ID: 1183378379

View in Genome Browser
Species Human (GRCh38)
Location 22:37478338-37478360
Sequence CCTGATGCCCAGGGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 288}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183378363_1183378379 25 Left 1183378363 22:37478290-37478312 CCTTCTTCCTGGAGCCAAGGGAG 0: 1
1: 0
2: 4
3: 36
4: 325
Right 1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 288
1183378368_1183378379 11 Left 1183378368 22:37478304-37478326 CCAAGGGAGCCCTAGGGCCAGGA 0: 1
1: 0
2: 5
3: 24
4: 293
Right 1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 288
1183378364_1183378379 18 Left 1183378364 22:37478297-37478319 CCTGGAGCCAAGGGAGCCCTAGG 0: 1
1: 0
2: 2
3: 26
4: 267
Right 1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 288
1183378370_1183378379 1 Left 1183378370 22:37478314-37478336 CCTAGGGCCAGGACCACTCTAAC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 288
1183378369_1183378379 2 Left 1183378369 22:37478313-37478335 CCCTAGGGCCAGGACCACTCTAA No data
Right 1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 288
1183378371_1183378379 -6 Left 1183378371 22:37478321-37478343 CCAGGACCACTCTAACACCTGAT 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183378379 Original CRISPR CCTGATGCCCAGGGGGTCCT GGG Intronic
900136982 1:1121844-1121866 CCTGATGCCCACTGGGCTCTCGG + Intergenic
900766966 1:4512268-4512290 CCTGTTGCCCAGGTGGACCCAGG + Intergenic
900915965 1:5638826-5638848 CCTGAGACCCAGGAGGTGCTGGG - Intergenic
901033433 1:6321958-6321980 CCTGAGGCCCAAGGTGCCCTCGG + Intronic
904307408 1:29599082-29599104 CCTGCTGCCCAGGGGTGCCCGGG - Intergenic
904396333 1:30224865-30224887 CCTGCTGCCCAGGGGTGCCCGGG + Intergenic
904595235 1:31640156-31640178 TCTGATGCCCTGGGGGGACTGGG + Intronic
905169110 1:36099188-36099210 CCGGGAGGCCAGGGGGTCCTGGG + Exonic
905353318 1:37362733-37362755 CCTGATGCTCTGGGTGCCCTAGG - Intergenic
905733491 1:40311661-40311683 CAGGTTTCCCAGGGGGTCCTGGG + Exonic
906224871 1:44113515-44113537 CCTGATACCCAGGCTGGCCTAGG - Intergenic
906263268 1:44408446-44408468 CCAAATGCCCAGGGGGTATTTGG - Intronic
908301451 1:62764768-62764790 CCTTATGCCTATGGGATCCTGGG - Intergenic
910312556 1:85841230-85841252 CTCGAGGCCCAGGTGGTCCTAGG + Exonic
911906037 1:103569868-103569890 CTTGAGGTTCAGGGGGTCCTCGG - Intronic
912262790 1:108125765-108125787 CTTGATGCTCAAGCGGTCCTGGG - Intergenic
914900571 1:151709143-151709165 CCCGATGCCTAGGGAGTCTTGGG + Intronic
915087271 1:153397264-153397286 GCTGGTGCCCAGGGGGTCAGAGG + Intergenic
917442607 1:175080439-175080461 CCTGATGCCCCAGGGTTCCCAGG + Intronic
917486977 1:175464287-175464309 TCTGAAGCCCTGGGGCTCCTAGG - Intronic
918444428 1:184602859-184602881 GCTGATGACCAGGGAGTCCTTGG + Intronic
919768816 1:201144225-201144247 CCTGATGCCGAGAGGCTCCCGGG + Intronic
919878038 1:201884838-201884860 CCTGAGGCCCAGGCTGTCCTGGG + Intergenic
920071981 1:203308555-203308577 CCTGATGCCCTGGTGGGCTTAGG + Exonic
920877546 1:209850662-209850684 CATGATGCCTAGTGGGTCCTTGG + Intronic
921576186 1:216837592-216837614 CTTGATGACCAGGGGATCTTTGG - Intronic
922576830 1:226666424-226666446 CCTGGTGTCCAGGGGCTCCAGGG + Intronic
923414111 1:233738127-233738149 CCTGATGCCCAGAATGTGCTTGG - Intergenic
923630432 1:235646036-235646058 CCTCATGCACAGGGGGTGTTGGG + Intronic
1062768157 10:80828-80850 CTTGTGGCCCAGTGGGTCCTTGG - Intergenic
1062829727 10:597520-597542 CCTGCTGCCCAGCGTGTCCTCGG - Intronic
1062971769 10:1653992-1654014 ACAGCTGCCCCGGGGGTCCTGGG + Intronic
1070624554 10:78041372-78041394 CCTGCTGGCCAGGGGGTGGTTGG + Intronic
1070660460 10:78302187-78302209 CCGGCTGCCCAGGGTGACCTAGG + Intergenic
1071473307 10:86003110-86003132 ACAGATGCCCAGGAGGTTCTGGG - Intronic
1073447153 10:103588569-103588591 CCTGATGCCTGGTAGGTCCTTGG + Intronic
1073509470 10:104034281-104034303 CCTGCGGCCCAGGAGGGCCTGGG + Exonic
1073510267 10:104038463-104038485 CCGGAGGCCCAGGGGGCCCAGGG + Exonic
1073865288 10:107796343-107796365 CCTGATTCCTGGAGGGTCCTTGG - Intergenic
1073954322 10:108851349-108851371 CATGATGCCCTGTGGGTCTTGGG - Intergenic
1075812183 10:125232367-125232389 CATGCTGCCCAAGGTGTCCTAGG + Intergenic
1076243330 10:128926904-128926926 CCTGCTGTCCAGGGGATCGTTGG + Intergenic
1076342582 10:129759824-129759846 CCTGAGGCCCAGGGCTCCCTGGG + Intronic
1076826980 10:132974056-132974078 CCGGATGGCCAGGCTGTCCTTGG - Intergenic
1076892274 10:133291137-133291159 CCTGCTGCCCATGGGGCCCAGGG - Intronic
1077331936 11:1987669-1987691 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1078552459 11:12290046-12290068 CCTGATGCCCACTGTGTCTTGGG - Intronic
1080230256 11:30012336-30012358 CCTGATGCCCAGTGGCTCTGAGG - Exonic
1081991242 11:47338749-47338771 CCAGATGTCCCGGGGGTCCATGG + Intronic
1082998594 11:59272168-59272190 CCTGGTGCCCAGTAGGTGCTTGG + Intergenic
1083943905 11:65913334-65913356 CCTTTGGCCCAGGGGGTGCTGGG - Intergenic
1084411656 11:69009439-69009461 CATGGAGCCTAGGGGGTCCTGGG - Intronic
1084659090 11:70536602-70536624 CCTGAAGCCCAGGAGCTCATGGG - Intronic
1085410242 11:76286510-76286532 CTTGATGCCCAGGGGGCCGTGGG - Intergenic
1088480256 11:110290312-110290334 CATGTTGCCCAGGCTGTCCTGGG - Intronic
1088902564 11:114129086-114129108 CCTGGTGCCAAGTGGGTTCTGGG - Intronic
1202814917 11_KI270721v1_random:42845-42867 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1092163294 12:6327844-6327866 CCTGCTGTCCCGGGGCTCCTCGG - Exonic
1094847429 12:34367479-34367501 AGGGATGCCCAGGGTGTCCTGGG + Intergenic
1094848197 12:34370672-34370694 CATGGCGCCCAGGGGATCCTTGG - Intergenic
1094848503 12:34371991-34372013 CGTGGTGCCCAGGGGACCCTGGG - Intergenic
1094849834 12:34377418-34377440 CGTGTTGCCCAGGGGACCCTGGG - Intergenic
1094851844 12:34385801-34385823 CGTGAGGCCCAGGGGACCCTGGG - Intergenic
1094853145 12:34391294-34391316 AGGGATGCCCAGGGTGTCCTGGG - Intergenic
1096079380 12:48823528-48823550 CCTAAGTCCCAAGGGGTCCTTGG + Intronic
1096109752 12:49021595-49021617 CCTGGTGCCCAGGGTGGGCTTGG + Exonic
1096145713 12:49277293-49277315 CCTCATGCCCCAAGGGTCCTGGG - Intergenic
1096240520 12:49957466-49957488 CCTGGTGCACAGTGGGTGCTTGG - Exonic
1102046335 12:109832511-109832533 CCTGGTGCCCCCGGGGTGCTTGG - Intronic
1102961440 12:117096091-117096113 CCTGATGCTCAGCAGGTGCTTGG + Intronic
1103201757 12:119093594-119093616 GCTGATCCCCAGGGGACCCTGGG + Intronic
1103327165 12:120129393-120129415 CTTGATGGCCTGGGGGTCCAGGG + Exonic
1103389537 12:120561726-120561748 CCTGACTCCCAAGGGCTCCTTGG + Intronic
1103680547 12:122690279-122690301 GCTTGGGCCCAGGGGGTCCTGGG - Intergenic
1103703637 12:122860262-122860284 TCTCATGCCCAGGGTGGCCTAGG - Intronic
1103848826 12:123917979-123918001 CCTGATGCCCAAGGGTCCCTGGG - Intronic
1103864392 12:124040346-124040368 CCTGATCCCCAGGAAGTCCTAGG - Intronic
1106100832 13:26694345-26694367 CCTGGTGCCCAGGGGCATCTCGG - Intergenic
1113539229 13:111093584-111093606 CCTGATGCCCAGGGGTTCAGGGG - Intergenic
1114663915 14:24367712-24367734 CCTGAGGCCAGGAGGGTCCTGGG - Intronic
1117322026 14:54633575-54633597 CCTGGTGCCTAGGGGGTAGTGGG + Intronic
1118478920 14:66144152-66144174 GCTCAGGCCCAGGGGGTTCTGGG - Intergenic
1118914978 14:70095280-70095302 CTGGCTGGCCAGGGGGTCCTAGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1119650342 14:76378610-76378632 GCTGCTGCCCAGTGGGTCCTGGG - Intronic
1121495951 14:94391364-94391386 CCTCATGTCCTGGGGTTCCTGGG - Intergenic
1122013871 14:98776969-98776991 CCTCCTGCCCACAGGGTCCTAGG + Intergenic
1123113483 14:105883533-105883555 CCTGCTGCCCCTGGGGACCTGGG + Intergenic
1124610807 15:31207076-31207098 CCCGATTCCCCGGGCGTCCTGGG + Intergenic
1125933352 15:43615632-43615654 GCTGAGGCCCAGGGGATGCTGGG - Exonic
1125946450 15:43715094-43715116 GCTGAGGCCCAGGGGATGCTGGG - Intergenic
1126697815 15:51341021-51341043 CCTGTTGGCCAGGCAGTCCTGGG + Intergenic
1127271488 15:57405973-57405995 CCTGACCCACAGGGGGTACTTGG - Intronic
1129325378 15:74797833-74797855 CCTTATGCTCTGTGGGTCCTTGG - Intronic
1132065656 15:98728643-98728665 GCTGATGCCCAGGGCCGCCTGGG + Intronic
1132400467 15:101501960-101501982 CCTGGTCACCAGGGAGTCCTCGG - Intronic
1132577465 16:670592-670614 CCAGGGGCCCAGGGGGTGCTGGG + Intronic
1133033632 16:3023066-3023088 CCAGGTCCCCAGGGGCTCCTGGG + Intronic
1134245007 16:12533324-12533346 CCTGTGGCCCTGTGGGTCCTGGG + Intronic
1134489790 16:14688111-14688133 CAGGATGCCCAGGGGATACTCGG + Intronic
1134495170 16:14727228-14727250 CAGGATGCCCAGGGGATACTCGG + Intronic
1135142759 16:19935835-19935857 GCTGCTGCCCAGGGAGTCCCTGG + Intergenic
1135448368 16:22537424-22537446 CAGGATGCCCAGGGGATACTCGG + Intergenic
1136272537 16:29157078-29157100 CTTTATCCCCAGGTGGTCCTCGG + Intergenic
1137451460 16:48578286-48578308 CCAGAGCCCCTGGGGGTCCTGGG - Intronic
1138487711 16:57357536-57357558 CCTGATCCTCAGAGGGCCCTGGG + Intergenic
1139121534 16:64024340-64024362 CCCTATGCCCAGTGGGTACTTGG + Intergenic
