ID: 1183381536

View in Genome Browser
Species Human (GRCh38)
Location 22:37492713-37492735
Sequence GGTGCTGTTGCCTGAGTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183381536_1183381545 23 Left 1183381536 22:37492713-37492735 CCAGGCACTCAGGCAACAGCACC 0: 1
1: 0
2: 0
3: 20
4: 280
Right 1183381545 22:37492759-37492781 TAGCGGCCGCACCAAACTGTAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1183381536_1183381546 24 Left 1183381536 22:37492713-37492735 CCAGGCACTCAGGCAACAGCACC 0: 1
1: 0
2: 0
3: 20
4: 280
Right 1183381546 22:37492760-37492782 AGCGGCCGCACCAAACTGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 18
1183381536_1183381543 6 Left 1183381536 22:37492713-37492735 CCAGGCACTCAGGCAACAGCACC 0: 1
1: 0
2: 0
3: 20
4: 280
Right 1183381543 22:37492742-37492764 CGCAGGGCAGACACCAGTAGCGG 0: 1
1: 0
2: 0
3: 13
4: 129
1183381536_1183381540 -10 Left 1183381536 22:37492713-37492735 CCAGGCACTCAGGCAACAGCACC 0: 1
1: 0
2: 0
3: 20
4: 280
Right 1183381540 22:37492726-37492748 CAACAGCACCACGGGCCGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183381536 Original CRISPR GGTGCTGTTGCCTGAGTGCC TGG (reversed) Exonic
900477891 1:2884472-2884494 GGGGCTGGTGCGTGAGCGCCCGG + Intergenic
900684616 1:3940205-3940227 GGTGCTGACGCCTGTGTCCCTGG + Intergenic
900714941 1:4138157-4138179 ACTGCTGTTTCCTGAGTCCCAGG + Intergenic
900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG + Intergenic
901244886 1:7722059-7722081 GCTGCTGGGGCCTGAGGGCCTGG + Intronic
901259580 1:7861695-7861717 GGGGCTGTTTCCTGAGGGACGGG - Intergenic
901676943 1:10890862-10890884 GTGACTGTTGCCTTAGTGCCTGG - Intergenic
902619924 1:17644825-17644847 GCTGCTATTTCCGGAGTGCCTGG + Intronic
902826293 1:18976569-18976591 GTGGATGGTGCCTGAGTGCCTGG - Intergenic
904246565 1:29192276-29192298 ACTGCAGTTCCCTGAGTGCCAGG + Intergenic
904289807 1:29477707-29477729 GCTGCTGTTTCATGAGAGCCTGG - Intergenic
904348956 1:29892620-29892642 GGTGCTTTTTCCTGAGTGAAGGG - Intergenic
904881184 1:33698399-33698421 GGGGCTTTTGCCTGAGTTCCAGG - Intronic
905452480 1:38065517-38065539 GGTGCTGGAGCCAGACTGCCTGG + Intergenic
907213369 1:52842322-52842344 GGTGCTGTTGCCAGATTTTCAGG + Intergenic
907471899 1:54679577-54679599 GGTGCTGGTGGCTGAGTTCTAGG + Intronic
908415630 1:63910759-63910781 TGTGCAGTGGCCTGAGTGCAAGG - Intronic
911608632 1:99936321-99936343 GGTGCTGCCCCCTGACTGCCTGG - Intergenic
916561947 1:165941040-165941062 GTTGCTGTTGCTTGAGGGCCGGG + Intergenic
917755422 1:178093878-178093900 GGAGCTGTGGCCTGAGAGTCAGG + Intergenic
922679373 1:227579279-227579301 GGTGGTGTTGGCTTAGGGCCAGG + Intronic
924433903 1:244021864-244021886 GGTTCTGTTGCCTGTAGGCCTGG + Intergenic
1062903750 10:1166093-1166115 GGTCCTGTTGTCTGGGAGCCTGG + Intergenic
1063134980 10:3208554-3208576 GGTCCTGATGGCCGAGTGCCAGG + Intergenic
1065226706 10:23550666-23550688 GGTACTATTGGATGAGTGCCTGG - Intergenic
1068773425 10:60847152-60847174 GCTGCAGTAGCCTGAGTGGCTGG - Intergenic
1069858844 10:71457650-71457672 GGGGCCGGTGCCTGAGTCCCAGG + Intronic
1070799032 10:79234208-79234230 GGTGCAGTTGCCAGGATGCCAGG + Intronic
1071601758 10:86961892-86961914 GGTGCTGAGGCCAGAGTGCAGGG + Intronic
1072219454 10:93315455-93315477 GGTGCTTTCGCCTGGGTGGCTGG + Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1074021970 10:109593716-109593738 GGTGCTGCTGCTTGACTCCCTGG - Intergenic
1074316871 10:112369109-112369131 GTTGCTACTGCCTGAGTGACAGG + Intergenic
1075558898 10:123453981-123454003 GGTGCTGTTGCTTCAGTTTCTGG + Intergenic
1076450842 10:130556028-130556050 CATCCTGTTGCCTGAGTCCCTGG + Intergenic
1076587035 10:131556325-131556347 TGTCCTGCTGGCTGAGTGCCTGG - Intergenic
1076729545 10:132431512-132431534 GGAGCTCTTGTCTGAGTTCCAGG + Intergenic
1076745113 10:132509079-132509101 GGGGCTGTTGGCTGAATCCCTGG - Intergenic
1077230267 11:1455485-1455507 GCAGCAGTGGCCTGAGTGCCCGG - Intronic
1077289268 11:1781401-1781423 GGTGCTGTGGCCTCAGGGCCTGG - Intergenic
1077420852 11:2449232-2449254 GGAGCTGTGGCTTCAGTGCCAGG - Intronic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1083006811 11:59354954-59354976 AGTGCTGTAGCCTGATTCCCAGG - Intergenic
1083985749 11:66214090-66214112 GGTGCAGCTCCCTGTGTGCCAGG + Intronic
1084524450 11:69686971-69686993 GTGACTGTTGCCTGAGTGGCTGG - Intergenic
1085187297 11:74586773-74586795 GATGCTGTAGCCAGATTGCCTGG + Intronic
1085467156 11:76731793-76731815 GTTGCTGCTGCCTGACTACCTGG - Intergenic
1087141398 11:94768735-94768757 GGTCCAGTTGCCTGCGGGCCGGG + Intronic
1089145626 11:116327917-116327939 GGTGCTGTAGCCTCATTCCCAGG + Intergenic
1089703278 11:120258722-120258744 GCAGCAGTGGCCTGAGTGCCTGG + Intronic
1090613711 11:128495466-128495488 GCCTCAGTTGCCTGAGTGCCAGG - Intronic
1090954555 11:131502831-131502853 GCTTTTGTTGCCTGAGTGCAGGG + Intronic
1091551056 12:1535091-1535113 GGGGCTGGTGCCTGAGTTCTAGG + Intronic
1094368467 12:29709219-29709241 GGTGATGTTGTCAGACTGCCTGG + Intronic
1099845274 12:88020833-88020855 TGTGCTGTGGCCTGAGGGCATGG - Intronic
1100007036 12:89906992-89907014 GTTGCTGTTGCTGGAATGCCAGG + Intergenic
1102631486 12:114284721-114284743 GATGCTGTTTGCTGCGTGCCTGG - Intergenic
1103418856 12:120763647-120763669 GCTGCTGTGTCCTGAGAGCCTGG - Exonic
1103612508 12:122132599-122132621 TGTGCTTCTGCCTGAGTGCCAGG + Intronic
1104586402 12:130051484-130051506 GGTTCTGTAGCTTGACTGCCTGG - Intergenic
1104766488 12:131333466-131333488 TGTGATGCTGCCTGAGTGTCGGG - Intergenic
1106173318 13:27307798-27307820 GCGGCTGTTGCCTGAGACCCAGG + Intergenic
1107694359 13:42986053-42986075 AGTGCTGTTGCAGGACTGCCAGG - Intronic
1107768711 13:43766481-43766503 GGTGCTTTGGCTTGAGTGCGTGG - Intronic
