ID: 1183382128

View in Genome Browser
Species Human (GRCh38)
Location 22:37495571-37495593
Sequence TAGGAGCTGCTGGGCTCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183382122_1183382128 10 Left 1183382122 22:37495538-37495560 CCGGCTGGAGGGCAGGCATTTCT 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1183382128 22:37495571-37495593 TAGGAGCTGCTGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 285
1183382120_1183382128 18 Left 1183382120 22:37495530-37495552 CCTCGGTGCCGGCTGGAGGGCAG 0: 1
1: 0
2: 1
3: 26
4: 324
Right 1183382128 22:37495571-37495593 TAGGAGCTGCTGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183382128 Original CRISPR TAGGAGCTGCTGGGCTCTGT GGG Exonic
900741128 1:4331567-4331589 TGGGAGCTGCAGGGCTCAGCGGG - Intergenic
901205676 1:7494474-7494496 GAGCAGCTGCTGGGGTCTGGGGG + Intronic
901244885 1:7722054-7722076 TAGGTGCTGCTGGGGCCTGAGGG + Intronic
901493931 1:9610691-9610713 TCGGAGCTGCTGGGCGTGGTGGG - Exonic
902231064 1:15027973-15027995 AAGGAGCCTCTGGGCTCTGTCGG - Intronic
902243257 1:15102514-15102536 CCTGAGCTGCTGGGCACTGTGGG + Intronic
902417338 1:16248263-16248285 TGGTAGCTCCTGGGCACTGTGGG - Exonic
902616885 1:17628665-17628687 TGGGAGCCTCTTGGCTCTGTGGG + Intronic
902986504 1:20157556-20157578 TAGGAGCTGTGGGGTTCTGCAGG + Intergenic
903970899 1:27118213-27118235 TAGGCCCTGATGGGCTCTCTGGG + Intronic
904247175 1:29196027-29196049 AAGGACATGCTGGGCTCTGAGGG + Intronic
904311749 1:29633511-29633533 TGGGAGCTGCTGAGCACAGTGGG + Intergenic
905916661 1:41689337-41689359 TAGGCGCTGAGGGGCTCTCTCGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906207668 1:43995807-43995829 CAGGAGCTGCAGGCATCTGTGGG + Exonic
906723145 1:48023750-48023772 TGACACCTGCTGGGCTCTGTGGG + Intergenic
906949389 1:50322245-50322267 AAGGAGCTGATAGGGTCTGTGGG - Intergenic
907301606 1:53490292-53490314 TGGGTGTTTCTGGGCTCTGTGGG + Intergenic
909492294 1:76239017-76239039 AAGGGGCTGCTGGGCTCCATTGG + Intronic
913305494 1:117426355-117426377 TTTAAGCTGCTGGGGTCTGTGGG + Intronic
914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG + Intronic
915281279 1:154823790-154823812 GAGGAGCAGCTGAGATCTGTGGG + Intronic
916143395 1:161719458-161719480 AAGGCGCTTCAGGGCTCTGTAGG + Intergenic
917473632 1:175349122-175349144 TAGGAGCTTCTGTGCACTGTTGG + Intronic
920252381 1:204630331-204630353 TCGGAGGGGCTGGGCTCTGGCGG + Intronic
921297465 1:213718260-213718282 TCACAGCTGCTGGGCTTTGTGGG - Intergenic
924793052 1:247270501-247270523 CAGGGCCTGCTGGGGTCTGTGGG - Intergenic
1062917615 10:1253885-1253907 TAGGATGCGGTGGGCTCTGTGGG + Intronic
1065483304 10:26215267-26215289 TCGGAGCTCCGGGGCTCTGGGGG - Intergenic
1067234680 10:44437616-44437638 GAGGAGCTGATGGGCCCTGGGGG + Intergenic
1069212642 10:65780276-65780298 CAGGGGCTGCTGGGCTGAGTGGG + Intergenic
1069651877 10:70054433-70054455 TAGGGGATCCTGGGGTCTGTGGG - Intronic
1069907884 10:71742522-71742544 TAGGAGCTGATGAGCTGTGTTGG + Intronic
1070838813 10:79469000-79469022 TAGGCACTGCAGAGCTCTGTGGG + Intergenic
1072008913 10:91286597-91286619 AAGGAGAGGCTGGGCTTTGTAGG - Intergenic
1073146618 10:101285647-101285669 GGGGAGCTCCTGGGCTCAGTGGG + Intergenic
1073146626 10:101285669-101285691 GGGGAGCTCCTGGGCTCAGTGGG + Intergenic
1074818726 10:117163653-117163675 AAGGCGCGTCTGGGCTCTGTAGG - Intergenic
1074904979 10:117853506-117853528 TAAATGCTGCTGAGCTCTGTGGG - Intergenic
1077174570 11:1182850-1182872 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077174785 11:1183969-1183991 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077323384 11:1952548-1952570 GAGAACCTGCTGGCCTCTGTTGG + Intronic
1077415422 11:2422366-2422388 TGGGAGCTGCTGGGCATTGGGGG + Intronic
1077908835 11:6557292-6557314 TAGGAGCAGCTTGGCACAGTAGG - Exonic
1080681763 11:34483389-34483411 TAGGTGCTGCAGGGTTATGTTGG - Intronic
1083736640 11:64685352-64685374 TGGGAGCAGCTGGGCTCTCGAGG - Intronic
1083745876 11:64736264-64736286 TAGCTGCTTCTGGGCTCTGGAGG - Intronic
1084479842 11:69413498-69413520 AAGGAGCTGCTGGTCTCTACTGG - Intergenic
1084596610 11:70120440-70120462 TAGGACCACCTGGGCCCTGTTGG + Intronic
1086091857 11:83012786-83012808 TACGAGGTGCTGGGCTGTGGAGG - Intronic
1087729272 11:101760015-101760037 TATGAGCAGATAGGCTCTGTGGG + Intronic
1089330941 11:117688513-117688535 TAGGAGCTGCAAGTCTGTGTGGG - Intronic
1089590967 11:119540518-119540540 TTGGGGGTGCTGGGCTGTGTGGG - Intergenic
1089706946 11:120284866-120284888 TCAGAGCAGCGGGGCTCTGTGGG - Intronic
1090076186 11:123581393-123581415 GAGGAGCTGCCGGCCTCTGGGGG - Intronic
1202806372 11_KI270721v1_random:7743-7765 GAGAACCTGCTGGCCTCTGTTGG + Intergenic
1091600250 12:1913636-1913658 CTGGAGCTGCTGAGCTCTGCTGG - Intronic
1091810224 12:3390855-3390877 TAGGAGGTGCTAGGCTCCGGAGG - Intronic
1092265762 12:6979169-6979191 CAGAAGCTGCTGTGCTCTGAGGG + Intronic
1093308235 12:17545051-17545073 TAGGAGCTGTTGGGCTTTCAGGG + Intergenic
1094841538 12:34344509-34344531 TCGGAGCTGCTGGGCCCCGCGGG - Intergenic
1094847254 12:34366717-34366739 GTGGGGCTGCGGGGCTCTGTGGG + Intergenic
1096613080 12:52815896-52815918 TAGGGGCAGCTTGGGTCTGTGGG - Intergenic
1098029858 12:66242540-66242562 TAGCAGCTGCTGGGTTCTCCAGG + Intronic
1101900271 12:108786872-108786894 TAGTCGCTGCCTGGCTCTGTGGG - Exonic
1102703657 12:114862473-114862495 TAGGGGCTGGTGAGCTCTGAGGG + Intergenic
1103996232 12:124831961-124831983 TAGGATCCTCTGGTCTCTGTGGG - Intronic
1104292780 12:127484685-127484707 TAGGAGCTGTAGGGTTCTGCAGG + Intergenic
1104681128 12:130752701-130752723 TCAGAGCTGCTGGGCATTGTGGG + Intergenic
1104725678 12:131074351-131074373 CAGGGGCTGCTGAGCTCTGCTGG - Intronic
1107949274 13:45447167-45447189 CAGGAGCTGCAGGGTCCTGTAGG - Intergenic
1107964491 13:45587015-45587037 GAGGCGCAGCCGGGCTCTGTGGG - Intronic
1110568569 13:76980212-76980234 TCGGAGGTGCTGGGGTATGTGGG - Intergenic
1111839616 13:93433726-93433748 CAGGGGCTGCTGGGCTATGGTGG + Intronic
1112705248 13:102060946-102060968 AATGACCTGCTGGCCTCTGTTGG - Intronic
1112864675 13:103879333-103879355 TAGCAGCTTCTTGGCACTGTTGG + Intergenic
1113133832 13:107067348-107067370 TAGGATCAGCTGGTCTCTGCAGG + Intergenic
1113634745 13:111911981-111912003 CAGGTGCTGCCGGGCTTTGTAGG - Intergenic
1113961249 13:114127469-114127491 AAGGGGCTGCTGGTCTGTGTGGG - Intronic
1114055654 14:18965318-18965340 AGGGAGCAGCTGGGCTCAGTGGG - Intergenic
1114106892 14:19436445-19436467 AGGGAGCAGCTGGGCTCAGTGGG + Intergenic
1114297105 14:21339802-21339824 TAGTAACTGCCGGGCTCTGTGGG + Intronic
1118616190 14:67575955-67575977 TAGGTGGGGCTGTGCTCTGTGGG - Exonic
1120875067 14:89367974-89367996 TAGGAGCTGCTGACCTCGGCAGG + Intronic
1121021063 14:90580482-90580504 GAGGAGATGCTGTTCTCTGTGGG - Intronic
1121048074 14:90802421-90802443 AAGGAGCCGCTGGCCTCTGAAGG + Intronic
1121775149 14:96585347-96585369 TGGGGGCTGCTGGGCTTTCTGGG + Intergenic
1121974822 14:98393460-98393482 AAGGGGCTGCTGGTATCTGTGGG + Intergenic
1122177087 14:99928653-99928675 TCTGAGCTGCTGGTCTCTGTAGG + Intronic
1122272810 14:100575911-100575933 TGGGGGCTGCTGGGCCCTGGGGG - Intronic
1122770531 14:104095752-104095774 CAGGAGCTGCTGGGCTGAGCAGG - Intronic
1124201269 15:27680325-27680347 AAGGAGCCACTGGCCTCTGTCGG + Intergenic
1125181957 15:36888186-36888208 GAGGAGCTGTTGGGCTCTGCCGG + Intergenic
1126670623 15:51112245-51112267 TGTGAGCTACTGGGCACTGTTGG + Intergenic
1126856576 15:52845204-52845226 TAGGATCTGCTGGGCTGAGCAGG - Intergenic
1129735507 15:77959386-77959408 GAGGAGGAGCTGGGCTTTGTTGG + Intergenic
1129790064 15:78335199-78335221 TAGGAGGTGGTGGGGTCTGAAGG - Intergenic
1129975918 15:79821582-79821604 TAGAAGCTGCTGGCCCCTGATGG - Intergenic
1130274733 15:82470395-82470417 AAGCAGCTGCTGGGGCCTGTGGG + Intergenic
1130467078 15:84197769-84197791 AAGCAGCTGCTGGGGCCTGTGGG + Intergenic
1130497186 15:84475767-84475789 AAGCAGCTGCTGGGGCCTGTGGG - Intergenic
1130510825 15:84587935-84587957 GAGGAGGAGCTGGGCTTTGTTGG + Intergenic
1130589377 15:85202362-85202384 AAGCAGCTGCTGGGGCCTGTGGG + Intergenic
1132038597 15:98506155-98506177 TTAGATCTTCTGGGCTCTGTTGG - Intronic
1132442887 15:101886151-101886173 TCTTAGCTTCTGGGCTCTGTAGG + Intergenic
1132865947 16:2092813-2092835 TAGGTGCTGCTGGCATCAGTAGG - Intronic
1133207483 16:4242076-4242098 GAGGAGCAGCTGGGCTCTCTTGG - Exonic