1139322801 16:66129084-66129106 CCTGATCCCCTGGGGGACCCTGG + Intergenic
1139855352 16:69975376-69975398 CAGGATGCCCAGGGGATACTCGG - Intergenic
1139885068 16:70202491-70202513 CAGGATGCCCAGGGGATACTCGG - Intergenic
1140218325 16:73025624-73025646 CCTGCAGCCCAGGGGTGCCTGGG - Intronic
1140367448 16:74393022-74393044 CAGGATGCCCAGGGGATACTCGG + Intergenic
1140500962 16:75433182-75433204 CCTGTGGCCCAGGTGGTCCAGGG - Intronic
1141666140 16:85466342-85466364 CCCACTCCCCAGGGGGTCCTGGG - Intergenic
1142192753 16:88725435-88725457 CTTGGGGCCCAGGGTGTCCTGGG + Exonic
1142982243 17:3678981-3679003 CGTGCTGCCAGGGGGGTCCTTGG - Intronic
1143325660 17:6096572-6096594 CCTGATGCCCAAGACATCCTTGG - Intronic
1144092651 17:11871892-11871914 CCTGGTGCTCAGGGGGTGGTGGG - Intronic
1146054873 17:29576016-29576038 TCTGAGCCCCAGGGGGTTCTGGG - Intronic
1146891013 17:36506546-36506568 CCCCATGAGCAGGGGGTCCTGGG + Exonic
1147188008 17:38722955-38722977 CTCAATGCCCAGGGGATCCTGGG - Intronic
1147620037 17:41860172-41860194 CCTGATTCCCAGGCTGCCCTGGG + Intronic
1150213376 17:63453778-63453800 CGTGAGCCCCAGGGGGTGCTTGG - Intergenic
1150288173 17:63965823-63965845 CATGAGGCCTAGGGGGTCCTGGG + Intronic
1150490970 17:65574073-65574095 CCTGATGCCCAGGGAATACCTGG + Intronic
1150724443 17:67640226-67640248 CCTGCTGCCAAAGGGGTCCCTGG + Intronic
1152460786 17:80441364-80441386 TCTGCTCCCCAGGGGGTCTTGGG - Intergenic
1152499400 17:80697931-80697953 CCTGGTGCCCAGTGGGTCACAGG - Intronic
1152572892 17:81128280-81128302 CCTTCTCCCTAGGGGGTCCTGGG - Intronic
1152835086 17:82524718-82524740 CCTGAGGCGCAGGTGTTCCTGGG + Intronic
1152923192 17:83076096-83076118 CTTGATTCCCAGGGCGTCGTAGG - Intergenic
1154371288 18:13765417-13765439 CCTGGTCCCCAGTGGCTCCTGGG + Intergenic
1157328549 18:46686501-46686523 CCTGAAGCCCAGGGCCTGCTGGG + Intronic
1159309552 18:66689052-66689074 TCTGATGGCCTGGGGCTCCTTGG + Intergenic
1160141144 18:76324345-76324367 CCTGATCTCCATGGGGTCCTGGG - Intergenic
1160407404 18:78654064-78654086 CCTGAGACCGAGGGGTTCCTGGG - Intergenic
1160443777 18:78912132-78912154 CTTGGTGCCCAGCTGGTCCTTGG + Intergenic
1162017803 19:7855065-7855087 CCTGCTCCCCAGAGTGTCCTGGG + Intronic
1162607314 19:11719625-11719647 CCTGAGCCCCAGGGCCTCCTTGG - Intergenic
1162771951 19:12954383-12954405 GCTGAGGCCCAGGAGCTCCTGGG - Exonic
1162817896 19:13207458-13207480 CCCGAGGCCCGGGGAGTCCTGGG + Exonic
1163271028 19:16253991-16254013 CCTGCTGCCCAGGGCCTTCTGGG - Intergenic
1163290204 19:16374391-16374413 TTTGAGACCCAGGGGGTCCTGGG - Intronic
1163645823 19:18488487-18488509 CCTGAGCCCCAGGGCCTCCTGGG - Intronic
1163781211 19:19249687-19249709 CCTGATGCAGCGGGTGTCCTTGG - Intronic
1164840689 19:31390183-31390205 CCTGAGGCCCAGCAGGGCCTGGG + Intergenic
1165925052 19:39321207-39321229 CCTAATACCCAGGGGGACCTCGG + Intergenic
1166381550 19:42357615-42357637 CCAGATGCCCGGGAGGTCCACGG - Intronic
1166835337 19:45664218-45664240 CCTGGTGCCCTCCGGGTCCTGGG - Intergenic