1108312053 13:49203503-49203525 AGTGCTATATCCTGAGTGCCTGG - Intronic
1108313371 13:49216967-49216989 ACTGCTGTTTCCTTAGTGCCTGG - Intergenic
1108914619 13:55591410-55591432 GTTACTGTTGCCTTAGTGCAGGG + Intergenic
1109309393 13:60674010-60674032 GGTGCTGTTTCATTAGGGCCAGG + Intergenic
1110975137 13:81822862-81822884 GATGCTCTTGCCTGAGTGTAAGG + Intergenic
1111592165 13:90362956-90362978 GGTGCTGTTGCTTGATTACCAGG + Intergenic
1113766192 13:112882388-112882410 GCTGCTGTTTCCTGCTTGCCCGG + Exonic
1113801357 13:113088098-113088120 GGTGCCGTGCCCTGGGTGCCAGG + Intronic
1118309145 14:64679974-64679996 GGTGATGTTGACTATGTGCCAGG - Intergenic
1119329432 14:73783228-73783250 GGTGATGTTGCTGGAGTCCCGGG + Intronic
1120668268 14:87333296-87333318 GGGGTTGGTGCCTGAGAGCCTGG - Intergenic
1121483208 14:94294009-94294031 AGTGCTGTGGCCTAAGGGCCTGG + Intergenic
1122397642 14:101444973-101444995 GGTCCTCTTCCCGGAGTGCCAGG - Intergenic
1122446753 14:101775453-101775475 GGTGCTGTTGCCTGGCTGCACGG + Intronic
1123449322 15:20350194-20350216 GGAGCAGTTGTCTGAGGGCCAGG + Intergenic
1128729110 15:70008808-70008830 GATGCTGAAGCCTGACTGCCTGG - Intergenic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1129740642 15:77987999-77988021 ACTCCAGTTGCCTGAGTGCCAGG - Intronic
1129845102 15:78764558-78764580 ACTCCAGTTGCCTGAGTGCCAGG + Exonic
1130256735 15:82329303-82329325 ACTCCAGTTGCCTGAGTGCCAGG - Intergenic
1130598215 15:85260685-85260707 ACTCCAGTTGCCTGAGTGCCAGG + Intergenic
1131020099 15:89090168-89090190 GATTTTGGTGCCTGAGTGCCTGG + Intronic
1132185112 15:99797200-99797222 GGTGCTGGTGCCTGTCTTCCCGG - Intergenic
1132414924 15:101613043-101613065 TGTGCTGGTGCCTGGGTGTCGGG + Intergenic
1132519457 16:380818-380840 GGTGCTGTTCCCCGACTTCCCGG - Intronic
1132872579 16:2122374-2122396 GGGGCCGTTCCCTGTGTGCCTGG - Intronic
1133018409 16:2955347-2955369 GTTCCTGTTGCCGGAGTGACAGG - Intergenic
1133173079 16:3993697-3993719 GGTCCTGTTGCGTTCGTGCCCGG - Intronic
1133927673 16:10206277-10206299 GGTTCTGCTGGCTGAGTGCCTGG - Intergenic
1134551677 16:15141574-15141596 GGGGCCGTTCCCTGTGTGCCTGG - Intergenic
1134651567 16:15913149-15913171 CGTGCTGTTGCCATGGTGCCTGG + Intergenic
1134810553 16:17163516-17163538 GGTTCTGGGGCATGAGTGCCAGG - Intronic
1135464160 16:22670822-22670844 GGTGCTGTTGCCTGAGGAAGGGG + Intergenic
1136117074 16:28101283-28101305 GGTGCTGTAGCCTGATTGAGGGG - Intronic
1136401147 16:30019685-30019707 GGAGCAGTTGCCTGTGGGCCTGG + Intronic
1136573398 16:31109625-31109647 GGGGCTGGAGCCTGAGTGTCTGG - Intronic
1138442657 16:57044430-57044452 GATGCGGTGCCCTGAGTGCCTGG - Intronic
1141117656 16:81324361-81324383 GCTGCTGTGGCCTGGGTGACGGG + Intronic
1141844202 16:86596046-86596068 AGGGCTCTTGCCTGTGTGCCAGG + Intergenic
1143871438 17:9959646-9959668 TGTGCTGATTCCTCAGTGCCAGG - Intronic
