ID: 1183396744

View in Genome Browser
Species Human (GRCh38)
Location 22:37575998-37576020
Sequence ACCAAGAATGTCTCCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 22, 2: 60, 3: 99, 4: 272}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183396736_1183396744 16 Left 1183396736 22:37575959-37575981 CCACTGGATGTCAGTGACACCCT 0: 1
1: 0
2: 5
3: 46
4: 323
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396738_1183396744 -3 Left 1183396738 22:37575978-37576000 CCCTCCCCTGAGCGGTGACAACC 0: 1
1: 0
2: 4
3: 24
4: 177
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396740_1183396744 -7 Left 1183396740 22:37575982-37576004 CCCCTGAGCGGTGACAACCAAGA 0: 1
1: 0
2: 1
3: 22
4: 161
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396733_1183396744 28 Left 1183396733 22:37575947-37575969 CCTGGCCTCTACCCACTGGATGT 0: 3
1: 46
2: 332
3: 840
4: 1421
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396742_1183396744 -9 Left 1183396742 22:37575984-37576006 CCTGAGCGGTGACAACCAAGAAT 0: 1
1: 0
2: 2
3: 87
4: 386
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396741_1183396744 -8 Left 1183396741 22:37575983-37576005 CCCTGAGCGGTGACAACCAAGAA 0: 1
1: 0
2: 1
3: 35
4: 190
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396739_1183396744 -4 Left 1183396739 22:37575979-37576001 CCTCCCCTGAGCGGTGACAACCA 0: 1
1: 0
2: 4
3: 35
4: 182
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396734_1183396744 23 Left 1183396734 22:37575952-37575974 CCTCTACCCACTGGATGTCAGTG 0: 1
1: 5
2: 84
3: 448
4: 1109
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272
1183396735_1183396744 17 Left 1183396735 22:37575958-37575980 CCCACTGGATGTCAGTGACACCC 0: 1
1: 1
2: 5
3: 87
4: 490
Right 1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG 0: 1
1: 22
2: 60
3: 99
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183396744 Original CRISPR ACCAAGAATGTCTCCAGACA GGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
903078328 1:20788805-20788827 ACCAAGATTGTTTTGAGACAGGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
905251540 1:36651973-36651995 ACCACTAATGACTCCAGTCAAGG + Intergenic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905460877 1:38122150-38122172 GCCATGAATGTGTCCAGACTAGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907239594 1:53074214-53074236 GCCAGGAATGGCTCCACACAGGG - Intronic
910293736 1:85623742-85623764 ACCAAGAATGTGGCCAGGCATGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916344355 1:163771277-163771299 ATCAAGAAGGGCTCCACACATGG + Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
919647615 1:200111074-200111096 AACAAGAAAGTCTCCACCCATGG - Intronic
920707997 1:208268919-208268941 ACCAGCCTTGTCTCCAGACAGGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921192015 1:212718688-212718710 ATCAAGAAAGTCTCCATAGAGGG - Intergenic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
923311648 1:232741304-232741326 ACCAAGATTTATTCCAGACAGGG + Intergenic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
1064184670 10:13151047-13151069 ATCAAGAATGTAACCAGACTTGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1067031858 10:42883549-42883571 ACCTAGCATGTCCCCAGGCATGG + Intergenic
1067345645 10:45436937-45436959 CCAAAGAATGTATCCAGCCAAGG - Intronic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1071538681 10:86458306-86458328 CCCAAGTATGTCTCCAGTCCTGG - Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072289667 10:93952523-93952545 ACCAACCAAGTCTCCCGACATGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1072894115 10:99350963-99350985 AACCAGATTGTCTCCATACATGG + Intronic
1073973795 10:109076246-109076268 TCCAAGTATGACTCCAGAGAAGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074228194 10:111508025-111508047 ACTAATAATGTCTTCAGAGATGG - Intergenic
1074259738 10:111839985-111840007 GCCAAGAGTTTTTCCAGACAGGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1084931281 11:72558195-72558217 ACCAAGAATGTGTCCCTACCTGG - Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086915679 11:92527615-92527637 AACAAGAATTTCACCAGACTTGG - Intronic
