 3:28389762-28389784 TGGCAAGTCCAGTTTCTGATGGG + Intronic
952189116 3:31003445-31003467 TGGCAAGTCCAAAATTTGAGGGG + Intergenic
952533739 3:34289310-34289332 TGGCAAGCCATGGTTCTGACAGG - Intergenic
954803056 3:53198545-53198567 GAGCAAACCCAGGCTCTGAGAGG + Intergenic
958931687 3:100214453-100214475 TGGCAAGTCCAAAATCTGACAGG + Intergenic
961525205 3:127492381-127492403 GAGGAAGCCAAGGATCTGAGAGG + Intergenic
961628425 3:128279490-128279512 AGGCAGGCCCAGCAGCTGAGGGG - Intronic
962737424 3:138338425-138338447 TGACAAGCTCAGGCTCTGGGAGG + Intergenic
965123583 3:164595344-164595366 TGGCAAGAGCAGGCTCTGTGCGG + Intergenic
966420746 3:179732092-179732114 TGGCAAGCCCAGGAGACCAGAGG + Intronic
967742094 3:193014833-193014855 TGGCAATGCCAAGAACTGAGGGG - Intergenic
968916823 4:3500272-3500294 TGGACAGCCCAGGACCAGAGAGG + Intronic
969103875 4:4790554-4790576 AGGCAAGCCTAGGCTCAGAGAGG + Intergenic
970964579 4:21913486-21913508 TGGCAAGTCCAAGATCAGAGAGG - Intronic
971375177 4:26050423-26050445 AGGCAATCCAAGGATCAGAGAGG - Intergenic
975193095 4:71489634-71489656 TGGGAAGCCCATCTTCTGAGAGG + Intronic
981824636 4:148926230-148926252 TGGCAAGCCCAGAGACTGGGAGG - Intergenic
984716803 4:182933529-182933551 TAGGAAGCCCAGGAACTGATTGG - Intergenic
985802042 5:2010840-2010862 TGGCAAGTCCAAAATCTGTGGGG - Intergenic
985958506 5:3282196-3282218 TGGCCAGCCAAGGATGTGAGGGG + Intergenic
990149612 5:52801014-52801036 TGGCCAGCCCAGGATTTGTGAGG + Exonic
991354984 5:65759514-65759536 TGGAAAGTCCAGAATCTCAGTGG + Intronic
991520658 5:67493773-67493795 TGGTAAGCCTAGGATCTGTGAGG - Intergenic
992925998 5:81587900-81587922 TGGCAAGCCCAGAAAATGATTGG - Intronic
995138281 5:108703890-108703912 TGGCAAGCCCAAAATCTGGAGGG - Intergenic
996372741 5:122770465-122770487 GGGCAAGCACAGGATCAGAATGG - Intergenic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
997762670 5:136464429-136464451 GGGCAAGCCCCAGATCTGAAAGG + Intergenic
998119114 5:139561608-139561630 CGGCAGGCCCAGGAGCTGAGTGG + Exonic
998191938 5:140032816-140032838 TGGCCAGCCAAGGACCTGAGGGG + Intronic
998945773 5:147337975-147337997 AGGCAAGTCAAGGAACTGAGAGG + Intronic
1000846250 5:166284396-166284418 TGGCAAACCCATAATCTGTGTGG - Intergenic
1001255816 5:170182946-170182968 TGGAAGGCCCAGCATCTGACAGG + Intergenic
1001592924 5:172878693-172878715 TGTCAAGGTCAGGATTTGAGGGG + Intronic
1001838434 5:174852563-174852585 TAGAAAGACCAGGAGCTGAGTGG + Intergenic
1002440230 5:179260535-179260557 TTGCCAGCCCAGGCTCTGAGCGG + Intronic
1005987101 6:30882315-30882337 AGGGAAGCCCAGGATGGGAGGGG + Intronic
1006255730 6:32830513-32830535 AGGCAAGACCAGGTTCTCAGAGG + Intronic
1007735306 6:43978617-43978639 TGGCAAGCCCAGCTTCTGGCTGG - Intergenic
1009439406 6:63658832-63658854 TGGCAAGCCCAAAATCTGCAGGG + Intronic
1014898201 6:126929641-126929663 GGTCAAGGCCAGGAGCTGAGAGG - Intergenic
1018502858 6:164430905-164430927 TGGCAAGTCCAAGATCAGAGGGG - Intergenic