1144125936 17:12202872-12202894 GGGCCTGTTTCCTGATTGCCAGG - Intergenic
1144372466 17:14605344-14605366 CTTTCTGTTCCCTGAGTGCCCGG + Intergenic
1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG + Exonic
1146510857 17:33447143-33447165 GGTCCTGGTACATGAGTGCCCGG + Intronic
1147167103 17:38599404-38599426 GGTGTGGTTGCCAGAGTGCAGGG - Intronic
1147948486 17:44093667-44093689 GCTGCTGCTGCTTGAGCGCCAGG + Exonic
1148212139 17:45815036-45815058 AGTGCTGTTTCCTGAGAGACTGG + Intronic
1151821704 17:76500494-76500516 GCTGCTGTTGCCTGGGCGGCTGG - Intronic
1151955780 17:77379515-77379537 GGTGCTGTTCCCTGATAGCCTGG + Intronic
1151991228 17:77575904-77575926 AGTGCTGTGGCCTGAGGGCAGGG - Intergenic
1152339321 17:79715672-79715694 GGAGCAGCTGTCTGAGTGCCAGG - Intergenic
1152585920 17:81189387-81189409 GGGGCTGCTGGCTGAGTGCTGGG + Intergenic
1152750137 17:82058837-82058859 GGTGCTGGTGAGTGAGGGCCAGG + Intronic
1153713872 18:7825887-7825909 GTTGGTGTTTCCTGTGTGCCTGG + Intronic
1154230904 18:12555262-12555284 GGTTCTGTTGCCAAAGTGCCAGG - Intronic
1155046776 18:22109767-22109789 GGTGCTCTTGCCTCAGCCCCTGG - Intergenic
1156538898 18:37890759-37890781 AGTGCTGCTTCCTGAGTGCTGGG - Intergenic
1158873511 18:61711172-61711194 GGCGTGATTGCCTGAGTGCCAGG - Intergenic
1160419729 18:78735698-78735720 GGCTCTGTGGCCTGGGTGCCAGG + Intergenic
1161041558 19:2113261-2113283 AGGGCTCTTCCCTGAGTGCCAGG + Intronic
1161167172 19:2794545-2794567 GGTGCTGTTGCCTGTGTCCTTGG - Intronic
1161252063 19:3285720-3285742 GGGGCTATTGCCTGAGGGGCGGG - Intronic
1162130094 19:8521197-8521219 TGTGCTGTTGGCAAAGTGCCAGG - Exonic
1163567216 19:18058810-18058832 GTTCCTGTTACCGGAGTGCCCGG + Intergenic
1164465329 19:28482931-28482953 GGATCTGTTGCCTGCCTGCCTGG - Intergenic
1165321310 19:35086901-35086923 GGTGATGATGTGTGAGTGCCCGG - Intergenic
1166315165 19:41985496-41985518 GGGGCTGAAGCCTGTGTGCCTGG + Intronic
1166636663 19:44457195-44457217 GGTGGTGATTCCGGAGTGCCCGG + Intergenic
1166669906 19:44703610-44703632 GATGTAGGTGCCTGAGTGCCGGG - Exonic
1167211268 19:48135627-48135649 GGGGCTGTGGGCAGAGTGCCAGG - Intronic
1202648730 1_KI270706v1_random:162215-162237 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
925007707 2:457201-457223 GGTTCTGTTGCCTAAGTTTCAGG + Intergenic
925425483 2:3746081-3746103 GAGGCTGTTGGCTGAGTGCCAGG + Intronic
926977911 2:18533449-18533471 GGTGGTGTTCCCTGATTGCCAGG - Intergenic
927516387 2:23674258-23674280 ACTGCTGTTTCCTGTGTGCCAGG - Intronic
927852218 2:26506512-26506534 GGCCCTGCTGCCTGAGTCCCGGG + Intronic
929825818 2:45308958-45308980 GATGCTGGTGCCAGACTGCCTGG + Intergenic
930022090 2:47007705-47007727 GGTGCTGCAGCCTGAGTGCGGGG + Intronic
930224770 2:48780857-48780879 GGTGCTGCTTCCTGAGTCCTGGG - Intergenic
932418985 2:71590370-71590392 GGTGCTGTTTGCTGGGTGCATGG + Intronic
932484875 2:72078668-72078690 GGTGCTGTTGCCAGATTGCAAGG - Intergenic
932489830 2:72113636-72113658 GGTGCTGAGGCCTGAGGACCAGG + Intergenic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
936271681 2:111054027-111054049 AGTGATGTTGAGTGAGTGCCTGG + Intronic
937218974 2:120330552-120330574 GATGATGTAGGCTGAGTGCCTGG - Intergenic
938265955 2:129928401-129928423 GGTGAGGGTGCCTGAGTTCCAGG - Intergenic
938541424 2:132286808-132286830 GGTGGTGTGCCCTGGGTGCCTGG + Intergenic
939007895 2:136810166-136810188 CGTGCTGCTGCCTGAGTTCATGG + Intronic
939143129 2:138379305-138379327 GGGGCTGGTGCCAGGGTGCCAGG - Intergenic
941185588 2:162318349-162318371 GGTGCTGTTGTCTGCGGGACAGG + Exonic
946227552 2:218272245-218272267 GGTGCTGTTGCAGGAATGCAGGG + Intronic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
947547014 2:231017350-231017372 GGTGCTTTTGGCTCTGTGCCAGG - Intronic
947566373 2:231196542-231196564 AGTGCATTTGCCTGACTGCCGGG - Intergenic
947912004 2:233807743-233807765 TGTGCTTTGGCCTGTGTGCCCGG + Exonic
948155326 2:235776812-235776834 GGTGCCGATGCCTGAGGGACGGG - Intronic
948523925 2:238558986-238559008 GGGGCTGGCGCCTGAGTGCCAGG + Intergenic
948702589 2:239769642-239769664 GGTGCAGTGGCCTTGGTGCCAGG + Intronic
948884941 2:240877746-240877768 GGTGGTGTGGCCTCGGTGCCAGG + Intronic
948904717 2:240973379-240973401 GGTGATGCTGAGTGAGTGCCAGG - Intronic
1168908523 20:1426435-1426457 GGTCTTGTTGACTGAGTCCCTGG - Intergenic
1170542867 20:17406723-17406745 GTAGCTGCTGCCTGAGTGACTGG - Intronic
1170853007 20:20021005-20021027 GGTGCAGATGCCTGTGTGCGTGG + Intronic
1170987485 20:21271885-21271907 CTTGCTGTTGCCTGGGTTCCTGG - Intergenic
1171870321 20:30519830-30519852 GGTGGTGTGTCCTGGGTGCCTGG + Intergenic
1172937359 20:38629688-38629710 GGTGCTGGTGCCTGAGCACAGGG - Intronic
1173317409 20:41957507-41957529 TGTGCTGGAGCCTGATTGCCTGG + Intergenic
1173333216 20:42092860-42092882 GGTGAGGGTGCCTGAGTGCAAGG - Intronic
1173929694 20:46808156-46808178 GCTGCTGTGAACTGAGTGCCAGG + Intergenic
1173943817 20:46934249-46934271 GTTGATGTTGTTTGAGTGCCTGG - Intronic
1174188086 20:48721202-48721224 GGGCCTGTTTCCTCAGTGCCTGG - Intronic
1175899940 20:62355950-62355972 CCCGCTGTTCCCTGAGTGCCTGG + Intronic
1176603091 21:8810326-8810348 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
1176898937 21:14416941-14416963 TGTGCTGTGTCCTGACTGCCTGG + Intergenic
1177248447 21:18561805-18561827 TCTGCAGTTGCCTGAGTTCCTGG + Intergenic
1177359236 21:20047642-20047664 TGTGCTGTGGCCTGAGAGCATGG - Intergenic
1179920747 21:44505992-44506014 AGTGCTGTGGCCTCTGTGCCTGG + Intronic
1180174210 21:46079689-46079711 GGTGCTGTTGGCTACGTGCGTGG - Intergenic
1180248535 21:46564270-46564292 TGTGCTCCTGCCTGGGTGCCAGG - Intronic
1180345377 22:11701883-11701905 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