1087509225 11:99068999-99069021 ACCATGAATGATGCCAGACAAGG - Intronic
1087823427 11:102737335-102737357 CCCAAGACTGTCTCCAGATGGGG - Intergenic
1088146255 11:106683574-106683596 ACCCAGAATGGCTACAGAAAGGG - Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088531982 11:110820284-110820306 ACCTAGAATTTCTCCAGCCCAGG - Intergenic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090064600 11:123492011-123492033 ACCTACAATATCTCCAAACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1098714296 12:73810209-73810231 ACTAGGAATATCTCCAGACCTGG + Intergenic
1099398365 12:82170179-82170201 AGCAAGAAAGTCTGAAGACATGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1100536475 12:95515276-95515298 ACCTAGATTGTTTCCCGACAAGG - Exonic
1100829741 12:98506782-98506804 ACCAAGGATGTGTGCACACAGGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103412043 12:120719383-120719405 ACCCAGAAGGTCTCCGGAGAAGG + Intronic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105412077 13:20178654-20178676 AACAAGTAAGTCTCCAGACCGGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1106838402 13:33660737-33660759 ATAAAGAATGTAGCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1113679051 13:112229630-112229652 ACCAGGAAGGACTCCAGAGAGGG + Intergenic
1114491776 14:23106881-23106903 ACCAAGAATGTAACCACACCTGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115137283 14:30126104-30126126 AGCAAGAATCTCTTCAAACATGG + Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117328648 14:54691257-54691279 AGGGATAATGTCTCCAGACAAGG - Intronic
1119118582 14:72051373-72051395 ACCAAGAATTTATACAGCCATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120416522 14:84225715-84225737 ACCAAGAATGTTTCTCAACAGGG - Intergenic
1120455087 14:84719640-84719662 ACCCAGAATGTGTCTAGGCATGG - Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1121954222 14:98199399-98199421 ACCAAGAATATGACCAGGCATGG + Intergenic
1122868002 14:104617965-104617987 AGCAAGAATGGCTCCAGTGATGG - Intergenic
1123073099 14:105651750-105651772 GCAAAGACTGTTTCCAGACAAGG + Intergenic
1123107446 14:105849239-105849261 GCAAAGACTGTTTCCAGACAAGG - Intergenic
1125246712 15:37648945-37648967 ACTAAGAAATTCTCCAGAAATGG + Intergenic
1126022996 15:44420446-44420468 AGCAAGACTGTCTCCAGGCCGGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137779091 16:51081944-51081966 ACCAAGTATGAATGCAGACAGGG + Intergenic
1138661440 16:58520559-58520581 ACCAGGAATGTCAGAAGACATGG + Exonic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1142016409 16:87750563-87750585 ACGAAGAATGGTTCCACACAGGG + Intronic
1143662274 17:8333063-8333085 ACCAGGGCTGTCTCCAGACTAGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144288968 17:13807216-13807238 ACCAGGGCTTTCTCCAGACATGG - Intergenic
1144398244 17:14867115-14867137 AGGAAGAGGGTCTCCAGACAGGG + Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1151731008 17:75911062-75911084 ACAAGGAATGTTTACAGACAAGG - Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152553233 17:81040206-81040228 TCAAAGAAAGTCACCAGACAAGG - Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1155007783 18:21743723-21743745 ACCAAGAATTCCTCCAAATAAGG - Intronic
1155314921 18:24562069-24562091 AACAAGACTGATTCCAGACATGG - Intergenic
1156666578 18:39415576-39415598 TCCAAGTATGTCTCCACAAAAGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161314196 19:3610310-3610332 ACCACGAATGCCCCCAGGCATGG + Intergenic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161444056 19:4308112-4308134 ACCAAGAAAGTGTCCAGGCCGGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161827057 19:6575032-6575054 ACAATGAATGACTCCAGCCATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165576687 19:36825645-36825667 ACCAAGAAAGAATCCAGAGAAGG - Exonic
1167001493 19:46747793-46747815 AGCATGAATGTGTCCAGAAAAGG - Intronic
1167111096 19:47461864-47461886 ACTAAGAATGTGTCCAGCCTGGG + Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
1168591144 19:57635001-57635023 ATCTAGAAAGTCACCAGACAGGG - Intronic
