ID: 1183377625

View in Genome Browser
Species Human (GRCh38)
Location 22:37474249-37474271
Sequence TTGATCTGGTCCTCAAATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183377625_1183377633 27 Left 1183377625 22:37474249-37474271 CCGGCATTTGAGGACCAGATCAA 0: 1
1: 0
2: 1
3: 23
4: 150
Right 1183377633 22:37474299-37474321 CTTGAGGGTTAGAGGTGAAGGGG 0: 1
1: 1
2: 1
3: 13
4: 238
1183377625_1183377630 25 Left 1183377625 22:37474249-37474271 CCGGCATTTGAGGACCAGATCAA 0: 1
1: 0
2: 1
3: 23
4: 150
Right 1183377630 22:37474297-37474319 TCCTTGAGGGTTAGAGGTGAAGG 0: 1
1: 0
2: 0
3: 22
4: 248
1183377625_1183377627 11 Left 1183377625 22:37474249-37474271 CCGGCATTTGAGGACCAGATCAA 0: 1
1: 0
2: 1
3: 23
4: 150
Right 1183377627 22:37474283-37474305 TTCACAAATGCTAATCCTTGAGG 0: 1
1: 0
2: 0
3: 7
4: 144
1183377625_1183377629 19 Left 1183377625 22:37474249-37474271 CCGGCATTTGAGGACCAGATCAA 0: 1
1: 0
2: 1
3: 23
4: 150
Right 1183377629 22:37474291-37474313 TGCTAATCCTTGAGGGTTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1183377625_1183377628 12 Left 1183377625 22:37474249-37474271 CCGGCATTTGAGGACCAGATCAA 0: 1
1: 0
2: 1
3: 23
4: 150
Right 1183377628 22:37474284-37474306 TCACAAATGCTAATCCTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 142
1183377625_1183377632 26 Left 1183377625 22:37474249-37474271 CCGGCATTTGAGGACCAGATCAA 0: 1
1: 0
2: 1
3: 23
4: 150
Right 1183377632 22:37474298-37474320 CCTTGAGGGTTAGAGGTGAAGGG 0: 1
1: 0
2: 2
3: 21
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183377625 Original CRISPR TTGATCTGGTCCTCAAATGC CGG (reversed) Intronic
900980671 1:6044404-6044426 TGGATCTGGTCCTTGAAGGCTGG + Intronic
901842949 1:11965199-11965221 GTGTTCTGGTCCTGAAATGTTGG - Intronic
903982517 1:27199626-27199648 TTGATTTGGTTCTAAAATGGAGG + Intergenic
905337763 1:37257254-37257276 CTGATCTGGTCCTAAATTGTAGG - Intergenic
908332284 1:63082695-63082717 TTGGTGTAGTCCTCAAATCCAGG - Intergenic
908375017 1:63527916-63527938 TTCATGTGGACTTCAAATGCTGG + Intronic
909652391 1:77990249-77990271 TTGATGTGCCCCTTAAATGCTGG + Intronic
909694237 1:78448008-78448030 TTGATTTGGTGTTCAAAAGCAGG - Intronic
912164929 1:107031614-107031636 GTGATCTGGTGCACAAATGGAGG - Intergenic
912429604 1:109622083-109622105 ATGATCTGGTCATCAAAGTCAGG - Intronic
918392614 1:184082319-184082341 TTGGTCTGGTCCTGAACTCCAGG + Intergenic
918460784 1:184774562-184774584 TTGGTTTGGTCCACAAAGGCGGG - Intergenic
919076377 1:192818488-192818510 TTTATTTGGTCTTCAAATTCTGG + Intergenic
920460809 1:206138586-206138608 TTGATTTGGACCTGAAAGGCAGG - Intergenic
924573251 1:245257214-245257236 TTGCTTTGGTCCTGAAAGGCAGG - Intronic
1065442499 10:25767112-25767134 TTGATTTGGTTTTCAAATACAGG + Intergenic
1068292741 10:55025844-55025866 TTGATCTGTACCTCAATCGCAGG - Intronic