1180352342 22:11815429-11815451 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1180352390 22:11815720-11815742 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1180353147 22:11820124-11820146 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
1180385093 22:12172233-12172255 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1180385867 22:12176637-12176659 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
1181171961 22:21014961-21014983 GCTGCTGTTCTCTGTGTGCCAGG + Intronic
1181462911 22:23095817-23095839 GGTGCTCTTGCCTGAGTTGCTGG - Exonic
1181467053 22:23115948-23115970 AGTGCGGTTGGCTGAGGGCCTGG + Intronic
1182266305 22:29118519-29118541 GGTGCTGGTGACTCAGTGCCTGG + Intronic
1182967017 22:34531876-34531898 GCTGCTGTATCCTGAGTACCTGG + Intergenic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1183831144 22:40418899-40418921 GGTCCTGTTGCCTGAGCCCTGGG - Exonic
1183978877 22:41528249-41528271 TGGGCTGTCCCCTGAGTGCCAGG - Exonic
1184226959 22:43134617-43134639 GTTCCTGTTGCCTGAGTCCTGGG + Intronic
1184670747 22:46011341-46011363 GGCGCTGTTTGCTCAGTGCCCGG - Intergenic
1185040432 22:48501205-48501227 GGAGCTGTGGCCTGAATGCATGG + Intronic
1185216428 22:49602352-49602374 GGTGCTGGTGTCTGCCTGCCCGG - Intronic
1185250864 22:49800988-49801010 GGTGCTGTTGCCAGGAGGCCTGG - Intronic
1185281656 22:49972348-49972370 GGTGCGGCTGCCTGAGGGGCAGG - Intergenic
949227000 3:1706113-1706135 GCTGCTGTGGCCAGACTGCCAGG + Intergenic
949951196 3:9230118-9230140 GGTGACGCTGACTGAGTGCCAGG + Intronic
953449116 3:42991636-42991658 GGTCATGCTGCCTGGGTGCCTGG + Intronic
954160389 3:48717317-48717339 GGCGCTGTTGCTAGGGTGCCAGG + Intronic
955051467 3:55415152-55415174 TCTGCTGATTCCTGAGTGCCAGG - Intergenic
956607082 3:71083733-71083755 GATGACGTTACCTGAGTGCCTGG + Intronic
961466531 3:127085150-127085172 GGAGGTGTTGCGTGGGTGCCTGG + Intergenic
961660037 3:128463661-128463683 GGTGGTGTGGGCTGAGTCCCGGG + Exonic
963094779 3:141524502-141524524 GCTGCTGTTGACTGTTTGCCAGG + Intronic
967371276 3:188749184-188749206 GGCGCTGTTGCCTGATTGTGAGG - Intronic
969841608 4:9887045-9887067 GGTGGAGTGGCCTGACTGCCAGG - Intronic
971171489 4:24237926-24237948 GATGCCATTGGCTGAGTGCCGGG - Intergenic
971298879 4:25425621-25425643 GGTCCTGTGGCCAGACTGCCTGG - Intergenic
973376758 4:49292219-49292241 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
973378647 4:49304801-49304823 GGTGGTGTTTCCGGGGTGCCTGG + Intergenic
973379571 4:49310853-49310875 GGTGGTGTTTCCGGGGTGCCTGG - Intergenic
973380435 4:49316849-49316871 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
973381447 4:49323456-49323478 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
973386013 4:49514819-49514841 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
975105159 4:70559672-70559694 GGTGCTTTTTCTTGAGTCCCAGG - Intergenic