1167349340 19:48964957-48964979 ACTGATGACCCTGGGGTCCTGGG - Intergenic
1167474965 19:49694797-49694819 CCTGAGGCCCAAGGAGTCCCAGG - Intronic
1168166557 19:54552227-54552249 CAGGATGTCCAGGGGGTCCCTGG - Intergenic
925904418 2:8530966-8530988 CCTGAATGCTAGGGGGTCCTGGG + Intergenic
927053309 2:19350151-19350173 CCTCATCCACAGTGGGTCCTGGG + Intergenic
927121860 2:19972079-19972101 TCTGAGGGCCAGGGGCTCCTGGG - Intronic
927376485 2:22421006-22421028 GCTGATGCCCAGGGGCTCGTGGG - Intergenic
927937615 2:27084437-27084459 CCTGCAGCCCAGGAGGCCCTGGG - Exonic
928092307 2:28382482-28382504 CCTGATAGCCAGGGGACCCTGGG - Intergenic
929565003 2:42978671-42978693 CCTGATGCCCTGGGAGGCCCAGG - Intergenic
932398204 2:71462546-71462568 CCTGCTGTTCAGTGGGTCCTGGG + Intronic
934112006 2:88752740-88752762 CCTGAAGACCAGGGGTTCCAGGG - Intergenic
937999342 2:127719846-127719868 CCTGAGGGCCAGGCGGGCCTTGG + Exonic
938001226 2:127740422-127740444 CATGGTGCCCAGGGGGACATGGG + Intronic
940100749 2:150035585-150035607 CCTGTGGCCCAGGGGGGCTTTGG - Intergenic
940423131 2:153501648-153501670 TCTGATGTCCAGGGACTCCTTGG - Intergenic
942293931 2:174499538-174499560 CCAGAGGCCCAGGCAGTCCTGGG - Intergenic
946192877 2:218016624-218016646 GCTGATGGCCAGGGGGACCCAGG + Intergenic
946415408 2:219537619-219537641 CCTGAACCCCAAGGTGTCCTGGG + Exonic
948151938 2:235751393-235751415 TCTGGTGCCCAGGGGGTTGTCGG + Intronic
1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG + Intronic
1170142122 20:13134930-13134952 CCTGATGCCAAAGTGGTCATGGG - Intronic
1170509850 20:17065296-17065318 CCTGATTCACAGGGGGCTCTAGG - Intergenic
1171015472 20:21537343-21537365 TTTGATGCTCAGGTGGTCCTGGG + Intergenic
1172888816 20:38249316-38249338 CCTGTTGCCCAGGGGGGCAAAGG + Intronic
1173193865 20:40897526-40897548 CCTGCAGGCCAGGTGGTCCTGGG - Intergenic
1173367572 20:42400991-42401013 CCAGAAACCTAGGGGGTCCTCGG - Intronic
1173458164 20:43220451-43220473 CCTGATCCCCAGGGGGACACTGG + Intergenic
1173643899 20:44621922-44621944 TCTGATGACAAGGGGGTCTTGGG - Intronic
1174741032 20:53014535-53014557 CCTGCTGCTCATGGGTTCCTAGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175820658 20:61907184-61907206 CCTGGTGCCCGGGGGGGCCTGGG - Intronic
1175852082 20:62099094-62099116 CAGGATGTCCATGGGGTCCTGGG - Intergenic
1176258475 20:64166370-64166392 CCAGGTGCCCAGGGGGTCGGGGG - Intronic
1176413874 21:6463737-6463759 CCGGATCCACAGGGGCTCCTTGG + Intergenic
1177941543 21:27417741-27417763 TCTGTTGCCCAGGGGGCTCTGGG - Intergenic
1178675088 21:34623921-34623943 ACTGATGCCCAGGGTATCCGTGG - Intergenic
1179689372 21:43072059-43072081 CCGGATCCACAGGGGCTCCTTGG + Exonic
1179804645 21:43829528-43829550 TCTGATGCCCTGGGGGGTCTGGG - Intergenic
1180092476 21:45540133-45540155 CCTGATGCCCAGAGAGGCCACGG + Intronic
1182293320 22:29298736-29298758 CAGGAGGCCCAGGAGGTCCTGGG + Exonic
1182786415 22:32911518-32911540 CCTGATGCCTGTGGGGGCCTGGG + Intronic
1183067811 22:35375612-35375634 CCTCGGGCCCAGGGGCTCCTAGG + Intergenic
1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG + Intronic
1183733690 22:39631949-39631971 CCTGGGGCCCAGGGAGTCCCAGG - Intronic
1184106624 22:42371083-42371105 TCTGATGGAGAGGGGGTCCTTGG + Intergenic
1184647282 22:45903233-45903255 CCTGCTGCTGAGGGGGTCCCAGG + Intergenic
1185311730 22:50159826-50159848 CTTGCTGCCCTGGGGGTTCTGGG + Intronic
949205907 3:1439278-1439300 GCTGAGGACCAGGGGGACCTGGG - Intergenic
949623011 3:5837396-5837418 CCTGCTGACCAAGGAGTCCTTGG - Intergenic
950718223 3:14864579-14864601 ACTGAGGCCCAGGGTGTCCAAGG - Intronic
952237213 3:31492590-31492612 CCTGATTCCCAGGGGGAACAGGG - Intergenic
952834671 3:37592703-37592725 CCAGAAACCCAAGGGGTCCTTGG - Intronic
953123046 3:40064629-40064651 CCTGAAGCCACGGAGGTCCTGGG + Intronic
953532112 3:43748253-43748275 CCTGATGGCCAGGAATTCCTGGG + Intergenic
953875363 3:46663592-46663614 CCTGATGTCCAGAGAGTTCTTGG + Intergenic
960576534 3:119235496-119235518 CCTGATGCCTTGGGGCTCCCTGG + Intronic
961554356 3:127688099-127688121 CCTGCTTCCCAGAGGGTCCCTGG - Intergenic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
962382050 3:134905818-134905840 CATGATTCCCAGGCAGTCCTTGG + Intronic
967948833 3:194824782-194824804 CCTGATGCCTAGCGGGTCCTTGG - Intergenic
968689334 4:1982598-1982620 CCTGTGGGCCAGGGTGTCCTAGG + Intergenic
969614974 4:8247037-8247059 CCTGAAGCCCAGGCTGTCCTGGG - Intergenic
969901654 4:10355689-10355711 GATGCTGCCCAGGGGGTCCTTGG - Intergenic
972646961 4:40977733-40977755 CCTGATTCCCAAGAGGTCCGAGG + Intronic
982222687 4:153138310-153138332 GCTGATGCCAATGAGGTCCTTGG - Intergenic
984985761 4:185328382-185328404 CCTGGTGGCCTGGGGCTCCTTGG - Intronic
985126663 4:186701567-186701589 CCTGATGCCCTGTGGGAGCTGGG - Intronic
985532707 5:443308-443330 CCTGACGGCCGGCGGGTCCTTGG + Intronic
985644421 5:1078293-1078315 CCCAAGGCCCCGGGGGTCCTGGG - Intronic
985726716 5:1520042-1520064 CCTGCTGCCCACTGGGTCCCTGG - Intronic
985966470 5:3342203-3342225 TCTGAGGGCCAGGGGATCCTGGG + Intergenic
988737352 5:34035665-34035687 CCGGTGGCCCAGGGGGGCCTTGG + Exonic
988783343 5:34543396-34543418 CATGGTCCCCAGGGGGTCCATGG + Intergenic
989084211 5:37657642-37657664 TCTGATGCCCAGGGTGACATCGG - Intronic
990149346 5:52799461-52799483 CCTGATGTCCTGGGAATCCTAGG - Intronic
992019466 5:72607636-72607658 CCTGCCTCCCAGGGGGCCCTTGG + Intergenic
994192433 5:96883192-96883214 CCTGATTCCCAGGGAGCTCTGGG - Intronic
997209231 5:132067824-132067846 CCTTATGCTCAGGAGGGCCTCGG - Intergenic
997425358 5:133799217-133799239 CCTGGTGCCCACGGGGTGCTGGG - Intergenic
998216088 5:140239604-140239626 CCTGAGACCCAGGGCTTCCTGGG + Intronic
998298874 5:140999171-140999193 CCTGATGGGGAGAGGGTCCTTGG + Intronic
999295586 5:150457783-150457805 ACTGTGGCCCAGGTGGTCCTGGG + Intergenic
1001367132 5:171153604-171153626 ACTGACACCCAGGGGGTGCTTGG + Intronic
1001425568 5:171619873-171619895 CCTGATGCCCAGGCCATCCCAGG + Intergenic
1002900048 6:1402614-1402636 CCTGGAGCCCCGGGCGTCCTTGG - Intergenic