1074840661 10:117347430-117347452 TTGATTTGGTCCAGAAAGGCAGG - Intronic
1076076066 10:127534767-127534789 TTGCTCTGGTCCTCTCAGGCAGG - Intergenic
1076531797 10:131149866-131149888 TTCCTCTGGTCCTGACATGCTGG - Intronic
1077586569 11:3458478-3458500 CAGATCTGGTTCTCAAATGCAGG - Intergenic
1078149952 11:8749946-8749968 TTGATCTCATCCTCAAAAGGGGG + Intronic
1078848427 11:15142184-15142206 CTGAGCTGGCCCTCAAATGGAGG - Intronic
1079647831 11:22889664-22889686 TAGAGTTGGTCTTCAAATGCAGG - Intergenic
1080913816 11:36634222-36634244 ATTCTCTGTTCCTCAAATGCTGG - Intronic
1081960712 11:47134642-47134664 GTGAACTGGTGCCCAAATGCAGG + Intronic
1083713034 11:64560346-64560368 TTGATCTGGTCAATAAAAGCTGG + Intronic
1085616069 11:77999849-77999871 CTAATATGGTCCTCAAATCCTGG - Intergenic
1086899961 11:92355888-92355910 TTCATCTGGTCCTTGAATGATGG + Intronic
1091237480 11:134031758-134031780 CAGCTCTGTTCCTCAAATGCTGG + Intergenic
1092030474 12:5279363-5279385 TTGATTTGGTGGTCATATGCAGG - Intergenic
1092412798 12:8267212-8267234 CAGATCTGGTTCTCAAATGCAGG - Intergenic
1093932046 12:24963756-24963778 TTGATTTGGTCCAGAAAGGCAGG - Intergenic
1094190040 12:27688795-27688817 TAGAGCTGGTCCTGAAATCCAGG - Intronic
1094745801 12:33342906-33342928 TTGATTTGGTCCAAAAAGGCAGG + Intergenic
1095334947 12:41012752-41012774 TTGATTTGGTTCTTAAATGGAGG + Intronic
1100526361 12:95423379-95423401 TACTTCTAGTCCTCAAATGCTGG - Intergenic
1112959569 13:105106958-105106980 TTGGTTTGGTCCTGAAAGGCAGG - Intergenic
1115565448 14:34621313-34621335 TTGCTCTGGTCCTTAAATGCTGG + Intronic
1121163025 14:91762769-91762791 TTGGTTTGGTCCAGAAATGCAGG + Intronic
1123154622 14:106212397-106212419 TTTATAAGGTCCTCAAATGCAGG + Intergenic
1124224783 15:27883646-27883668 CTGTTCAGGTTCTCAAATGCCGG - Intronic
1126662371 15:51045571-51045593 TTGATTTGGTCCAGAAAGGCGGG - Intergenic
1128404039 15:67316873-67316895 CAGATCTGTCCCTCAAATGCAGG - Intronic
1130004794 15:80084810-80084832 CTCACCTGGTCCTCAGATGCTGG - Intronic
1130036566 15:80366705-80366727 TTCATTTGGTCCTAAAATGGAGG - Intronic
1130505893 15:84541635-84541657 TTGATCTGCTCTTCACATCCTGG - Intergenic
1131138737 15:89959810-89959832 TTGTGCTGGTTCTCAAATCCAGG + Intergenic
1132568714 16:634888-634910 TTGACCTGATGCTCAGATGCAGG - Intronic
1133301560 16:4785819-4785841 TTGATCTGGTCCCCGAAGCCGGG + Exonic
1133354001 16:5122710-5122732 CAGATCTGGTACTCAAATGCAGG - Intergenic
1133875940 16:9734381-9734403 TTCATCTGGTGCTCAACTCCCGG - Intergenic
1134592607 16:15467852-15467874 TTGATTTGGTCCAGAAAGGCAGG + Intronic
1137390562 16:48077886-48077908 TTGGTCTGGTCCTTGAATGCTGG + Intergenic
1137960296 16:52876020-52876042 TTGATCAGGTGCTGAAATGGAGG + Intergenic
1140187877 16:72790382-72790404 TTCATCTGGACCTCACCTGCTGG + Intronic
1143262461 17:5609866-5609888 GGGCGCTGGTCCTCAAATGCAGG - Intronic
1144777255 17:17791162-17791184 TTGCCCTGGCCCACAAATGCAGG - Intronic
1144823540 17:18092053-18092075 TTGAGCTGCACCTCAAATGATGG + Intronic
1149250895 17:54768007-54768029 TTGATCTAGTGCCGAAATGCTGG + Intergenic
1151055361 17:71024442-71024464 TTTATTTGGTCCTGGAATGCAGG - Intergenic
1152432751 17:80258666-80258688 TTGATTTGGTCCAGAAAGGCAGG + Intergenic
1155186604 18:23392527-23392549 TTTATGTGATCCTCAAATGAAGG - Intronic
1155847067 18:30721215-30721237 TTGATCTTGTGCTAAAATGCTGG - Intergenic
1157135484 18:45050196-45050218 TTGCTCTTGCCCTCAAATGAAGG - Intronic
1157174709 18:45440888-45440910 TTGCTCTAGGACTCAAATGCCGG + Intronic
1158864575 18:61625803-61625825 TTGATTTGGTCCAGAAAGGCAGG - Intergenic
1158932159 18:62333000-62333022 TTGATCTGGTCCTGGAAGGATGG + Intronic
1163521987 19:17796860-17796882 TTGCTCTGGGCCTCAGAGGCTGG - Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166200654 19:41235548-41235570 TGGATCTGGGGCTCAAATCCAGG - Intronic
926329948 2:11816054-11816076 TTCATCTGGTCTTCAAATTCAGG - Intronic
928895194 2:36253685-36253707 TTGATGTGCTCCTGACATGCAGG + Intergenic
937121237 2:119441233-119441255 TTGATCTGTTCAGCAAATGCAGG - Intronic
937229222 2:120387785-120387807 CTGATCTTGGCCTCAGATGCTGG + Intergenic
941152856 2:161937235-161937257 ATGATCTGGACCTTAAATGATGG + Intronic
944422656 2:199547712-199547734 TTCATCTGGTACTCAACTGAAGG - Intergenic
945062260 2:205919604-205919626 TTGATTTGGTTCTAAAATGGAGG - Intergenic
1170141075 20:13125378-13125400 TTTATCTGGTCCTAATATTCTGG + Intronic
1170225355 20:13986022-13986044 TTGATCTGTTCATCAGTTGCTGG + Intronic
1171208724 20:23300887-23300909 TTGATTTGGTTCTAAAATGGAGG + Intergenic
1173339103 20:42137973-42137995 TTCATCTGGCCCTCTAATCCAGG + Intronic
1175167002 20:57051144-57051166 TTCAACTGGTTCTCAAATTCAGG - Intergenic
1177904690 21:26961336-26961358 TTGAATTGGTCCTCAAAGGATGG - Intronic
1178863207 21:36306473-36306495 TTGATTTGGTCCAGAAAGGCAGG + Intergenic
1179957136 21:44747668-44747690 TTGATTTGGTCCAGAAAGGCAGG - Intergenic
1182208845 22:28656262-28656284 TAAAACTGGTCCTCAAATGTTGG + Intronic
1183377625 22:37474249-37474271 TTGATCTGGTCCTCAAATGCCGG - Intronic
1184566551 22:45295515-45295537 TTGCTCTGGTCCCCTAATCCTGG + Intronic
949831128 3:8215726-8215748 TTGGTCTAGTCCTGAAATGTAGG - Intergenic
950040084 3:9914742-9914764 TTGTTCTGGCCCTCACCTGCCGG + Exonic
950314801 3:11991861-11991883 TTGAGCTGGGCCTTAAATGATGG + Intergenic
950997641 3:17520217-17520239 TTGAACTGGTAATTAAATGCAGG - Intronic
951404326 3:22276452-22276474 TAGATCTGGGTCTCAGATGCAGG - Intronic
954306422 3:49727959-49727981 TTGATATGGGCCTCAGGTGCAGG - Intronic
955797534 3:62653324-62653346 TTTACCAGGTCCTCACATGCTGG - Intronic
957057902 3:75458402-75458424 CAGATCTGGTATTCAAATGCAGG - Intergenic
959610529 3:108289516-108289538 TTGATCTTGTGCTCGTATGCTGG + Intergenic
959889410 3:111537340-111537362 TCACTCTTGTCCTCAAATGCAGG + Intronic
961295550 3:125881309-125881331 CAGATCTGGTACTCAAATGCAGG + Intergenic
961890359 3:130125863-130125885 CAGATCTGGTTCTCAAATGCAGG - Intergenic
962384066 3:134919035-134919057 TTGCTGTGGTCCTCATGTGCAGG + Intronic
966211156 3:177454764-177454786 CTCATCTGGTCCACAGATGCTGG - Intergenic
966284135 3:178273298-178273320 TTGGTCTGGTGCTCAACTGCAGG + Intergenic
967403410 3:189088551-189088573 TTGACCTTGACCTCAAATGTCGG + Intronic
967541404 3:190672165-190672187 TTTATCTGGTTTTCAAATCCTGG - Intergenic
969001769 4:3988409-3988431 CAGATCTGGTTCTCAAATGCAGG - Intergenic
969752258 4:9120251-9120273 CAGATCTGGTTCTCAAATGCAGG + Intergenic
969812145 4:9656402-9656424 CAGATCTGGTTCTCAAATGCAGG + Intergenic
970042562 4:11812215-11812237 TTGACTTGTTCCTCAAATGTTGG - Intergenic
970714867 4:18909263-18909285 TTAATTTGGTGCTCCAATGCTGG - Intergenic
972034520 4:34504652-34504674 TTGATTTGGTCCAGAAAGGCAGG + Intergenic
972848485 4:43019115-43019137 TTGATCTGGACCTCAAAGACTGG - Intronic
973740268 4:53912666-53912688 TTCATCTGGTCCTGAAGTGGAGG - Intronic
974181906 4:58395404-58395426 TTGCTGTGGTCCTCACATGGTGG + Intergenic
975059780 4:69983636-69983658 TTGGTTTGGTCCTGAAAGGCTGG + Intergenic
975587588 4:75965866-75965888 TTGCTGTGGTCCTCAGAGGCAGG - Intronic
978018979 4:103785536-103785558 TTGATTTGGTTCTAAAATGGAGG - Intergenic
979101550 4:116622747-116622769 TTGTTCGTGTCATCAAATGCTGG + Intergenic
982938993 4:161524282-161524304 TTGATTTGGTCCAGAAAAGCAGG - Intronic
983337822 4:166419132-166419154 TTGATTTGGTCCTAAAATGGAGG - Intergenic
983509555 4:168592570-168592592 ATGATCTGTTCCTAAAATTCAGG + Intronic
990379337 5:55206828-55206850 TTGATTTGGTTCTGAAATGGAGG - Intergenic
991478899 5:67055423-67055445 ATGATCTTGACCTTAAATGCAGG + Intronic
994786972 5:104178576-104178598 TTGATTTGGTTCTAAAATGGAGG - Intergenic
998570688 5:143253966-143253988 TTGATTTGGTTCTAAAATGGGGG + Intergenic
1002566674 5:180116070-180116092 TTGAGCTGGTCCTCAAGAGGTGG + Intronic
1004585090 6:16991558-16991580 TTGATCTAGTCATCGAATACAGG - Intergenic
1006794791 6:36724929-36724951 CTGGTCCCGTCCTCAAATGCAGG - Intronic
1007861626 6:44915807-44915829 TTGGTCTGGTCCAGAAAGGCGGG - Intronic
1008241497 6:49118395-49118417 TTTATTTGTTCATCAAATGCAGG + Intergenic
1009591126 6:65672493-65672515 TGGAGCTGGTCCACAAATACTGG + Intronic
1010354132 6:74910578-74910600 TAGATCTAGTTCTCAACTGCTGG + Intergenic
1016943330 6:149503043-149503065 TTAATCTGTTCCTTAAAAGCTGG - Intergenic
1018835799 6:167482799-167482821 TTGGTTTGGTCCAAAAATGCAGG + Intergenic
1021506458 7:21390892-21390914 TTGACCTACTCCTTAAATGCTGG - Intergenic