975414166 4:74088557-74088579 GGTACTATTGCCTGGGTGCCAGG - Intergenic
975892848 4:79050046-79050068 GGTGCTCCTGCCTGGCTGCCAGG - Intergenic
985579389 5:688988-689010 GCTGCTGGTGCCTCAGGGCCAGG - Intronic
985594235 5:781047-781069 GCTGCTGGTGCCTCAGGGCCAGG - Intergenic
986637150 5:9834638-9834660 GGAGCTATTGCCTGTGTCCCTGG - Intergenic
988105307 5:26739740-26739762 GTGGCTGTTGCTAGAGTGCCAGG + Intergenic
990863800 5:60358106-60358128 GGCTCTGTTGCCAGACTGCCTGG - Intronic
993287290 5:86015974-86015996 GGTGATGCTGCCTGAGAGCCAGG + Intergenic
995753506 5:115477543-115477565 GGGTCTGGTGCCAGAGTGCCTGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
997885911 5:137629928-137629950 GGCAGAGTTGCCTGAGTGCCTGG - Intronic
998137645 5:139682579-139682601 GGCGCTGTTGCCTTTGGGCCAGG + Intronic
998325026 5:141272590-141272612 GGTCCTTTTGCCTAAGTGCTAGG + Intergenic
998393840 5:141805705-141805727 CCTGTTGTTGCCTGATTGCCTGG - Intergenic
1001169840 5:169408762-169408784 GATGCTGATGCCTGAATGCATGG - Intergenic
1002888686 6:1316745-1316767 GAGGCTGCTGCCTGAGTGCAGGG - Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1004349712 6:14880441-14880463 GGGGCTGCTGCCTGAGCCCCTGG - Intergenic
1004669396 6:17781664-17781686 GTTGCTGATGCTTGAGTGCACGG + Intronic
1006419554 6:33924735-33924757 GGTTCTGCTGGCTGAGTTCCTGG - Intergenic
1006516584 6:34548979-34549001 GGAGCAGTGGCCTGAGTGTCAGG - Intronic
1017754255 6:157516418-157516440 GTTGCGGGTCCCTGAGTGCCTGG + Intronic
1021464099 7:20922214-20922236 TGTACTGTTTTCTGAGTGCCTGG + Intergenic
1021812351 7:24415246-24415268 GGTGCTGGAGCCAGACTGCCAGG - Intergenic
1022853002 7:34284098-34284120 GGTGCTGTTGCCTCTCTTCCAGG - Intergenic
1023081865 7:36533891-36533913 GCTGCTTTTGCCTTGGTGCCTGG + Intronic
1023371900 7:39520036-39520058 GGTCCTCTTACCTGAGGGCCGGG - Intergenic
1023569233 7:41555168-41555190 GGTGCTATTTCCTGGGTACCAGG + Intergenic
1023932044 7:44711983-44712005 GGGGCTGTTCCCTCTGTGCCAGG + Intergenic
1024152087 7:46582250-46582272 GCCTCTGTTTCCTGAGTGCCTGG - Intergenic
1025785865 7:64642841-64642863 AGTCATGTTGCCTGAGTGACAGG - Intergenic
1026055584 7:66980852-66980874 AGTGCTGTTGCCAAAATGCCAGG - Intergenic
1026722110 7:72840967-72840989 AGTGCTGTTGCCAAAATGCCGGG + Intergenic
1026942157 7:74293430-74293452 GGGGCTGTAGCCTGAGTCCACGG + Intronic
1027390769 7:77701470-77701492 GGTGGTGTTCCCTTATTGCCTGG + Intronic
1030426712 7:109387624-109387646 GGTGCTGCTGACTTGGTGCCTGG + Intergenic
1034934203 7:155187972-155187994 GGGGCTGTGGGGTGAGTGCCTGG - Intergenic
1035616222 8:1003726-1003748 AGGGCTGTTGTCTGAGCGCCTGG + Intergenic
1036217075 8:6889687-6889709 GGTGGTGCTGCCTGAGAGTCCGG + Intergenic
1037763358 8:21756699-21756721 GGGGCTGTAGCCCCAGTGCCAGG - Intronic
1038473513 8:27844993-27845015 GCTGCTGTTGTCTTAGTGGCAGG - Intergenic