1003168651 6:3703078-3703100 CCTGCAGCCCAGGGGCTCCTTGG + Intergenic
1004518428 6:16340285-16340307 CCTGATCTCCAGGAGGGCCTAGG + Intronic
1005646301 6:27841709-27841731 CCTGATTCCCAGGAAGTGCTTGG + Intronic
1006019872 6:31111704-31111726 CCTGAATCCCAGTGTGTCCTGGG - Exonic
1006152432 6:31996630-31996652 CCTGAGGCCCAGGGGACCTTAGG + Intronic
1006158738 6:32029367-32029389 CCTGAGGCCCAGGGGACCTTAGG + Intronic
1006633535 6:35446262-35446284 CCAGAGGCCCAGCGGGTCTTCGG + Intergenic
1006672000 6:35735451-35735473 CCTGCTGCCTAGGGTGTACTGGG + Intergenic
1006840829 6:37027077-37027099 CCTAGTGGTCAGGGGGTCCTGGG - Intronic
1007081358 6:39107301-39107323 CCTGATGCCCAGGGAGGTCAGGG - Intronic
1007182793 6:39942513-39942535 CCTGAAGGCAAGGGGGTCCATGG - Intergenic
1008506543 6:52236317-52236339 CCTTATGACCAGGGGCTCTTTGG + Intergenic
1009348981 6:62651230-62651252 TCTGATGGCCTGGGGCTCCTTGG - Intergenic
1009355524 6:62739976-62739998 CCTGGTGCCCAGTGGCTCCTAGG + Intergenic
1013036842 6:106393270-106393292 AATGATGCACAGGGGGTCCAGGG + Intergenic
1013175778 6:107675371-107675393 CCTGAAGCCCTGGGCGTCCGAGG + Intergenic
1013587371 6:111591457-111591479 CCTGATGCCCAGGACATCCTGGG + Exonic
1017523185 6:155220080-155220102 CCTCCTGCCAAGTGGGTCCTTGG + Intronic
1018926906 6:168212875-168212897 CCTCATGCCCAGGGGGACCGAGG + Intergenic
1019313185 7:372717-372739 CCTGATGCCCAGGGGGTCGAGGG - Intergenic
1019321449 7:417287-417309 GCTGAAGCCCAGGGGATGCTGGG - Intergenic
1019726486 7:2605786-2605808 CCTGACGCCCAGGGTGCCCTGGG + Intronic
1019987983 7:4672063-4672085 CCTTAAGCCCAAAGGGTCCTTGG - Intergenic
1020274544 7:6616186-6616208 GGTGAGGCCCAGGGGGTCGTTGG + Exonic
1021719265 7:23490480-23490502 CCGGAGGCCCCGGGGGCCCTGGG + Intergenic
1022523058 7:31020176-31020198 GCTGATGCCCAGGGAGGCCAGGG - Intergenic
1023279152 7:38552255-38552277 TCTGAAGTGCAGGGGGTCCTGGG - Intronic
1023841553 7:44101279-44101301 GCTGCTGCCATGGGGGTCCTGGG + Intergenic
1024319722 7:48052809-48052831 ACTGATGCCCTGGAGGTCTTCGG - Exonic
1026979766 7:74519466-74519488 CCTGATTCCCAAGGGGTCACGGG + Exonic
1029444634 7:100605160-100605182 GCTGATGCCCGGGGGGTAATCGG - Exonic
1034232170 7:149539034-149539056 ACTGATGGCTGGGGGGTCCTGGG - Intergenic
1034282573 7:149864280-149864302 CCTGAGGGACAGGGAGTCCTTGG + Exonic
1035655775 8:1303681-1303703 CCTAAGGCCCAGGGTCTCCTTGG + Intergenic
1038182553 8:25242782-25242804 CCAGTTGCCCAGGGTGCCCTGGG + Intronic
1040914697 8:52557202-52557224 GCTGATGCCCGGGTGGTGCTTGG + Intronic
1042877153 8:73449785-73449807 CCTGAGGCCCAGGAGGGCTTAGG + Intronic
1045316293 8:101046511-101046533 CCAGAGGCCCAAGGGGGCCTGGG + Intergenic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1048509111 8:135046423-135046445 CATTAAGCCCAGGGAGTCCTGGG - Intergenic
1048771376 8:137898949-137898971 GCTGATGCCCAGGCAGTTCTTGG + Intergenic
1049059247 8:140263361-140263383 CCTGAAGCACAGTGGGTACTGGG + Intronic
1049220908 8:141428382-141428404 CCCACTGCCCAGGGGGTCCTGGG + Intronic