1022289426 7:28986633-28986655 TTGAGCTGGGTCTCAAAGGCTGG + Intergenic
1024753976 7:52506150-52506172 TTGTTTTTGTCCTAAAATGCTGG + Intergenic
1026143146 7:67723293-67723315 TTGGTTTGGTCCAGAAATGCAGG - Intergenic
1029328347 7:99829446-99829468 TTGGTTTGGTCCACAAAGGCAGG + Intronic
1033122466 7:138678216-138678238 TTGATTTGGTCCAGAAAGGCGGG - Intronic
1035693291 8:1573629-1573651 CTGTTCTGGTGCCCAAATGCAGG + Intronic
1036375465 8:8195662-8195684 GAGATCTGGTTCTCAAATGCAGG + Intergenic
1036685452 8:10906400-10906422 TAGATGTGGTCTTCACATGCAGG + Intronic
1036854067 8:12227487-12227509 GAGATCTGGTTCTCAAATGCAGG - Intergenic
1036875440 8:12469985-12470007 GAGATCTGGTTCTCAAATGCAGG - Intergenic
1037492066 8:19406041-19406063 TTGATCTGGACATCAAAGGCTGG - Exonic
1039220014 8:35320173-35320195 TTGGTTTGGTCCTGAAAGGCAGG + Intronic
1039822046 8:41142937-41142959 TTGACCTTGGCCTCAAAGGCAGG + Intergenic
1040794147 8:51271271-51271293 TTGTTCTGGCCCACAAGTGCTGG - Intergenic
1041783634 8:61606965-61606987 TTGAGCTGGTCCTCAAGTAGTGG - Intronic
1042932881 8:74030807-74030829 TTGATTTGGTTCTTAAATGGAGG - Intergenic
1042973919 8:74443235-74443257 CTGATCTGGATCCCAAATGCTGG + Intronic
1051366612 9:16325781-16325803 TGCATCTGGTTCTCAAATGGTGG - Intergenic
1052020236 9:23517365-23517387 TTGATCTTTGCCTCAAATCCTGG - Intergenic
1052215902 9:25965010-25965032 TTGATTTGGTTCTAAAATGGAGG + Intergenic
1055972103 9:81921631-81921653 TTGATTTGGTTCTAAAATGAAGG + Intergenic
1055973856 9:81936703-81936725 TTGATTTGGTTCTAAAATGAAGG + Intergenic
1058229944 9:102413291-102413313 TTCTTCTGGCCCTCAAATGTTGG - Intergenic
1059312500 9:113398019-113398041 TTGTTCTGGACTCCAAATGCTGG + Intronic
1059917675 9:119121773-119121795 TTAATCTGGTATTCAAATGCTGG + Intergenic
1062492218 9:136811257-136811279 TTGATTTGGTCCACAAAGGCGGG + Intronic
1191169306 X:57424591-57424613 TTAATGTGTTTCTCAAATGCTGG - Intronic
1191638824 X:63408486-63408508 TTGGTTTGGTCCCCAAATGTGGG - Intergenic
1192222831 X:69209005-69209027 TGGATCCAGTCCTCAAATGTAGG - Intergenic
1193790688 X:85812618-85812640 TTGATTTGGTTCTAAAATGGAGG - Intergenic
1194014882 X:88606639-88606661 TTGATTTGGTCCAGAAAGGCAGG - Intergenic
1194130779 X:90079329-90079351 TTGGTCTGGTCCAGAAAGGCGGG - Intergenic
1194482380 X:94442134-94442156 TTGATCTGGTTCTAAAATGGAGG + Intergenic
1196158306 X:112454996-112455018 TTGATCTGGGCATCATTTGCAGG - Exonic
1197020212 X:121677966-121677988 TTGTTCTGTTCCTCAAGTGTTGG - Intergenic
1197356298 X:125440020-125440042 TTGATTTGGTTCTAAAATGGAGG + Intergenic
1199680677 X:150222288-150222310 TTGAGCTGGTACTCCAATGGAGG - Intergenic
1202364068 Y:24142981-24143003 TTGATCTGCTCTTCACATCCTGG + Intergenic
1202506712 Y:25527141-25527163 TTGATCTGCTCTTCACATCCTGG - Intergenic