1039589067 8:38731269-38731291 GGCTCTGTAGCCAGAGTGCCTGG + Intronic
1044800428 8:95948333-95948355 TCTGCTGTTTCCTGAATGCCTGG - Intergenic
1048835966 8:138519220-138519242 CATCCTGTTGCCTGAGGGCCTGG - Intergenic
1049586708 8:143435731-143435753 GGTTCTGTGCCCTGTGTGCCTGG - Intergenic
1049678275 8:143903173-143903195 GGGGCAGCTGCCTGAGTCCCCGG - Intergenic
1050397477 9:5214571-5214593 GGTCCTGTAGCCTGAGTCCATGG - Intergenic
1055134213 9:72808319-72808341 GGTGCTGTTGCCCTAGAGCTAGG + Intronic
1057125989 9:92616797-92616819 AGTGCTGTGCGCTGAGTGCCCGG - Exonic
1057436446 9:95045057-95045079 GGTGCTGTTTCCTGACACCCTGG + Intronic
1057948609 9:99351930-99351952 AGTTCTGGTGCCTGAGTACCAGG + Intergenic
1059929492 9:119247061-119247083 TGTGCTCTTGTCTGAGTTCCTGG - Intronic
1060811830 9:126614578-126614600 GGTGCTGCTGGGTGAGTGCGGGG + Exonic
1061832303 9:133303836-133303858 GGGGCAGCTGCCTGAGTGGCAGG + Intergenic
1062053290 9:134458194-134458216 GGTGCTGTGCCCTGAGACCCAGG + Intergenic
1062141762 9:134963020-134963042 GGTGCTGTTGGCTGACTGTGGGG + Intergenic
1062512713 9:136916211-136916233 GGTGCTGAGGCCTCAGGGCCTGG - Intronic
1203698659 Un_GL000214v1:118283-118305 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1203701472 Un_GL000214v1:136883-136905 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1203480308 Un_GL000224v1:5467-5489 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1203481275 Un_GL000224v1:11795-11817 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1203482239 Un_GL000224v1:18104-18126 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1203548825 Un_KI270743v1:151968-151990 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1203549594 Un_KI270743v1:156434-156456 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
1203549617 Un_KI270743v1:156581-156603 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
1203550559 Un_KI270743v1:162746-162768 GGTGGTGATTCCTGGGTGCCTGG - Intergenic
1203569900 Un_KI270744v1:120818-120840 GGTGGTGATTCCTGGGTGCCTGG + Intergenic
1185464979 X:349100-349122 GGTGCTATGGCCTGAATGCCTGG + Intronic
1189711586 X:43818503-43818525 CCTGCTGTTGCCTGTGTGCAAGG - Intronic
1192839111 X:74835883-74835905 GGAGATGTTGTCTGGGTGCCAGG + Intronic
1196121063 X:112051166-112051188 GATGCTGTTTCCTTGGTGCCAGG + Intronic
1197152888 X:123239299-123239321 TGTCCTGTTTCCTCAGTGCCTGG + Intronic
1197723311 X:129759490-129759512 TTTGTTGTTGCCTGTGTGCCTGG + Intronic
1199978430 X:152907686-152907708 GCTGGTGTTGCCTGAGTACGGGG + Intergenic
1200890153 Y:8314722-8314744 AGTACTGTTACCTGTGTGCCTGG - Intergenic
1202268311 Y:23044231-23044253 AGTTCTCTTGCCTGTGTGCCTGG - Intergenic
1202421303 Y:24677975-24677997 AGTTCTCTTGCCTGTGTGCCTGG - Intergenic
1202449483 Y:24992107-24992129 AGTTCTCTTGCCTGTGTGCCTGG + Intergenic