1049316434 8:141971314-141971336 CATGAAGCCCAGGGAGTGCTTGG - Intergenic
1049529988 8:143149294-143149316 CCTCACCCCCAGGGGGTCCCAGG - Intergenic
1049915790 9:317080-317102 TCTGTTGCCCAGGTGTTCCTTGG - Exonic
1053298652 9:36933462-36933484 CGTGGTGCCCCGGGAGTCCTGGG + Intronic
1053390400 9:37731042-37731064 CAGGAGGTCCAGGGGGTCCTTGG - Exonic
1055595331 9:77860164-77860186 GCAGATGCCCAGGTGGTCATGGG - Intronic
1056067157 9:82948397-82948419 CCTGGTTCACAGGGGGTCCTGGG - Intergenic
1056464370 9:86839320-86839342 GCTGATGCCCAGGGGAGCCCTGG + Intergenic
1056792281 9:89633575-89633597 CCTGATTCCCTGGGAGGCCTTGG + Intergenic
1056954975 9:91074408-91074430 CCAGCTTCCCAGGGGCTCCTGGG + Intergenic
1057190161 9:93082893-93082915 CATGATGCCGAGGGGCTCCCAGG + Intronic
1057726727 9:97573238-97573260 CCTGGTGCCCTGGGGGTCCTGGG - Intronic
1059561434 9:115338552-115338574 CCCGGTGCCCATGGGTTCCTGGG - Intronic
1060187834 9:121574765-121574787 TCCCATGCCCAGGGGGGCCTCGG + Intronic
1060894923 9:127211419-127211441 CCTGATCCCCAGTGCATCCTTGG + Intronic
1061249229 9:129416734-129416756 CCTGGCTCCCGGGGGGTCCTCGG + Intergenic
1061764560 9:132873708-132873730 CCTGAGGCCGAGTGGGTGCTGGG - Intronic
1061808122 9:133147785-133147807 CCTGAGTCCCAGGGGGTCAAAGG + Intronic
1061924204 9:133798045-133798067 CCTGAGTCCCAGGTGGTTCTAGG + Intronic
1062254914 9:135616350-135616372 GGCGATGCCCAGGGGGTGCTGGG - Intergenic
1062583593 9:137238875-137238897 CCTAGTGCCCAGGGCATCCTGGG - Intergenic
1062737116 9:138143662-138143684 CCTGTGGCCCAGCGGGTCCTTGG + Intergenic
1185478817 X:431003-431025 CCTGAAACTCGGGGGGTCCTGGG + Intergenic
1185620680 X:1451131-1451153 CCCCATTCCTAGGGGGTCCTGGG + Intronic
1185620694 X:1451166-1451188 CCCCATCCCTAGGGGGTCCTGGG + Intronic
1185620722 X:1451238-1451260 CCCCATGCCTAGGGCGTCCTGGG + Intronic
1185620737 X:1451274-1451296 CCCCATCCCTAGGGGGTCCTGGG + Intronic
1185620782 X:1451381-1451403 CCCCATCCCTAGGGGGTCCTGGG + Intronic
1185620999 X:1451946-1451968 CCACATGCCTAGGGCGTCCTGGG + Intronic
1185621057 X:1452098-1452120 CCCCATCCCTAGGGGGTCCTGGG + Intronic
1186660015 X:11660193-11660215 TGTGATGCCCAGGGGCTCCTTGG + Intronic
1187486131 X:19706240-19706262 CCTCAGGCCTAGGGGATCCTGGG - Intronic
1189334858 X:40164964-40164986 CCTGATGCCCAGGCGGCCCATGG + Intronic
1189354440 X:40300278-40300300 CCTGAGGCCCAGGCGGACCCTGG - Intergenic
1189571904 X:42306956-42306978 GCTCAGGCCCAGGGGGACCTGGG - Intergenic
1195696766 X:107673238-107673260 CCTGACTCCCAGGGAGTCCTGGG + Intergenic
1195755000 X:108191507-108191529 CCTGAGGCCCTAGGGCTCCTGGG + Exonic
1195755487 X:108195081-108195103 CCTGTTGCCCTGGAGGGCCTTGG + Exonic
1195797504 X:108667152-108667174 CTGGAAGTCCAGGGGGTCCTGGG - Exonic
1196485617 X:116203546-116203568 CCTGATGACCAAGGAGCCCTTGG - Intergenic
1199582672 X:149376066-149376088 TCTGATGCCCAGGGGCCTCTTGG + Intergenic
1201982870 Y:19926548-19926570 TCTGATGGCCTGGGGCTCCTTGG + Intergenic