ID: 1183398281

View in Genome Browser
Species Human (GRCh38)
Location 22:37585749-37585771
Sequence CAGTGTGGCCAGGGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183398281_1183398288 4 Left 1183398281 22:37585749-37585771 CCACCTGCCCCCTGGCCACACTG No data
Right 1183398288 22:37585776-37585798 CTCTATCCCTTGAATTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183398281 Original CRISPR CAGTGTGGCCAGGGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr