ID: 1183390182

View in Genome Browser
Species Human (GRCh38)
Location 22:37541273-37541295
Sequence CAGAAGTGGCAGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183390177_1183390182 -2 Left 1183390177 22:37541252-37541274 CCAGATGGGAGAAGAACCATTCA No data
Right 1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG No data
1183390171_1183390182 25 Left 1183390171 22:37541225-37541247 CCAGCTCACGGATGGGAAAACCA No data
Right 1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG No data
1183390175_1183390182 5 Left 1183390175 22:37541245-37541267 CCAAGGCCCAGATGGGAGAAGAA No data
Right 1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG No data
1183390176_1183390182 -1 Left 1183390176 22:37541251-37541273 CCCAGATGGGAGAAGAACCATTC No data
Right 1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183390182 Original CRISPR CAGAAGTGGCAGAAGGAGGC CGG Intergenic
No off target data available for this crispr