1018876110 6:167824792-167824814 CGGGAAGCCCAGGAACTGAAAGG + Intergenic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1020078840 7:5275654-5275676 TGGGAAGCCCAGGCTCAGAGAGG - Intronic
1023553918 7:41400107-41400129 TGGCAAGGCCAAGCTATGAGAGG - Intergenic
1024345284 7:48307055-48307077 TGGCAAGCCCAAAATCTGCAGGG - Intronic
1024352571 7:48381918-48381940 AGGCAAGCCAAAGAGCTGAGCGG + Intronic
1025200047 7:56956513-56956535 TGGGAAGCCCAGGCTCAGAGAGG + Intergenic
1025671897 7:63620419-63620441 TGGGAAGCCCAGGCTCAGAGAGG - Intergenic
1027889158 7:83948489-83948511 TGGTCAGCACAGGATTTGAGTGG + Intergenic
1030238631 7:107294286-107294308 GGGCAAGCCATGGATTTGAGAGG - Intronic
1036661891 8:10714345-10714367 TGCCAAGGCCAGGGTCAGAGAGG + Intergenic
1037462198 8:19122245-19122267 TGACAACCCCAGGAACAGAGCGG - Intergenic
1045329598 8:101143550-101143572 GGGCATGCCCAGGAGCTCAGGGG + Intergenic
1047633134 8:126729934-126729956 TGGCAACCCCTGAATCTTAGAGG + Intergenic
1048141228 8:131796604-131796626 AGGCAAGGCCTGGAGCTGAGAGG + Intergenic
1048291677 8:133186064-133186086 TGGCAAGCCCTGAATCCCAGAGG + Intergenic
1048364326 8:133725199-133725221 GGGCAAGCCCAGGGTCAGTGTGG - Intergenic
1048889913 8:138937593-138937615 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1051652171 9:19338834-19338856 TGGCAAACCCAGAGTCTGAGTGG + Intronic
1053205780 9:36185031-36185053 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1055772068 9:79728087-79728109 TGGCAATCCCAGGGTCTGGACGG + Intergenic
1055987923 9:82071382-82071404 TGGCAAGTCCAAAATCTGAAGGG - Intergenic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1057096070 9:92311026-92311048 TGGCAAGCCCTGGGTCTCATTGG + Intronic
1057800005 9:98185207-98185229 AGGGAAGCCCAGGAGCTGTGGGG - Intronic
1062529612 9:136994161-136994183 CTGCCAGCCCAGGAGCTGAGAGG + Intergenic
1062670252 9:137704726-137704748 TGGAAATCCCAGGCTCTGGGAGG + Intronic
1185868895 X:3646819-3646841 TGGCCAGCCCAGGCCCTGGGAGG + Intronic
1186934935 X:14438750-14438772 AGGAAAGCCCAGGACCTGATGGG - Intergenic
1186968984 X:14819459-14819481 AGGGGAGCCGAGGATCTGAGAGG + Intergenic
1187538395 X:20165426-20165448 TGGAAAGGCCAGGATCTCATGGG - Intronic
1188065586 X:25655761-25655783 TGGCCAGCCCAGATTCTGAGGGG + Intergenic
1188423807 X:30023242-30023264 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1188551362 X:31368405-31368427 GGGCAAGCATTGGATCTGAGTGG - Intronic
1189412360 X:40783941-40783963 GGGCCAGGCCAGGATCTGTGTGG - Intergenic
1190336736 X:49267215-49267237 GGGCAGGCCCAGGGTGTGAGAGG + Intergenic
1190548705 X:51556929-51556951 GGGCAAGCAGAGGATCAGAGAGG - Intergenic
1191604961 X:63051144-63051166 TGGCAAGCACAGGAAAAGAGTGG - Intergenic
1194560862 X:95418140-95418162 TGGCAAGTCCAAAATCTGACAGG + Intergenic
1196313975 X:114201287-114201309 TGCTAATCCCAGGATCTGAGTGG - Intergenic
1196786351 X:119424640-119424662 TTGCAAGCTCAGAAACTGAGAGG + Intronic
1198840751 X:140854787-140854809 TGGGAAGCCAAGGGTTTGAGGGG + Intergenic
1200795328 Y:7336250-7336272 TGGCCAGCCCAGGCCCTGGGAGG - Intergenic