1133382936 16:5346139-5346161 GTGGAGCTCCTGGGCTCTGGAGG + Intergenic
1134254900 16:12602810-12602832 TAGGAGCTACTGGACACAGTGGG + Intergenic
1134766213 16:16760461-16760483 GTGGTTCTGCTGGGCTCTGTTGG + Intergenic
1137480654 16:48849310-48849332 TAGGACCTGGTGTGGTCTGTGGG - Intergenic
1137674933 16:50299491-50299513 TCTGAGCAGCTGGGGTCTGTGGG + Intronic
1138093362 16:54194208-54194230 TGGGTGCTGCTGGGCACTGCTGG + Intergenic
1138194811 16:55044270-55044292 TAGGAGCTGAGCAGCTCTGTTGG + Intergenic
1138207399 16:55134905-55134927 TTGGAGATGATGGGCTCTGGGGG - Intergenic
1140054793 16:71516380-71516402 TAGGGGCTGCGGGGCGGTGTGGG + Intronic
1140407293 16:74719249-74719271 CGGGAGCTGCTGCCCTCTGTTGG + Intronic
1141362113 16:83405489-83405511 TAGGTGCTGCTGGCATCTCTTGG - Intronic
1142185813 16:88694261-88694283 CAGGATCTGCTGAGCTCTGACGG + Intergenic
1142304224 16:89276574-89276596 TGGGAGCTTCTGGGCAGTGTCGG - Intronic
1143399965 17:6637582-6637604 GTGGGGCTGCTGGGGTCTGTGGG - Intronic
1143627346 17:8118096-8118118 TAGGGGCTGCGGGGCTGGGTAGG + Exonic
1145007331 17:19345015-19345037 TGGGATCTGCTGGGCACAGTGGG - Intronic
1145233863 17:21194898-21194920 CAGCAGCTGCTGGGCCCTGAGGG - Intergenic
1146122571 17:30208478-30208500 TAGGAACTGCTGGGACCTCTCGG - Intronic
1146259558 17:31412647-31412669 GAGGAGCTCCCAGGCTCTGTGGG - Intronic
1146520916 17:33524931-33524953 AGGGAGCTGCTGGGCTCCCTAGG - Intronic
1147007873 17:37419015-37419037 AAGTAGAGGCTGGGCTCTGTGGG - Intronic
1148049332 17:44761399-44761421 TAGGAGGTTCTGGGCTGTGGTGG + Intronic
1148405742 17:47413462-47413484 TAGAAGCTGCTGAGTTCTGTTGG + Intronic
1148785926 17:50146203-50146225 AAGGTGGGGCTGGGCTCTGTGGG + Intronic
1148994538 17:51698070-51698092 CAGCAGCTGCTGCCCTCTGTGGG + Intronic
1149076004 17:52596619-52596641 TAGGAGCTGTAGGGTTCTGCAGG + Intergenic
1151450315 17:74194720-74194742 GAGGGGCTGCTGGCCTCTGCGGG + Intergenic
1152128102 17:78459548-78459570 CAGGTGCTGCTGACCTCTGTGGG + Intronic
1152715620 17:81899124-81899146 TGGGACTTGCTGTGCTCTGTTGG + Intronic
1154338484 18:13484182-13484204 TGGGTGATGCTGGGGTCTGTAGG + Intronic
1154384552 18:13881094-13881116 TAGGAACTGCTGGGGCCTCTAGG - Intergenic
1155159590 18:23184936-23184958 TATGAGGTGGTGGGGTCTGTGGG - Intronic
1160662870 19:309155-309177 CAGGAGCTGGAGGGCTCTGAGGG - Intronic
1160833539 19:1114060-1114082 TAGCAGCAGCTGGGCTCAGGTGG + Intronic
1161236698 19:3201815-3201837 GAGCAGCAGCTGGGCCCTGTGGG - Intronic
1162728078 19:12701728-12701750 TTGGGGCAGCTGGGCTCTGAGGG - Intronic
1162872775 19:13598809-13598831 TAGTTGCTGCTGGGCAATGTTGG - Intronic
1163916666 19:20246208-20246230 TAGGAGCTGTGGGGATCTGCAGG + Intergenic
1164737465 19:30552496-30552518 GAGGAGCTGCTGAGATCTGTGGG - Intronic
1165007292 19:32817626-32817648 GTGGAGCTGCTGGGCCCTGTGGG + Intronic
1165074203 19:33271852-33271874 GAGCAGCTGCTGGGCCCTGAGGG - Intergenic
1166858170 19:45793531-45793553 TAGGAGCTGTTGGGATCAGGGGG - Intergenic
1167072589 19:47229508-47229530 TGTGTGCTGCTGGGCTGTGTGGG - Intronic
1168187368 19:54708741-54708763 TGGGCTCTGGTGGGCTCTGTTGG - Intergenic
1168378931 19:55903991-55904013 TGGGATATGCTGGGCTGTGTAGG - Intronic
1168399961 19:56079974-56079996 TGGGAGCGGCTGGGCTCTAGGGG + Intergenic
925087277 2:1117885-1117907 TAGTTGCTGCTGTGCCCTGTTGG + Intronic
925681940 2:6431699-6431721 TTGGTGCTGCTGGTCCCTGTGGG - Intergenic
925770812 2:7281560-7281582 TTGGAGCAGGTGGGCTGTGTTGG - Intergenic
926192340 2:10738338-10738360 TAAGAGCTGCTGGGAGCTGGGGG - Intronic
927864143 2:26577988-26578010 AAGGAGCTGCTGCCCTCTGGTGG + Intronic
929144214 2:38692636-38692658 GAAGTGCTGCTGGGCTCTCTAGG + Intronic
930518413 2:52434624-52434646 TAGGAGCTGTGGGGTTCTGCAGG + Intergenic
931170362 2:59796940-59796962 TTGGAGCTCATGGGCTATGTAGG + Intergenic
931698511 2:64890114-64890136 TAGGAGCTGTGGGGTTCTGCAGG - Intergenic
931778087 2:65556941-65556963 TGGCAGCTGCTGAGCTCTCTCGG + Intergenic
932604846 2:73158044-73158066 AGGGAGCTGATGGGATCTGTTGG + Intergenic
935669917 2:105546341-105546363 TAGGACCTGAGGGGCTTTGTTGG + Intergenic
938473819 2:131589894-131589916 AGGGAGCAGCTGGGCTCAGTGGG - Intergenic
938823767 2:134984090-134984112 TAGTAGCTGCAGGCCTATGTGGG - Intronic
941041435 2:160628190-160628212 TAGGCCTTGCTGAGCTCTGTTGG + Intergenic
945323684 2:208457481-208457503 GTGGAGCTGCTGAGCTCTATTGG + Intronic
948125398 2:235561316-235561338 CAGGAGCTGCTGGGGTCTGCGGG + Intronic
948305519 2:236944376-236944398 TAGGGGCTGGTTGGCTCAGTGGG + Intergenic
1168900482 20:1359709-1359731 CAGGAGCTGCTGTGGTCAGTAGG - Intronic
1168954462 20:1825176-1825198 CAGGAGCTGTTGGGCAGTGTTGG - Intergenic
1169227511 20:3865679-3865701 TTGGAGCTGCTGGGGTCTCCTGG - Exonic
1170429761 20:16265262-16265284 AAGGAGGAGCTGGACTCTGTAGG - Intergenic
1170452542 20:16499174-16499196 AAAGAGATGCTGGGTTCTGTGGG - Intronic
1173451668 20:43169850-43169872 TAAGAGCTGCTGGCCACTGAAGG + Intronic
1175903116 20:62367620-62367642 GAGGAGCTGGTGGGCGCTCTGGG - Intergenic
1176103852 20:63376575-63376597 TGGGAGCTGCTGGCCTTTGCAGG + Intronic
1176148669 20:63577558-63577580 AAGGAGCTGCCGGGAGCTGTTGG - Intergenic
1178041275 21:28643118-28643140 TAGGAACTGGTGGGGACTGTGGG - Intergenic
1178476287 21:32940128-32940150 GGGGTGCTGCTGGCCTCTGTTGG + Intergenic
1180474130 22:15687870-15687892 AGGGAGCAGCTGGGCTCAGTGGG - Intergenic
1180597468 22:16988098-16988120 TGGGAGCAGCTGGGCTCAGCTGG + Exonic
1181111283 22:20604412-20604434 TAGGAGCCGTTGGTGTCTGTGGG + Intergenic
1181760760 22:25057295-25057317 CTGGAGCTCCGGGGCTCTGTGGG + Intronic
1182128567 22:27834398-27834420 CCGCAGCTTCTGGGCTCTGTGGG - Intergenic
1182712683 22:32332464-32332486 TCGGGGCAGCTGGGATCTGTAGG - Intergenic
1183382128 22:37495571-37495593 TAGGAGCTGCTGGGCTCTGTGGG + Exonic
1184248483 22:43247563-43247585 TGGGAGCTGCTGGGAGCTGCTGG + Intronic
1184272115 22:43390504-43390526 TATGATCTCCTGGTCTCTGTGGG + Intergenic
1185140141 22:49095521-49095543 TGTGAGCTGCTGGGCTGTGCTGG - Intergenic
950171743 3:10843592-10843614 TTGAAGCTGCTGAGCTCTTTGGG - Intronic
950882824 3:16336942-16336964 GAGGAGCTGCCGAGCTGTGTTGG - Intronic
952148965 3:30565753-30565775 TAGTACCTCCTGGCCTCTGTAGG + Intergenic
954135191 3:48579203-48579225 CAGGAGCCGCTGGGCCCTCTGGG - Exonic
954375955 3:50194260-50194282 GAGGAGCTGCTGGTCCCTGGAGG + Intronic
954840655 3:53508805-53508827 GAGAAGCTGTTGGGGTCTGTTGG - Intronic
954931047 3:54281458-54281480 GAGGAAGTGCTGGGCTCTGAGGG + Intronic
955421995 3:58748241-58748263 TAAGAGATTATGGGCTCTGTTGG - Intronic
959395884 3:105837903-105837925 TACGAGCTGCTGGGGCCTGGAGG - Intronic
959857235 3:111174023-111174045 TAGGATCTGGGTGGCTCTGTAGG + Intronic
961166197 3:124765512-124765534 AAGGAGCTGCTGTGTTCTGCAGG - Intronic
962367773 3:134797178-134797200 CAGGGACTGCTGGGCTTTGTAGG + Intronic
967063929 3:185897302-185897324 TCGGAGCTTCTTGGATCTGTGGG + Intergenic
968701919 4:2061446-2061468 CAAGGGCCGCTGGGCTCTGTGGG + Intronic
968729693 4:2263842-2263864 TGGGTCCTGCAGGGCTCTGTGGG - Intergenic
968757965 4:2426588-2426610 TAGGATCTGCTGGGGGCTGCTGG + Intronic
970604827 4:17669301-17669323 TATTTGCTGCTGGGCTTTGTGGG - Intronic
971024616 4:22576364-22576386 TTGGAACTTCTGTGCTCTGTTGG + Intergenic
971343136 4:25788904-25788926 TATGACCTGCTGAGCTCTGCTGG - Intronic
971925198 4:33000275-33000297 TAAGAGCTGCTGTGTTCTCTGGG + Intergenic
972264287 4:37444186-37444208 TATGAGCTGCAGGTGTCTGTTGG - Exonic
972991943 4:44831171-44831193 TAAGGGCAGCTGGGCTATGTGGG + Intergenic
974196373 4:58581073-58581095 TAGGATTTGCTTGGCTATGTGGG + Intergenic
975493922 4:75017302-75017324 TATGACCTGCTGAGCTTTGTAGG - Intronic
976670745 4:87649969-87649991 TTGGGTCTGCTGGGATCTGTCGG + Intergenic
978366566 4:107989478-107989500 TATGTGCTGCTTGGCTGTGTTGG - Intergenic
978690205 4:111499328-111499350 CAGAAGCTGCTGTGCTCTCTTGG - Intergenic
980731669 4:136832180-136832202 TAGTATCTGCTGGTGTCTGTTGG + Intergenic
981318288 4:143363340-143363362 TAAGAGCTCCTGGGTGCTGTGGG + Intronic
981474913 4:145179203-145179225 TATGCTCTGCTGGGCTGTGTAGG - Intronic
981760157 4:148185393-148185415 TAGGAGTTGCTCTACTCTGTAGG + Intronic
982136120 4:152275865-152275887 TGGTGGCTGCTGGGCTTTGTTGG - Intergenic
984352852 4:178618072-178618094 TAGGAGAGGCTGGGCTTTATGGG - Intergenic
985639408 5:1056699-1056721 TGGGGGCTCCTGGGCCCTGTGGG - Intronic
985678685 5:1245055-1245077 GAGGAGCTCCAGGGCCCTGTGGG - Intronic
986336868 5:6762072-6762094 TGGGAGCTGCAGGGCCCTGGGGG - Intergenic
988728634 5:33947972-33947994 GAGGAGATGCTGGGTGCTGTGGG - Intronic
989959312 5:50391650-50391672 TAGGATTGGCTTGGCTCTGTGGG - Intergenic
990983267 5:61620132-61620154 TAGGAGCTGGGGGGCACAGTGGG + Intergenic
997042664 5:130277088-130277110 TAGGGGCTGCTGGGCTCATTCGG + Intergenic
1002201178 5:177529330-177529352 AAGGAGCAGCTGGGCTTTGGTGG + Intronic
1002788798 6:423949-423971 CAGGAGGTGCTGGGCCCTGCTGG + Intergenic
1005075795 6:21905765-21905787 TGGCAGCTGCTGGGCTCATTTGG - Intergenic
1005856033 6:29863991-29864013 GAGGAGCTGCTGAGCTCTCCAGG - Intergenic
1010489089 6:76452736-76452758 TGGGAGCTGCTGGGCTTTACTGG + Intergenic
1011565227 6:88666047-88666069 TAGGAGCTGTGGGGTTCTGCAGG + Intronic
1012611824 6:101228032-101228054 TAGGAGCTGTGGGGTTCTGCAGG - Intergenic
1016995397 6:149959111-149959133 TAGGAGCAGCTGGTTTCTCTAGG + Intergenic
1017003214 6:150010393-150010415 TAGGAGCAGCTGGTTTCTCTAGG - Intergenic
1018095869 6:160386635-160386657 TGGGATCTGGAGGGCTCTGTGGG - Intronic
1018751143 6:166807591-166807613 TAGCACCTCCTGGCCTCTGTAGG - Intronic
1019015248 6:168875498-168875520 TAGGAGGTGCTGGGGTGTATCGG + Intergenic
1019015268 6:168875610-168875632 TAGGAGGTGCTGGGGTGTATTGG + Intergenic
1019015278 6:168875666-168875688 TAGGAGGTGCTGGGGTGTATCGG + Intergenic
1019015287 6:168875720-168875742 TAGGAGGTGCTGGGGTGTATCGG + Intergenic
1019015307 6:168875832-168875854 TAGGAGGTGCTGGGGTGTATTGG + Intergenic
1019368454 7:647421-647443 TGGGAGCTGCTGGGGGGTGTTGG - Intronic
1019624884 7:2011074-2011096 GGGGAGCACCTGGGCTCTGTGGG + Intronic
1019656312 7:2197960-2197982 GAGGGGCTGATGGGCCCTGTGGG - Intronic
1020070274 7:5222932-5222954 TGGGAGCTGCCGGGCACTGGAGG - Intronic
1020211352 7:6160018-6160040 TCGGAGCTGTGGGGCTTTGTTGG + Intronic
1021270451 7:18578111-18578133 TAGCAGCTGCAGGGAACTGTGGG + Intronic
1026467189 7:70664342-70664364 TGGCAGCTGTTGGACTCTGTGGG + Intronic
1026851452 7:73726058-73726080 CAGGGGCTGCTGGGGTCTGGAGG + Intergenic
1027231326 7:76274308-76274330 TGGGAGCTGCAGGGCTCTGGAGG + Intronic
1029273540 7:99391300-99391322 TGAGAGTTGCTGGGCTCTCTCGG - Intronic
1030396523 7:108993633-108993655 TAGGAACTTCTGGGCACTGGAGG - Intergenic
1034254912 7:149719651-149719673 TACGAGACGCTGGTCTCTGTGGG + Exonic
1034304490 7:150038527-150038549 TAGGAGCTGTGGGGTTTTGTAGG - Intergenic
1034801176 7:154057608-154057630 TAGGAGCTGTGGGGTTTTGTAGG + Intronic
1035761239 8:2070352-2070374 TGGCAGCTGCTGGCCGCTGTGGG + Intronic
1037721013 8:21444146-21444168 TAGGAGGTGCTGGGCACCGTGGG - Intergenic
1039580711 8:38664389-38664411 TTGGAGCTCCTGTGCTCTGTTGG + Intergenic
1040408721 8:47134044-47134066 AGGGAGCAGCTGGGCTCCGTGGG + Intergenic
1041030808 8:53733681-53733703 TAGGAGCTGTGGGGTTCTGCAGG + Intronic
1041718182 8:60950912-60950934 GAGGAGCTGCAGAGCTCTGCGGG + Intergenic
1041892586 8:62887373-62887395 TTGGAGCTTCTTGGATCTGTGGG + Intronic
1047305823 8:123652354-123652376 TCGGAGATGATGGGCTCTGTGGG - Exonic
1047627742 8:126673844-126673866 TGGGTGTTGGTGGGCTCTGTAGG + Intergenic
1048987836 8:139744796-139744818 GAGGAGCTGTTGGGCTCTCTTGG + Intronic
1049782787 8:144436403-144436425 TGGGAGCTGTGGGGATCTGTGGG + Exonic
1050337690 9:4605353-4605375 TTGGTGCAGCTGTGCTCTGTGGG + Exonic
1053785790 9:41652048-41652070 AAGGGGCTTCTGGGCTGTGTTGG - Intergenic
1054159252 9:61662129-61662151 AAGGGGCTTCTGGGCTGTGTTGG + Exonic
1054174503 9:61866011-61866033 AAGGGGCTTCTGGGCTGTGTTGG - Intergenic
1054449361 9:65395059-65395081 AAGGGGCTTCTGGGCTGTGTTGG - Intergenic
1054479026 9:65593134-65593156 AAGGGGCTTCTGGGCTGTGTTGG + Intergenic
1054663035 9:67714780-67714802 AAGGGGCTTCTGGGCTGTGTTGG + Intergenic
1054731368 9:68705384-68705406 TCGGAGCTGCTGGGCTTTGGCGG + Intergenic
1056939245 9:90941177-90941199 TGGGAGCTGCTGAGCTCCTTGGG - Intergenic
1057809685 9:98248284-98248306 TGGGAAGTGCTGGTCTCTGTTGG - Intronic
1059090056 9:111346954-111346976 TAGAAGCTGCTGGGGTCTGTAGG - Intergenic
1059123296 9:111661593-111661615 TAGGGGCTGCTGGGCCCGGCCGG - Exonic
1062212661 9:135373088-135373110 TGGGTGCTGCTGGGCACTGATGG - Intergenic
1062452019 9:136619802-136619824 CTGAAGCAGCTGGGCTCTGTGGG - Intergenic
1062523582 9:136969529-136969551 TGGGAGCTGGTGGTCTCTGCGGG + Intronic
1062710120 9:137970973-137970995 CAGATGCTGCAGGGCTCTGTGGG + Intronic
1185514611 X:690143-690165 TAGGAGCTTCTGAGCTTAGTAGG + Intergenic
1185576553 X:1179233-1179255 TAAGACGTGCTGAGCTCTGTGGG - Intergenic
1185634766 X:1543586-1543608 TTGGTGCTGCTGGGTTTTGTGGG + Intergenic
1185877403 X:3712590-3712612 CAGGAGCAGCTGGGCTGTGGGGG - Intronic
1187932101 X:24302922-24302944 TTCCAGCTGCTGGCCTCTGTTGG + Intergenic
1187999572 X:24967883-24967905 TTGGAGCTGCTCAGCTCAGTTGG + Intronic
1188242450 X:27808819-27808841 GAGCAGAGGCTGGGCTCTGTGGG - Intronic
1190224425 X:48534360-48534382 TAGGAGTTGATGGGGTATGTGGG - Intergenic
1194911961 X:99656463-99656485 CAGGAGGGGCTGGGCCCTGTAGG + Intergenic
1197533919 X:127663879-127663901 GAGGAGTTGCTGGGCTGAGTAGG + Intergenic
1197626533 X:128808287-128808309 TAGGAGCAGCTGAGGTCAGTGGG + Intergenic
1199783316 X:151082674-151082696 CGGGAGCTGCTGCGCTCTCTTGG - Intergenic
1200038073 X:153346088-153346110 GAGGATCAGCTGGGCTCTCTGGG + Intronic
1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG + Intergenic
1202369059 Y:24185259-24185281 AAGCAGCTGCTGGGGCCTGTGGG - Intergenic
1202501726 Y:25484858-25484880 AAGCAGCTGCTGGGGCCTGTGGG + Intergenic