927250377 2:20990954-20990976 ACAAAGAATCTGTCCAGACCAGG - Intergenic
928902918 2:36340417-36340439 CAAAAGAATGTCTTCAGACATGG + Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
934050839 2:88209527-88209549 ACCAAGCATTTCTCCAGTCTTGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937240947 2:120462333-120462355 ACCTTGAATGCCTCCAGAGATGG + Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937345750 2:121124378-121124400 ATCTAGAGTGTCTCCAGCCAAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937819967 2:126299088-126299110 AAAAAGAATGTTTCCATACATGG - Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
941684300 2:168432011-168432033 ACGAAGATTGTCACCAGCCAAGG - Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
942926371 2:181437940-181437962 ACCATGACAGTATCCAGACAGGG + Intergenic
943002811 2:182350459-182350481 ACAAAGAATGGCTACATACAAGG + Intronic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946109248 2:217399507-217399529 ACCAGGAATTTCTCCTGACTGGG - Intronic
946623927 2:221590975-221590997 ACCAAGAAATTCTGGAGACACGG + Intergenic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948337240 2:237219155-237219177 ACAAAGAATGTCCCAAGACTAGG - Intergenic
948475243 2:238214106-238214128 AGCAAGACTGTCTCCAAAAAAGG - Intergenic
1169849075 20:10031133-10031155 ACCAACTTTGTCTCCAAACATGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171343007 20:24445203-24445225 CCCAAGAATGTAGCCAGACTGGG + Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172860129 20:38043047-38043069 GCCAAGTATGGATCCAGACACGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174502771 20:50997673-50997695 CCCATGACAGTCTCCAGACAGGG + Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1178497976 21:33102923-33102945 ACCAATAATTTCACCAGCCAGGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182521189 22:30885311-30885333 TTCAAGAATGTGTCCAGAAAGGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
949923888 3:9025471-9025493 CCTATGAATGTCTCCAGAAATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952246176 3:31595005-31595027 ACCAATAAAGTCTCCATAAAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
958558922 3:95718038-95718060 ACCAAGAATGTCTGCAATTATGG + Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963237512 3:142970336-142970358 CCCAGTACTGTCTCCAGACAGGG - Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965208008 3:165746845-165746867 ACAAAGAACGTTTCAAGACATGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967984597 3:195085645-195085667 ACTAGGATTGTCACCAGACACGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
973200702 4:47498537-47498559 ACCAAGTATATCTCCAGCAAAGG + Intronic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977060188 4:92249378-92249400 ATCAAGAATGTAACCAGATAAGG + Intergenic
978207625 4:106097422-106097444 AGCATGAATGTCTGTAGACATGG + Intronic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
981493352 4:145364929-145364951 ACAAAGAATGTCAGAAGACAGGG + Intergenic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983790523 4:171792063-171792085 TCCAATGATGTCTCCAGAAAAGG - Intergenic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
986596636 5:9429607-9429629 ATCAGGAATATCTCCTGACAAGG + Intronic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987086674 5:14476323-14476345 ACCAGGAAGGTCACCAGCCAAGG + Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988302984 5:29457012-29457034 ACCAAGAATATCTGCACACTTGG - Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989438466 5:41441834-41441856 ACCCAGGTTGTCTCCACACATGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994550714 5:101231539-101231561 ACCAAGACTGGCTACAAACAAGG - Intergenic
994814661 5:104569779-104569801 CCAAAGAATGCCTTCAGACAGGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996686488 5:126287215-126287237 ACCAAGGATGTTTCTAGATACGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999553170 5:152712382-152712404 ACCAATAATGATTCCAGAGATGG - Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001434021 5:171685626-171685648 ACCAAGAGGGTCCCCAGACTTGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005392306 6:25345910-25345932 ATCAAGAATGACACCAGACTGGG - Intronic
1006410660 6:33871483-33871505 AACAAGAGGGTCTCCAGGCATGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1006966463 6:37990924-37990946 ACAAAGAATGACCCCAGGCATGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008807963 6:55454679-55454701 ACTAAGAATGTTTGCAGACCAGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009406350 6:63318198-63318220 ACAAAGAATTTCTTCAGACTGGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1011810579 6:91128130-91128152 ACCATGAATGTCACCTTACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015355058 6:132268222-132268244 ACTAAGAAAGTCTCCAAAAAAGG - Intergenic
1015391337 6:132685830-132685852 ACGGAGAATGTTTCCAGAGAGGG + Intronic
1015765396 6:136710795-136710817 ACCCAGAAAGTCACCAGCCAGGG - Intronic
1017292321 6:152753591-152753613 TCAAAGAATGTCTCCATAGATGG - Intronic
1018344740 6:162888660-162888682 ACCAAGTGTGTCTTCAGAAAGGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021024925 7:15653933-15653955 AACAAGAATTTCTGTAGACATGG - Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023528882 7:41133232-41133254 ACCAAGAATATCCAGAGACAAGG + Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026470308 7:70689443-70689465 GCAAAGAATCCCTCCAGACAGGG - Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028759144 7:94475552-94475574 GGCAGGAATGTCTGCAGACAAGG + Intergenic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030872983 7:114780657-114780679 AGCAAGGATGGCTCCAAACAGGG - Intergenic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1034295547 7:149968911-149968933 CCCAAGAACGTCTCCACAGAGGG - Intergenic
1034810512 7:154128019-154128041 CCCAAGAACGTCTCCACAGAGGG + Intronic
1035791345 8:2308097-2308119 AACAAGAATGTCTCCTTTCATGG + Intergenic
1035801460 8:2413608-2413630 AACAAGAATGTCTCCTTTCATGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037818189 8:22122789-22122811 ACCCAGTTTGTCTCCAGCCAGGG - Exonic
1038620410 8:29137429-29137451 CCCAGGAATGTCTGCAGGCACGG + Intronic
1040412489 8:47168510-47168532 AGCAAGAATGTCTCCATCCAAGG - Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1048561901 8:135548186-135548208 ACCAAGCACTTCTCTAGACATGG + Intronic
1048668006 8:136686057-136686079 TCTAAGAATCTCTCCATACATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1052848552 9:33360149-33360171 ACACAGAAGGTCTCCAAACATGG + Intronic
1053043009 9:34890678-34890700 CCAAAGAATATCTCCACACAGGG - Intergenic
1054849854 9:69836433-69836455 CGCAACAATGTCTCCAGGCATGG + Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061619630 9:131803476-131803498 ACAAAGAATGGCTCCATCCAAGG - Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061958776 9:133977470-133977492 ACACAGAATGTTGCCAGACAAGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186077111 X:5892709-5892731 AGAAAGAAAGTCTCCAGACCAGG - Exonic
1186132884 X:6487802-6487824 TCCAAGCATATTTCCAGACATGG + Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187247485 X:17565938-17565960 ACCAAGAATTTCTTCACAAATGG + Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188673209 X:32905873-32905895 ACTAGGAATCTCTCCGGACATGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189550506 X:42087645-42087667 ACCAATCATGTCACCAAACAAGG - Intergenic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1193985699 X:88238048-88238070 ACCAGGGAAGACTCCAGACAGGG - Intergenic
1194269236 X:91789510-91789532 ACTAAGAAAGGCTGCAGACAAGG - Intronic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1194498915 X:94655887-94655909 ACCAAGAATGTAATCAGACCTGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199952610 X:152717388-152717410 GCCAAGAATGTTTCCCGACCTGG + Exonic
1199957073 X:152751060-152751082 GCCAAGAATGTTTCCCGACCTGG - Intronic
1200586454 Y:5010499-5010521 ACTAAGAAAGGCTGCAGACAAGG - Intronic
1200750686 Y:6941693-6941715 ACCAAGAAATACTCCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic